NOVEL CORONAVIRUS RAPID DETECTION KIT BASED ON THERMAL CONVECTION PCR
20230203575 · 2023-06-29
Inventors
- Xiwen JIANG (Guangzhou, Guangdong, CN)
- Taosheng HUANG (Guangzhou, Guangdong, CN)
- Zhuojian LU (Guangzhou, Guangdong, CN)
- Qixian CHEN (Guangzhou, Guangdong, CN)
- Weiping LIN (Guangzhou, Guangdong, CN)
Cpc classification
G01N21/6428
PHYSICS
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q2537/143
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a novel coronavirus rapid detection kit based on thermal convection PCR and a method for multiple detection of novel coronavirus nucleic acid. The kit comprises a combination of primers and probes for detecting N genes and ORFlab genes of a novel coronavirus genome.
Claims
1-10. (canceled)
11. A kit for detection of novel coronavirus nucleic acid, which comprises a primer pair set; wherein the primer pair set comprises a first primer pair and a second primer pair; wherein the first primer pair comprises: a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2, and the second primer pair comprises: a forward primer as shown in SEQ ID NO.4 and a reverse primer as shown in SEQ ID NO.5.
12. The kit of claim 11, wherein the kit further comprises a probe set; wherein the probe set comprises the first probe whose nucleotide sequence is as shown in SEQ ID NO.3 and the second probe whose nucleotide sequence is shown in SEQ ID NO.6.
13. The kit of claim 11, wherein the primer pair set further comprises an internal standard primer pair, and the internal standard primer pair comprises: a forward primer as shown in SEQ ID NO.7 and a reverse primer as shown in SEQ ID NO.8.
14. The kit of claim 12, wherein the probe set comprises an internal standard probe whose nucleotide sequence is shown in SEQ ID NO.9.
15. The kit of claim 14, wherein the 5′ end of each probe is labeled with a fluorescent reporter group; and, the 3′ end of each probe is labeled with a fluorescence quenching group.
16. The kit of claim 15, wherein the fluorescent reporter groups labeled on the probes are different from each other.
17. The kit of claim 11, wherein the kit includes a first container, and the first container contains a primer-probe mixture, and the primer-probe mixture contains polynucleotides whose sequences are shown in SEQ ID NOs.1-6.
18. The kit of claim 17, wherein the primer-probe mixture further comprises polynucleotides whose sequences are shown in SEQ ID NOs.7-9.
19. The kit of claim 17, wherein the kit further includes a second container, and the second container contains a PCR enzyme system including a Hot-start enzyme and a Reverse transcriptase C-MMLV.
20. The kit of claim 19, wherein the first container further contains dNTPs.
21. A method for multiplex detection of novel coronavirus nucleic acid, wherein the method comprising the steps of: (1) providing nucleic acid samples of the subject to be tested; (2) preparing PCR reaction system and perform PCR detection: wherein, the PCR reaction system includes: the nucleic acid sample provided in step (1), primer pair set and probe set; wherein the primer pair set comprises a first primer pair and a second primer pair; wherein the first primer pair comprises: a forward primer as shown in SEQ ID NO.1 and a reverse prime as shown in SEQ ID NO.2, and the second primer pair comprises: a forward primer as shown in SEQ ID NO.4 and a reverse primer as shown in SEQ ID NO.5; wherein the probe set comprises a first probe whose nucleotide sequence is shown in SEQ ID NO.3, and a second probe whose nucleotide sequence is shown in SEQ ID NO.6.
22. The method of claim 21, wherein the nucleic acid sample is derived from an environmental sample.
23. The method of claim 21, wherein the PCR detection in step (2) is thermal convection PCR.
Description
DESCRIPTION OF DRAWINGS
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
DETAILED DESCRIPTION OF INVENTION
[0047] Through extensive and intensive research, the inventors obtained a kit and method for rapid detection of novel coronavirus nucleic acid. After several rounds of screening and verification, the present invention obtains a primer-probe combination with high sensitivity, strong specificity and good repeatability from a large number of primer-probe combinations, which is suitable for thermal convection PCR and ordinary fluorescent quantitative PCR, and capable of multiple detection. Using the kit and detection method of the present invention, based on thermal convection PCR, the ultra-fast PCR amplification detection of 50 cycles can be completed in 18 minutes, and the detection sensitivity is equivalent to that of ordinary fluorescent quantitative PCR.
[0048] Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions as described, due to such methods and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, and the scope of the present invention will be limited only by the appended claims.
[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to specifically recited value, the term “about” means that the value may vary from the recited value by no more than 1%. For example, as used herein, the expression “about 100” includes all values between 99 and 101 and (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0050] Although any methods and materials similar or equivalent to those described in the present invention can be used in the practice or testing of the present invention, the preferred methods and materials are exemplified herein.
[0051] Thermal Convection PCR
[0052] Thermal convection PCR is in a closed space, keeping the temperature of its upper and lower surfaces constant, resulting in a regular scrolling pattern phenomenon in which hot fluid rises and cold fluid descends. The heat convection caused by the density change of the fluid in the space caused by the temperature difference between the upper and lower sides is applied to DNA amplification. The lower part of the capillary tube is subjected to constant heating causing the denaturation reaction of the sample at the bottom. At the same time, its density becomes smaller, and the buoyancy gradually increases. When the buoyancy is greater than the viscous force and gravity the sample at the bottom floats upward and rises to a lower temperature region near the top of the tube. The sample undergoes annealing and extension reactions, while being affected by cooling. The density becomes greater again and begins to sink slowly. And the heating and cooling process is repeated. In this way, PCR reactions are achieved by thermal convection.
[0053] However, there are also many difficulties in achieving stable amplification using thermal convection PCR. For example, it is difficult to ensure that the thermal convection fluid path is regular, which leads to the inability to ensure that the reaction reagents can fully complete the three steps of deformation, annealing and extension which in turn leads to problems such as low amplification efficiency, poor amplification specificity, and large differences between tubes. Therefore, the design of specific reagents especially primers and probes is more demanding in thermal convection PCR
[0054] The thermal convection PCR equipment currently available in the market includes the POCKIT™ nucleic acid analyzer developed by Taiwan GeneReach Biotechnology Corporation and the thermal convection PCR detector developed by Achem Biosystems (Korea).
[0055] Multiplex PCR
[0056] Multiplex PCR, also known as multiple primers PCR or complex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments. The reaction principle, reaction reagents and operation process are the same as general PCR.
[0057] There are many factors that affect multiplex PCR reactions, such as:
[0058] (1) The imbalance of the reaction system. The imbalance of the reaction system leads to the rapid amplification of certain dominant primers and their templates in the previous rounds of reactions, and a large number of amplification products are obtained, and these amplification products are also good inhibitors of DNA polymerase. Therefore, as a large number of amplification products appear, the polymerization ability of the polymerase is more and more strongly inhibited. Therefore, the primers and their templates that are at a disadvantage in the early stage are more difficult to react, resulting in a very small amount of amplification product that cannot be detected.
[0059] (2) Primer specificity. If the primer has stronger binding ability with other non-target gene fragments in the system, the ability of the target gene to bind to the primer will be contested, resulting in a decrease in amplification efficiency.
[0060] (3) The optimal annealing temperature is inconsistent. Multiple pairs of primers are put into a system for amplification. Since the annealing temperature for PCR reaction is the same, the optimal annealing temperature of each pair of primers is required to be close.
[0061] (4) Primer dimers, including the dimers between primers and the hairpin structure formed by the primers themselves, and there is also a third-party DNA-mediated polymer. Like non-specific primers, these dimers will interfere with the competition between the primer and the target binding site, affecting the amplification efficiency.
[0062] Although several factors affecting the efficiency of amplification are mentioned as above, more factors are unclear. So far, there is no effective method that can clearly predict the amplification efficiency.
[0063] The Kit
[0064] The present invention provides a kit for specifically detecting the novel coronavirus nucleic acid in a sample, including a combination of primers and probes for detecting N gene, wherein the primer sequences for detecting the N gene are:
TABLE-US-00001 SEQ ID NO. 1: GGGGAACTTCTCCTGCTAGAAT and SEQ ID NO. 2: CAGACATTTTGCTCTCAAGCTG,
[0065] and the corresponding detection probe sequence is SEQ ID NO.3: TTGCTGCTGCTTGACAGATT.
[0066] In one embodiment, the kit further includes a combination of primers and probes for detecting the ORFlab gene, wherein the primer sequence for detecting the ORFlab gene are:
TABLE-US-00002 SEQ ID NO. 4.: CCCTGTGGGTTTTACACTTAA SEQ ID NO. 5: ACGATTGTGCATCAGCTGA,
[0067] and the sequence of the corresponding detection probe is SEQ ID NO. 6: CCGTCTGCGGTATGTGGAAAGGTTATGG.
[0068] In one embodiment, the kit further includes internal standard quality control amplification primers and detection probes; and the sequences of the internal standard quality control amplification primers are:
TABLE-US-00003 SEQ ID NO. 7: CTCCGTACACTCTCCTACCCTC SEQ ID NO. 8: ACACCTCTGGATGCCACT,
[0069] and the sequence of the corresponding detection probe is SEQ ID NO. 9: CCATTGCCAGTCCGCCGTC.
[0070] In a preferred embodiment of the present invention, the 5′ end of each probe is labeled with a fluorescent reporter group; and/or, the 3′ end of each probe is labeled with a fluorescence quenching group.
[0071] In another preferred embodiment, the fluorescent reporter groups labeled on the probes are different from each other.
[0072] Preferably, the fluorescent group is selected from the group consisting of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5.
[0073] Preferably, the quenching group is selected from the group consisting of MGB, BHQ-1, BHQ-2, and BHQ-3.
[0074] In one embodiment, the kit includes a positive quality control (Including pseudoviruses containing target fragments and pseudoviruses containing internal standard fragments) and a negative quality control (Pseudovirus with internal standard fragment).
[0075] In one embodiment, the kit includes PCR reaction solution A and PCR reaction solution B, wherein PCR reaction solution A includes specific primers and probes (SEQ ID NO.: 1-9), Tris-HCl Buffer, Mg.sup.2+ and dNTPs; PCR reaction solution B includes Hot start Taq enzyme, C-MMLV enzyme.
[0076] For the gene sequence of the novel coronavirus in the present invention, please refers to GISAID: BetaCov/Wuhan/WH01/2019| EPI_ISL_406798. For the oligonucleotide sequence information of its E gene, please refer to the Reference Roujian Lu, Xiang Zhao, Juan Li, et. al, Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020 Jan. 30.
[0077] In present invention, the specific primers and probes are screened by a large number of tests, and then combined, optimized and verified and finally dual primer-probe combinations that will not interfere with each other, have high amplification efficiency, and have good specificity are finally screened.
[0078] Detection Methods
[0079] 1. Sample Processing and Nucleic Acid Extraction
[0080] It is recommended to take 200 μl liquid sample for nucleic acid extraction. Nucleic acid extraction or purification kits (Magnetic Bead Method) produced by Sun Yat-Sen University Daan Gene Co., Ltd. can be used (Yuesuixiebei No. 20170583 and Yuesuixiebei No. 20150302), and other commercial products can also be used, and the specific operation steps should be carried out according to the instructions of the kit.
[0081] Both the negative and positive quality controls in this kit are involved in the extraction.
[0082] 2. Preparation of PCR Reagent
[0083] Take out NC(ORFlab/N) PCR reaction solution A and NC(ORFlab/N) PCR reaction solution B from the kit, thaw at room temperature, shake and mix well, and centrifuge at 8000 rpm for a few seconds before use.
[0084] Take N+1 (N=number of samples to be tested+NC(ORFlab/N) negative quality control+NC(ORFlab/N) positive quality control) PCR reaction tubes.
[0085] The single-person amplification system is prepared in the following table:
TABLE-US-00004 NC(ORF1ab/N) PCR NC(ORF1ab/N) PCR Amplification reaction solution A reaction solution B system 12 μl 3 μl 15 μl
[0086] Take N+1 dedicated PCR reaction tubes, and use a narrow-mouth pipette tip to aliquot the PCR reagents (15 μl per tube). After the aliquoting is completed, use a centrifuge at 8000 rpm for 1 min to allow the PCR reaction solution to flow into the bottom of the PCR reaction tube.
[0087] 3. Add Sample
[0088] The PCR reaction tubes were added with the extracted DNA samples, negative quality control products and positive quality control products of 5 μl respectively. Cover the tube cap tightly and centrifuge at 8000 rpm for 3 minutes. After centrifugation, observe whether there are visible bubbles remaining in the reaction tube. Repeat centrifugation if necessary. If there are no visible bubbles, each reaction tube was placed into a portable rapid PCR instrument (Achem Biosystems (Korea)).
[0089] 4. PCR Amplification
[0090] The program was set as follows: first perform reverse transcription at 50° C. for 4 minutes, and then perform 50 cycles of thermal convection PCR reaction at 95° C.
[0091] Select the FAM channel, VIC channel, and CY5 channel for detection.
[0092] 5. Result Analysis and Judgment
[0093] When the instrument was normal, and the NC (ORFlab/N) positive quality control and NC (ORFlab/N) negative quality control were both normal, the result analysis was performed.
[0094] FAM Channel and VIC Channel:
[0095] 5.1 Positive: If the test results of the FAM channel and VIC channel of the sample to be tested were Ct≤40 and the curve was S-shaped or there was an obvious exponential growth period, or the FAM channel and VIC had one Ct≤40 and the other Ct≤45, it was judged as 2019 novel coronavirus (2019-nCoV) positive;
[0096] 5.2 Suspicious: The test results of the FAM channel and VIC channel of the sample to be tested are both 40≤Ct≤45. At this time, the sample should be tested repeatedly. If the Ct value of the rereading result still exists in the same range, the curve was S-shaped or has an obvious exponential expansion period, it was judged that the 2019 novel coronavirus (2019-nCoV) was positive, otherwise the 2019 novel coronavirus (2019-nCoV) was negative;
[0097] 5.3 Negative: If the test results of the FAM channel and VIC channel of the sample to be tested are Ct≥45 or no Ct detection, the results were judged to be negative for 2019 novel coronavirus (2019-nCoV).
[0098] 6. Quality Control
[0099] 6.1 NC (ORFlab/N) negative quality control: FAM and VIC detection channels had no obvious amplification curves, but Cy5 channel had obvious amplification curves;
[0100] 6.2 NC (ORFlab/N) positive quality control: FAM and VIC detection channels had obvious amplification curves and Ct value≤32, and Cy5 channel had an amplification curve or no;
[0101] The experiment was valid if all the above conditions are met at the same time. Otherwise, all the experiments should be repeated.
[0102] 7. Interpretation of Test Results
[0103] 7.1 Negative quality control products and positive quality control products need to be tested for each experiment, and the test results could only be judged when the results of the quality control products meet the quality control requirements.
[0104] 7.2 When the detection channel of FAM and VIC was positive, the result of Cy5 channel (internal standard channel) may be negative due to the competition of the system.
[0105] 7.3 When the internal standard result was negative, if the FAM and VIC detection channels of the detection tube were also negative, it means that the system is inhibited or the operation is wrong. The test is invalid, and the sample needs to be re-examined.
[0106] 7.4 The following formats of the report were recommended:
[0107] The negative result were reported in the following format: 2019 Novel Coronavirus (2019-nCoV) RNA was not detected in the sample, and the concentration was lower than the sensitivity of the kit;
[0108] The positive result were reported in the following format: 2019 novel coronavirus (2019-nCoV) RNA was detected in the sample.
[0109] 7.5 Experimental results showed that the kit of the present invention had a good detection effect, and the detection results were basically not much different from ordinary fluorescent PCR. The detection limit concentration was 300 copies/ml.
[0110] The beneficial effects of the present invention include:
[0111] (1) Using the kit and detection method of the present invention, based on thermal convection PCR, the ultra-fast PCR amplification detection of 50 cycles can be completed in 18 minutes, and the detection sensitivity is equivalent to that of ordinary fluorescent quantitative PCR, and the sensitivity can reach 300 copies/ml. Combined with the direct expansion cracking method, the overall detection time does not exceed 30 minutes, which is about 1.5 hours faster than the existing known rapid detection equipment.
[0112] (2) The present invention can detect novel coronavirus-infected patients with high efficiency, high specificity and low cost by targeted detection of the N gene and ORFlab gene of the novel coronavirus. It also prevents false negatives that may occur due to virus variability, and confirms missed detections that may be caused by mutations, which significantly improves the accuracy of virus identification.
[0113] (3) The detection kit of the present invention also includes a novel coronavirus N gene and ORFlab gene nucleic acid target detection system and an endogenous internal standard detection system. And the present invention is a multiplex fluorescence detection kit, which can monitor the specimen collection, nucleic acid extraction process and PCR amplification process to reduce the occurrence of false negative results.
[0114] (4) After multiple rounds of screening and verification, the present invention obtains a primer-probe combination with high sensitivity, strong specificity and good repeatability from a large number of primer-probe combinations, which is suitable for thermal convection PCR and ordinary fluorescent quantitative PCR, and capable of multiple detection.
[0115] The present invention is suitable for the detection of novel coronavirus 2019-nCoV nucleic acid, and can provide a reliable basis for virus identification and prevention and control, and is worthy of popularization and application. In addition, the method of the present invention is also suitable for non-diagnostic purposes. For example, in the epidemic prevention and control process, the detection method of the present invention can be used to detect viral nucleic acids in the environment, and these viral nucleic acid information can be used for public health management.
[0116] The present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without detailed conditions in the following examples are generally in accordance with the conditions described in the conventional conditions such as Sambrook. J et al. “Guide to Molecular Cloning Laboratory” (translation by Huang Peitang et al., Beijing: Science Press, 2002), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercially available channels.
EXAMPLE 1
Design of Primers and Probes
[0117] Based on the sequence of the novel coronavirus, the conserved regions of its genome were analyzed. Dozens of specific primers and probe sequences targeting the N gene and ORFlab gene of the novel coronavirus were designed in these conserved regions. In addition, in order to monitor the process of sample collection, nucleic acid extraction and PCR amplification, internal standard primers and probes were designed.
[0118] In the design process of the above-mentioned primers and probes, the formation of hairpin structures, intra-primer dimers, inter-primer dimers and mismatches needs to be avoided as much as possible.
[0119] In addition, the above-designed novel coronavirus-specific primers and probe sequences were analyzed by aligning the NCBI Blast online database (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to avoid non-specific binding with other viruses or human genes.
[0120] After multiple rounds of screening and optimization by conventional real-time fluorescent quantitative PCR, and then verified by thermal convection PCR, a set of primers and probe sequences with optimal sensitivity and specificity were finally determined.
TABLE-US-00005 TABLE 1 Sequences of primers and probes for novel coronavirus Site Name Sequences SEQ ID Nos. N gene nCoV-N-F GGGGAACTTCTCCTGCTAGAAT 1 nCoV-N-R CAGACATTTTGCTCTCAAGCTG 2 nCoV-N-P TTGCTGCTGCTTGACAGATT 3 ORF1 nCoV-ORF1ab-F CCCTGTGGGTTTTACACTTAA 4 ab gene nCoV-ORF1ab-R ACGATTGTGCATCAGCTGA 5 nCoV-ORF1ab-P CCGTCTGCGGTATGTGGAAAGGTTATGG 6 Internal F7 ACACCTCTGGATGCCACT 7 standard R7 CTCCGTACACTCTCCTACCCTC 8 P7 CCATTGCCAGTCCGCCGTC 9
[0121] Among them, the 5′-terminal fluorescent group of nCoV-N-P is FAM, and the 3′-terminal quenching group is BHQ1; the 5′-terminal fluorescent group of nCoV-ORFlab-P is VIC, and the 3′-terminal quenching group is BHQ1; the 5′-terminal fluorescent group of P7 is CY5, and the 3′-terminal quenching group is BHQ2.
TABLE-US-00006 TABLE 2 Components of the kit Component name Specification Quantity Main ingredient PCR detection NC(ORF1ab/N) 290 μl/tube 1 Specific primers and probes reagent PCR reaction (SEQ ID NOs. 1-9), Tris-HCl solution A buffer, MgCl.sub.2, dNTPs NC(ORF1ab/N) 80 μl/tube 1 Hot-start Taq enzyme, PCR reaction C-MMLV enzyme solution B Quality Control NC(ORF1ab/N) 200 μl/tube 1 Pseudovirus with internal Negative standard fragment Quality Control NC(ORF1ab/N) 200 μl/tube 1 Pseudoviruses containing Positive target fragments, Quality Control Pseudoviruses containing internal standard fragments
[0122] wherein the sequence of the N gene target fragment is as follows:
TABLE-US-00007 (SEQ ID NO. 19) ATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAG GGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCT TGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTC TGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGC TGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGC ATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCA AGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAA ACATTGGCCGCAAA,
[0123] the sequence of the ORF lab gene target fragment is as follows:
TABLE-US-00008 (SEQ ID NO. 20) GGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGT GCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTC TGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAA CCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACCGGGTTTGC GGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACT GATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGT TTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGAC GAAGATGACAATTT,
[0124] and the sequence of the internal standard fragments is as follows:
TABLE-US-00009 (SEQ ID NO. 21) GGTGCCCACCAGCAGGATGGGCACATCAGGGCAGTGGTGGCACACCTC TGGATGCCACTTGTGCCGCACGTTCTCATAGGACGGCGGACTGGCAAT GGAGAAACAGATGACGAAAACGTTGGTCTGAGGGTAGGAGAGTGTACG GAGGCGGTCATACTCCTCCTGGCCCGCAGTGTCCCACAGGTTCAGGTT CACTGTGCGCCCGTCAACTGCGCTCTGCGCGCTGTAATTGTCGAACAC GGTGGGGATGTACTCTTTGGGGAAAGCGTTAGTTGTGTAGCAGATGAG CAGGCACGTCTTGCCCACAGCCCCATCACCCACCACCACGCACTTGAT GCTCTGCATCGTGGGTGCAGTTGCTGTAGTGGAGGCAGTGCCTCC.
EXAMPLE 2
Detection Method and System
[0125] In order to determine the detection system of primers and probes, the influences of different concentrations of primers and probes on the fluorescent PCR reaction were respectively tried.
[0126] The results showed that when the nCoV-N-F, nCoV-N-R primer concentrations were 20 pmol, the nCoV-N-P probe concentration was 6 pmol, the nCoV-ORFlab-F, nCoV-ORFlab-R primer concentrations were 15 pmol, the nCoV-ORFlab-P probe concentration was 6 pmol, the F7, R7 primer concentrations were 5 pmol, the P7 probe concentration was 3 pmol, the amplification curve was the best.
[0127] The finalized reaction system is as follows:
TABLE-US-00010 PCR reaction solution A 12 μL PCR reaction solution B 3 μL Nucleic acid of the sample to be tested 5 μL
[0128] Among them, PCR reaction solution A contains specific primers and probes (SEQ ID NOs.:1-9), tris-hydrochloric acid buffer, MgCl.sub.2, dNTPs (4 mmol);
[0129] PCR reaction solution B contains Hot-start Taq enzyme, Reverse transcriptase (C-MMLV enzyme). Hot-start Taq enzyme, Reverse transcriptase, and dNTPs can all use commercially available products, such as Qiagen's products. In each PCR reaction solution B, the amount of Hot-start Taq enzyme is 24U, the amount of Reverse transcriptase is 24U.
EXAMPLE 3
Sensitivity Test
[0130] The virus-like particles containing target fragments were constructed. After the determination of the concentration, the pseudovirus was diluted to an appropriate concentration, and then 10-fold specific dilution was performed, and the concentrations were 3.00E+06, 3.00E+05, 3.00E+04, 3.00E+03, 3.00E+02 copies/ml.
[0131] The above pseudoviruses were detected using the detection system and cycling parameters determined above. Part of the detection results refer to
EXAMPLE 4
Specificity Test
[0132] Influenza A/B virus, Coronavirus 229E, Coronavirus NL63, Coronavirus OC43, Coronavirus HKU1, Respiratory syncytial virus, Adenovirus, Mycoplasma pneumoniae, and Chlamydia pneumoniae were used as specific samples for detection.
[0133] The test results were shown in
EXAMPLE 5
Repeatability Test
[0134] Pseudoviruses with concentrations of 1.00E+05 copies/ml, 1.00E+04 copies/ml and 1.00E+03 copies/ml were selected for detection, and repeated tests were carried out using the detection system and cycle parameters determined above.
[0135] Refer to
EXAMPLE 6
Clinical Samples Detection
[0136] 1. Sample Processing and Nucleic Acid Extraction
[0137] It was recommended to take 200 μl liquid sample for nucleic acid extraction. Nucleic acid extraction or purification kits (Magnetic Bead Method) produced by Sun Yat-Sen University Daan Gene Co., Ltd. can be used (Yuesuixiebei No. 20170583 and Yuesuixiebei No. 20150302), and other commercial products can also be used, and the specific operation steps should be carried out according to the instructions of the kit.
[0138] Both the negative and positive quality controls in this kit are involved in the extraction.
[0139] 2. Preparation of PCR Reagent
[0140] Take out NC(ORFlab/N) PCR reaction solution A and NC(ORFlab/N) PCR reaction solution B from the kit, thaw at room temperature, shake and mix well, and centrifuge at 8000 rpm for a few seconds before use.
[0141] Take N+1 (N=number of samples to be tested+NC(ORFlab/N) negative quality control+NC(ORFlab/N) positive quality control) PCR reaction tubes.
[0142] The single-person amplification system is prepared in the following table:
TABLE-US-00011 NC(ORF1ab/N) PCR NC(ORF1ab/N) PCR Amplification reaction solution A reaction solution B system 12 μl 3 μl 15 μl
[0143] Take N+1 dedicated PCR reaction tubes, and use a narrow-mouth pipette tip to aliquot the PCR reagents (15 μl per tube). After the aliquoting is completed, use a centrifuge at 8000 rpm for 1 min to allow the PCR reaction solution to flow into the bottom of the PCR reaction tube.
[0144] 3. Add Sample
[0145] The PCR reaction tubes were added with the extracted DNA samples, negative quality control products and positive quality control products of 5 μl respectively. Cover the tube cap tightly and centrifuge at 8000 rpm for 3 minutes. After centrifugation, observe whether there are visible bubbles remaining in the reaction tube. Repeat centrifugation if necessary. If there are no visible bubbles, each reaction tube was placed into a portable rapid PCR instrument (Achem Biosystems (Korea)).
[0146] 4. PCR Amplification
[0147] The program was set as follows: first perform reverse transcription at 50° C. for 4 minutes, and then perform 50 cycles of thermal convection PCR reaction at 95° C.
[0148] Select the FAM channel, VIC channel, and CY5 channel for detection.
[0149] 5. Result Analysis and Judgment
[0150] When the instrument was normal, and the NC (ORFlab/N) positive quality control and NC (ORFlab/N) negative quality control were both normal, the result analysis was performed.
[0151] FAM Channel and VIC Channel:
[0152] 5.1 Positive: If the test results of the FAM channel and VIC channel of the sample to be tested were Ct≤40, and the curve was S-shaped or there was an obvious exponential growth period, or the FAM channel and VIC have one Ct≤40 and the other Ct≤45, it was judged as 2019 novel coronavirus (2019-nCoV) positive;
[0153] 5.2 Suspicious: The test results of the FAM channel and VIC channel of the sample to be tested are both 40≤Ct≤45. At this time, the sample should be tested repeatedly. If the Ct value of the rereading result still exists in the same range, the curve was S-shaped or has an obvious exponential expansion period, it is judged that the 2019 novel coronavirus (2019-nCoV) was positive, otherwise the 2019 novel coronavirus (2019-nCoV) was negative;
[0154] 5.3 Negative: If the test results of the FAM channel and VIC channel of the sample to be tested are Ct≥45 or no Ct detection, the results were judged to be negative for 2019 novel coronavirus (2019-nCoV).
[0155] 6. Quality Control
[0156] 6.1 NC (ORFlab/N) negative quality control: FAM and VIC detection channels had no obvious amplification curves, but Cy5 channel had obvious amplification curves;
[0157] 6.2 NC (ORFlab/N) positive quality control: FAM and VIC detection channels had obvious amplification curves and Ct value≤32, and Cy5 channel had an amplification curve or no;
[0158] The experiment was valid if all the above conditions are met at the same time. Otherwise, all the experiments should be repeated.
[0159] 7. Interpretation of Test Results
[0160] 7.1 Negative quality control products and positive quality control products need to be tested for each experiment, and the test results could only be judged when the results of the quality control products meet the quality control requirements.
[0161] 7.2 When the detection channel of FAM and VIC was positive, the result of Cy5 channel (internal standard channel) may be negative due to the competition of the system.
[0162] 7.3 When the internal standard result was negative, if the FAM and VIC detection channels of the detection tube were also negative, it means that the system is inhibited or the operation is wrong. The test is invalid, and the sample needs to be re-examined.
[0163] 7.4 The following formats of the report were recommended:
[0164] The negative result report were reported in the following format: 2019 Novel Coronavirus (2019-nCoV) RNA was not detected in the sample, and the concentration was lower than the sensitivity of the kit;
[0165] The positive result report were reported in the following format: 2019 novel coronavirus (2019-nCoV) RNA was detected in the sample.
[0166] 7.5 Experimental results showed that the kit of the present invention had a good detection effect, and the detection results were basically not much different from ordinary fluorescent PCR. The detection limit concentration was 1000 copies/ml.
[0167] Among the 32 suspected clinical samples tested, a total of 24 novel coronavirus 2019-nCoV nucleic acid positive clinical samples were detected. Typical test results are shown in
[0168] Sequencing verification results showed that the detection accuracy of the detection system of the present invention reached 100%, which further proved the accuracy of clinical detection of the system of the present invention.
[0169] The kit of the invention has good detection effect, and the detection result is not much different from that of ordinary fluorescent PCR.
COMPARATIVE EXAMPLE 1
[0170] In the research process, the present inventor screened dozens of PCR primers and probes for the target nucleic acid sequence of the novel coronavirus. After extensive testing, finally obtained a combination of primers and probes that can meet the needs of clinical detection with sensitivity and specificity, is suitable for thermal convection PCR, and can perform multiple detection.
[0171] For the detection target of the N gene detection target of novel coronavirus, the inventors have undergone a lot of screening and combination. Some typical primer sequences designed are as follows:
TABLE-US-00012 Control upstream primer nCoV-N-F2: (SEQ ID NO. 10) CTAAGAAGCCTCGGCAAAA Control downstream primer nCoV-N-R2: (SEQ ID NO. 11) CGTCTGCCGAAAGCTTG Control probe nCoV-N-P2: (SEQ ID NO. 12) TTACATTGTATGCTTTAGTGGCAGT Control upstream primer nCoV-N-F3: (SEQ ID NO. 13) GACCCCAAAATCAGCGAAAT Control downstream primer nCoV-N-R3: (SEQ ID NO. 14) TCTGGTTACTGCCAGTTGAATCTG Control probe nCoV-N-P3: (SEQ ID NO. 15) ACCCCGCATTACGTTTGGTGGACC Control upstream primer nCoV-N-F4: (SEQ ID NO. 16) TTACAAACATTGGCCGCAAA Control downstream primer nCoV-N-R4: (SEQ ID NO. 17) GCGCGACATTCCGAAGAA Control probe nCoV-N-P4: (SEQ ID NO. 18) ACAATTTGCCCCCAGCGCTTCAG
[0172] Firstly, the conventional fluorescent quantitative PCR detection was used for primary screening.
[0173] The detection results of nCoV-N-F2 and nCoV-N-R2 were shown in
[0174] The detection results of nCoV-N-F3 and nCoV-N-R3 showed that the primer pair had better specificity and sensitivity to the N gene target nucleic acid in a single detection system. However, in the multiplex detection system, the amplification of low concentration nucleic acid of N gene was significantly inhibited. The results of single and multiplex systems tests were shown in
[0175] The detection results using nCoV-N-F4 and nCoV-N-R4 showed that the primer pair could perform multiple detection in the conventional fluorescent quantitative PCR detection system, and had better specificity and sensitivity. However, in thermal convection PCR, the sensitivity was significantly reduced. It showed that the control primer pair nCoV-N-F4 and nCoV-N-R4 could not be applied to the thermal convection PCR detection system.
[0176] All literatures mentioned in the present application are incorporated herein by reference, as though each one is individually incorporated by reference. In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications, equivalents of which falls in the scope of claims as defined in the appended claims.