Materials and methods for treatment of pulmonary arterial hypertension

Abstract

The invention relates to the use of microRNA 96 and precursors and mimics thereof for the inhibition of vascular cell proliferation and/or vascular remodelling, and for the treatment of associated medical conditions such as pulmonary arterial hypertension (PAH).

Claims

1. A method for prophylaxis or treatment of pulmonary hypertension, comprising delivering to a target cell, or administering to a subject: (a) miR-96, a mimic thereof, or a precursor of either; or (b) a nucleic acid encoding miR-96, a mimic thereof, or a precursor of either.

2. A method for pulmonary vascular remodelling, comprising delivering to a target cell, or administering to a subject: (a) miR-96, a mimic thereof, or a precursor of either; or (b) a nucleic acid encoding miR-96, a mimic thereof, or a precursor of either.

3. A method according to claim 1 wherein said pulmonary hypertension is pulmonary arterial hypertension.

4. A method according to claim 1 wherein the target cell expresses the 5-HT1B receptor.

5. A method according to claim 1 wherein the target cell is a vascular cell.

6. A method according to claim 5 wherein the vascular cell is a vascular smooth muscle cell (VSMC) or a vascular endothelial cell.

7. A method according to claim 6 wherein the vascular cell is a pulmonary artery smooth muscle cell (PASMC) or pulmonary artery endothelial cell.

8. A method according to claim 1 wherein the target cell is a cell associated with the vasculature.

9. A method according to claim 8 wherein the target cell is an adventitial fibroblast or an immune cell.

10. A method according to claim 9 wherein the immune cell is a T lymphocyte, monocyte, macrophage or mast cell.

11. A method according to claim 1 wherein the precursor of miR-96 is pre-miR-96.

12. A method according to claim 11 wherein the pre-miR-96 has the sequence: TABLE-US-00008 (hsa-pre-miR-96) (SEQ ID NO: 3) UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAG CAAUCAUGUGCAGUGCCAAUAUGGGAAA  or (mmu-pre-miR-96) (SEQ ID NO: 4) CCAGUACCAUCUGCUUGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUG UCUCUCCGCUGUGAGCAAUCAUGUGUAGUGCCAAUAUGGGAAAAGCGGGC UGCUGC, wherein the mature miR-96 sequence is underlined.

13. A method according to claim 1 wherein the precursor of miR-96 is pri-miR96.

14. A method according to claim 1 wherein the miR-96 mimic comprises a guide strand which has the sequence: TABLE-US-00009 UUUGGCACUAGCACAUUUUUGCU (SEQ ID NO: 1) (wherein the seed sequence is underlined) or which differs from that sequence at one or more positions outside the seed sequence.

15. A method according to claim 14 wherein the miR-96 mimic comprises: (a) one or more modified sugar residues; (b) one or more modified internucleoside linkages; or (c) one or more modified bases.

16. A method according to claim 1 wherein the miR-96, mimic or precursor thereof is associated with a carrier, wherein the carrier is a pharmaceutically acceptable lipid or polymer, or a combination thereof.

17. A method according to claim 1 wherein the nucleic acid is delivered as naked DNA or in association with a carrier.

18. A method according to claim 1 wherein the nucleic acid is delivered via a viral vector.

19. A method according to claim 18 wherein the viral vector is an adenoviral or retroviral vector.

20. A method according to claim 19 wherein the retroviral vector is a lentiviral vector.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Differential expression of microRNAs across genders in PASMCs

(2) Analysis of microRNA expression by quantitative-PCR in female and male WT and BMPR2.sup.R899X+/− PASMCs show gender can affect expression profile. Results are normalized to U6 and expressed as a fold change of female WT value. Data expressed as mean±SEM. P<0.05*, p<0.01** (female vs. male) and p<0.05.sup.+, p<0.01.sup.++, p<0.001.sup.+++ (WT vs. BMPR2.sup.R899X+/−).

(3) FIG. 2. Expression of miR-96 highest in lung

(4) Global analysis of miR-96 expression by quantitative-PCR in mouse tissue shows levels are significantly higher in lung. (RV, Right Ventricle). Results are normalized to U6 and expressed as a fold change of lung value. Data expressed as mean±SEM. P<0.01** and P<0.001***.

(5) FIG. 3. Validation of the 5-HT1B receptor as a target of miR-96

(6) (A) and (B) Pre-miR-96 at concentration of 25 nM decreases luciferase activity but has not effect on mock control vector. (C) Pre-miR-96 transfection increases mature miR-96 levels compared to control and scrambled miR. Results were normalised to U6 and expressed as a fold change of control value. Data expressed as mean±SEM. P<0.05* and P<0.01**.

(7) FIG. 4. Increased expression of target 5-HT1B in female BMPR2.sup.R899X+/− PASMCs

(8) Analysis of 5-HT1B (A) protein and (B) mRNA expression in female and male PASMCs from WT and BMPR2.sup.R899X+/− mice. Female BMPR2.sup.R899X+/− PASMCs exhibit increased 5-HT1B protein and mRNA expression compared to female WT. Representative immunoblot of 5-HT1B protein expression in mouse PASMCs (C). Results were normalised to alpha-tubulin and GAPDH respectively and expressed as a fold change. Data expressed as mean±SEM. P<0.05*, p<0.01** (female vs. male) and p<0.05.sup.+, p<0.01.sup.++, p<0.001.sup.+++ (WT vs. +/−).

(9) FIG. 5. BMP4 stimulation rescues miR-96 expression in deficient female BMPR2.sup.R899X+/− PASMCs

(10) Mouse PASMCs from female BMPR2.sup.R899X+/− mice exhibit a tentative increase in miR-96 levels when stimulated with 1 nM BMP4. Results were normalised to U6 and expressed as a fold change. Data expressed as mean±SEM.

(11) FIG. 6. Deficiency of SMAD1 exhibits similar miR-96 expression profile as BMPR2.sup.R899X+/−

(12) Mouse PASMCs from female mice with compromised SMAD1 expression (+/−) show a reduction in miR-96 expression compared to female WT (A). In whole lung tissue there is a trend for a decrease in miR-96 levels in female SMAD1+/− mice vs. female WT with no change between males (B). Results were normalised to U6 and expressed as a fold change. Data expressed as mean±SEM. P<0.01**.

(13) FIG. 7. Effect of Human PAH on miR-96 and 5-HT1B Expression

(14) Female patient PASMCs have a reduction in mir-96 expression compared to non-PAH controls (A). The 5-HT1B receptor expression is increased in female patient PASMCs compared to non-PAH controls (B), low expression of miR-96 and high expression of 5-HT1B is found within HPAH patients with BMPR2 mutations. Results were normalised to RNU48 and expressed as a fold change of female control value. Data expressed as mean. R899X, N903S: BMPR2 mutations. HPAH: heritable PAH. IPAH: idiopathic PAH.

(15) FIG. 8. Depletion of oestrogen increases miR-96 expression and decreases target 5-HT1B only in female mice

(16) Female mice treated with the aromatase inhibitor, anastrazole, have an increased expression of miR-96 (A) and decreased expression of 5-HT1B (B) compared to vehicle control whereas male mice exhibit no change in expression of either miR-96 (C) or 5-HT1B (D). Results were normalised to U6 and expressed as a fold change of control value. Data expressed as mean±SEM. P<0.05* and P<0.01**.

(17) FIG. 9. A Role for oestrogen in the regulation of miR-96

(18) Human PASMCs stimulated with 1 nM oestrogen (E2) for 72 hours show a reduction in miR-96 expression (p=0.0512) (A) and a corresponding trend for an increase in 5-HT1B receptor expression (B). Results were normalised to RNU48 and expressed as a fold change of control value. Data expressed as mean±SEM.

(19) FIG. 10. A mir-96 mimic prevents hypoxia-induced pulmonary hypertension (PH) in the mouse. 1.5 mg/kg of the mir-96 mimic was administered i.v. once a week for two weeks during which time mice were exposed to hypoxia. The miR-96 mimic prevents the rise in Right ventricular Systolic pressure (A), right ventricular hypertrophy (B) and pulmonary vascular remodeling (C). *P<0.05, **P<0.01, **P<0.001, ****P<0.0001; 1-way ANOVA followed by Tukey's post-hoc test.

(20) FIG. 11. A mir-96 mimic reverses pulmonary hypertension (PH) in a mouse with a BMPR2 mutation (BMPR2.sup.R899X+/−). 1.5 mg/kg of the mir-96 mimic was administered i.v. once a week for two weeks after which the mice were assessed for the development of PH. The miR-96 mimic prevents the rise in Right Ventricular Systolic pressure (A), right ventricular hypertrophy (B) and pulmonary vascular remodeling (C).*P<0.05,***P<0.001, ****P<0.0001; 1-way ANOVA followed by Tukey's post-hoc test

DETAILED DESCRIPTION OF THE INVENTION

(21) Research suggests that microRNAs (miRs) play a crucial role in the pathobiology of pulmonary arterial hypertension (PAH).

(22) Heritable PAH (hPAH) is associated with mutations in the gene for bone morphogenetic protein receptor 2 (BMPR2). The inventors have studied a BMPR2 mouse model of PAH carrying a mutation also found in PAH patients, the BMPR2.sup.R899X+/− mouse.

(23) In this model, gender emerges as a key underlying regulator of basal expression of miRs within pulmonary artery smooth muscle cells (PASMCs). MiR-96 was down-regulated in PASMCs from female BMPR2.sup.R899X+/− mice compared to the female wild type (WT) whereas expression between the male transgenics and their WT controls was unchanged. Global expression analysis showed highest miR-96 expression within the lung. The target gene for the 5-HT1B receptor was inversely correlated with the expression of miR-96 within the female BMPR2.sup.R899X+/− PASMCs at both mRNA and protein level. The 5HT1B gene was validated as a target for miR-96 by luciferase reporter assay.

(24) The inventors also verified that PASMC from female PAH patients with BMPR2 mutations exhibit low miR-96 and high 5HT1B expression.

(25) These results suggest sex hormones such as oestrogen may play a role in regulating miR-96. Consistent with this we have shown that inhibiting the synthesis of endogenous oestrogen in vivo increased lung miR-96 and decrease 5-HT1B expression within female mice only. Direct stimulation with oestrogen in human PASMCs caused a reduction in miR-96 and increase in 5-HT1B expression.

(26) In summary, a decrease in miR-96 was associated with increased 5HT1B expression. This suggests that miR-96 mimic/pre-miR-96 strategies may be a novel therapeutic approach to PAH. In support of this hypothesis, pre-clinical studies confirm that a mir-96 mimic is effective in preventing or reversing pulmonary hypertension in mouse models of pulmonary hypertension.

EXAMPLES

(27) Materials and Methods

(28) Cell Culture

(29) Murine Pulmonary Artery Smooth Muscle Cells

(30) Female and male pulmonary artery smooth muscle cells (PASMCs) derived from BMPR2.sup.+/−R899X mice and corresponding wild type control mice were provided by Prof. N. W. Morrell (University of Cambridge, Cambridge, UK). BMPR2.sup.+/−R899X mice have a heterozygous knock-in mutation of the BMPR2 gene. The mice were similar to those described by West et al. (Am J Physiol Lung Cell Mol Physiol 295: L744-L755, 2008). Briefly PAMSCs were grown in 20% FBS (Foetal Bovine Serum) DMEM (Dulbecco's Modified Eagle Medium) in the presence of growth factors (epidermal growth factor, basic fibroblast growth factor and insulin) and antibiotic (Penicillin Streptomycin). PASMCs were utilised between passage 4 and 8 and cell viability was based on distinct smooth muscle cell morphology.

(31) Human Pulmonary Artery Smooth Muscle Cells

(32) Female human PASMCs were provided by Prof. N. W. Morrell (University of Cambridge, Cambridge, UK). Briefly human PASMCs were explanted from the small distal pulmonary arteries of the pulmonary vasculature from three PAH patients, two with HPAH and one with IPAH. PASMCs derived from non-PAH subjects were utilised as controls. Human PASMCs were grown in 10% FBS DMEM in the presence of antibiotic antimycotic solution (containing penicillin, streptomycin and amphotericin) and were used between passage 4 and 8. PASMC phenotype was confirmed via smooth muscle cell morphology.

(33) RNA and Protein Analysis

(34) Taqman Quantitative-PCR Analysis of miRNAs and mRNAs

(35) Total RNA was extracted using the miRNeasy kit (Qiagen) according to the manufacturer's instructions and RNA purity quantified using NanoDrop-1000 Spectrophotometer. Expression of miRs and mRNA was assessed by Taqman quantitative-PCR as previously described [17]. To obtain a fold change miR expression data was normalised to U6 for mouse and RNU48 for human. mRNA expression data was normalised to GAPDH. All PASMC miRNA and mRNA expression data is n=6 in triplicate.

(36) Western Blot Analysis of Protein

(37) Protein was extracted using the RIPA lysis method. The RIPA buffer was supplemented with proteases inhibitors PMSF, soybean trypsin inhibitor and benzamidine. Briefly supplemented RIPA buffer was added to PASMCs which were then agitated on ice for 10 minutes. Cell lysates were collected via scraping. Protein expression data was normalised to alpha-tubulin and quantified using densitometry. All protein expression data is n=4 in duplicate.

(38) Effectiveness of microRNA-96 Mimic In Vivo

(39) To assess whether miR-96 was involved in the pathology of pulmonary hypertension, the microRNA-96 mimic (Applied Biosystems, #MC10422, having the base sequence

(40) TABLE-US-00007 UUUGGCACUAGCACAUUUUUGCU, (SEQ ID NO: 1)
identical to mature mouse and human miR-96) was administered intravenously via the tail vein once a week for 2 weeks using the MaxSuppressor™ In Vivo RNA-LANCEr II delivery method. The mimic was prepared in the delivery reagent as per manufacturing instructions at a dose of 1.5 mg/kg per injection i.e. ˜30 ug per mouse per injection. Negative microRNA mimic (Applied Biosystems) and PBS dosed animals were used as controls.
Chronic Hypoxia

(41) Female wild type (WT) C57/Bl (Charles River) mice aged 2 months old were exposed to 14 day hypobaric hypoxia (10% O.sub.2, 550 mbar) as described previously (18). Mice maintained in normoxic conditions (21% O.sub.2, 1000 mbar) were studied as controls.

(42) In Vivo Assessment of PH

(43) Measurements of right ventricular systolic pressure (RVSP), right ventricular hypertrophy (RVH) and pulmonary vascular remodeling were performed as previously described (3,4,10)

(44) Target Validation

(45) Luicferase Reporter Assay

(46) The psi-CHECK-2 dual luciferase reporter vector (Promega) was utilised for the reporter assay. Briefly, a fragment of the 3′UTR (untranslated region) of the 5-HT1B receptor gene was generated by polymerase chain reaction (PCR) from genomic mouse DNA and was cloned via the in-fusion cloning method into the multiple cloning site of the psi-CHECK-2 vector at the XhoI and the NotI restriction sites. The psi-CHECK-2 5-HT1B vector was then sequenced to confirm there was no unwanted mutations within the 3′UTR region of the 5-HT1B. lug of psi-CHECK-2 control vector or the psi-CHECK-2 5HT1B vector along with either pre-miR-96 (Ambion) or scrambled miR (Ambion) were co-transfected into HeLa cells using Lipofectamine 2000 (Invitrogen) and optimem (Invitrogen) for a total of 6 hours before being replaced with 10% FBS DMEM. The HeLa cells were left for 48 hours and the luciferase activity measured using the Dual-Glo Luciferase Assay System (Promega) and detected by a luminometer. The renilla luciferase activity was normalised to the internal firefly luciferase activity and data expressed as a percentage of the internal control.

(47) Analysis of Data

(48) Values are expressed as mean±standard error of the mean. A t-test or 2-way ANOVA followed by Bonferroni's post-hoc test was performed to evaluate the statistical significance between all groups where appropriate. A probability level of p<0.05 was defined as being statistically significant.

(49) Results

(50) FIG. 1 demonstrates that many miRs were differentially affected by gender, and miR-96 was severely down regulated in female BMPR2.sup.R899X+/− mice vs wild type controls but not males; miR-96 levels were lower in female BMPR2.sup.R899X+/− mice vs male BMPR2.sup.R899X+/− mice.

(51) Lung expression of miR-96 is extremely high compared with other tissue levels which would facilitate selective targeting of the lung (FIG. 2). We confirmed that the 5HT1B receptor is a target for miR96 using luciferase reporter assay (FIG. 3).

(52) Decreased expression of miR96 was associated with an elevation in the target gene for the 5HT1B receptor in the female BMPR2.sup.R899X+/− mice (FIG. 4). The decreased miR96 expression was rescued by BMP4 stimulation (FIG. 5). The same phenotype is observed in PASMCs from Smad1+/− mice (FIG. 6).

(53) Results have been confirmed in human PASMCs (FIG. 7). Of especial interest is that in a female patient with the R899X mutation, 5HT1B levels were high and miR96 expression extremely low (FIG. 7).

(54) We also examined the effect of oestrogen depletion with an aromatase inhibitor, anastrozole on the expression of both miR96 and the 5HT1B receptor. Previously we have shown that anastrozole reverses PAH in female mice and rats but not in males (unpublished). Here we show that depletion of oestrogen in vivo with anastrozole increased miR96 expression and decreased 5HT1B expression in the female mouse lung but not the male (FIG. 8).

(55) In keeping with this, the miR-96 gene has oestrogen-responsive regions and oestrogen itself decreased expression of miR-96 and increased expression of the 5HT1B receptor in (FIG. 9).

(56) FIGS. 10 and 11 confirm that a miR-96 mimic can both prevent and reverse experimental PH in a mouse model in vivo.

(57) Discussion

(58) Our results suggest that increased oestrogen and BMPR2 haploinsufficiency are associated with decreased miR-96 expression.

(59) miR-96 normally represses the translation of the gene for 5HT1B and so the decrease in miR-96 induces an increase in 5HT1B expression. This facilitates PASMC proliferation by serotonin and pulmonary vascular remodelling and contributes to the development of PAH.

(60) While the invention has been described in conjunction with the exemplary embodiments described above, many equivalent modifications and variations will be apparent to those skilled in the art when given this disclosure. Accordingly, the exemplary embodiments of the invention set forth are considered to be illustrative and not limiting. Various changes to the described embodiments may be made without departing from the spirit and scope of the invention. All documents cited herein are expressly incorporated by reference.

REFERENCES

(61) (1) Shapiro S, Traiger G L, Turner M, Mcgoon M D, Wason P, Barst R J. Sex differences in the diagnosis, treatment, and outcome of patients with pulmonary arterial hypertension enrolled in the registry to evaluate early and long-term pulmonary arterial hypertension disease management. Chest 2012 February; 141(2):363-73. (2) Lane K B, Machado R D, Pauciulo M W et al. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nature Genetics 2000 September; 26(1):81-4. (3) Dempsie Y, Morecroft I, Welsh D J et al. Converging evidence in support of the serotonin hypothesis of dexfenfluramine-induced pulmonary hypertension with novel transgenic mice. Circulation 2008 Jun. 3; 117(22):2928-37. (4) Morecroft I, Dempsie Y, Bader M et al. Effect of Tryptophan Hydroxylase 1 Deficiency on the Development of Hypoxia-Induced Pulmonary Hypertension. Hypertension 2007 Jan. 1; 49(1):232-6. (5) Morecroft I, White K, Caruso P et al. Gene Therapy by Targeted Adenovirus-mediated Knockdown of Pulmonary Endothelial Tph1 Attenuates Hypoxia-induced Pulmonary Hypertension. Mol Ther 2012 August; 20(8):1516-28. (6) Lawrie A, Spiekerkoetter E, Martinez E C et al. Interdependent serotonin transporter and receptor pathways regulate S100A4/Mts1, a gene associated with pulmonary vascular disease. Circ Res 2005 Aug. 5; 97(3):227-35. (7) MacIntyre P D, Bhargava B, Hogg K J, Gemmill J D, Hillis W S. Effect of Subcutaneous Sumatriptan, A Selective 5Ht1 Agonist, on the Systemic, Pulmonary, and Coronary Circulation. Circulation 1993 February; 87(2):401-5. (8) MacLean M R, Clayton R A, Templeton A G B, Morecroft I. Evidence for 5-HT1-like receptor-mediated vasoconstriction in human pulmonary artery. British Journal of Pharmacology 1996 September; 119(2):277-82. (9) MacLean M R, Morecroft I. Increased contractile response to 5-hydroxytryptamine(1)-receptor stimulation in pulmonary arteries from chronic hypoxic rats: role of pharmacological synergy. British Journal of Pharmacology 2001 October; 134(3):614-20. (10) MacLean M R, Deuchar G A, Hicks M N et al. Overexpression of the 5-hydroxytryptamine transporter gene—Effect on pulmonary hemodynamics and hypoxia-induced pulmonary hypertension. Circulation 2004 May 4; 109(17):2150-5. (11) Morecroft I, Heeley R P, Prentice H M, Kirk A, MacLean M R. 5-hydroxytryptamine receptors mediating contraction in human small muscular pulmonary arteries: importance of the 5-HT1B receptor. British Journal of Pharmacology 1999 October; 128(3):730-4. (12) Morecroft I, Loughlin L, Nilsen M et al. Functional interactions between 5-hydroxytryptamine receptors and the serotonin transporter in pulmonary arteries. J Pharmacol Exp Ther 2005 May; 313(2):539-48. (13) Morecroft I, Pang L, Baranowska M et al. In vivo effects of a combined 5-HT(1B) receptor/SERT antagonist in experimental pulmonary hypertension. Cardiovasc Res 2010 Feb. 1; 85(3):593-603. (14) Dempsie Y, Nilsen M, White K et al. Development of pulmonary arterial hypertension in mice over-expressing S100A4/Mts1 is specific to females. Respiratory Research 2011; 12(1):159. (15) Dempsie Y, MacRitchie N A, White K et al. Dexfenfluramine and the oestrogen-metabolizing enzyme CYP1B1 in the development of pulmonary arterial hypertension. Cardiovasc Res 2013 Jul. 1; 99(1):24-34. (16) White K, Dempsie Y, Nilsen M, Wright A F, Loughlin L, MacLean M R. The serotonin transporter, gender, and 17 beta oestradiol in the development of pulmonary arterial hypertension. Cardiovasc Res 2011 May; 90(2):373-82. (17) White K, Loughlin L, Maqbool Z et al. Serotonin transporter, sex, and hypoxia: microarray analysis in the pulmonary arteries of mice identifies genes with relevance to human PAH. Physiological Genomics 2011 April; 43(8):417-37. (18) Caruso P, MacLean M R, Khanin R et al. Dynamic Changes in Lung MicroRNA Profiles During the Development of Pulmonary Hypertension due to Chronic Hypoxia and Monocrotaline. Arteriosclerosis Thrombosis and Vascular Biology 2010 April; 30(4):716-U182. (19) Caruso P, Dempsie Y, Stevens H C et al. A Role for miR-145 in Pulmonary Arterial Hypertension/Novelty and Significance. Circ Res 2012 Jul. 20; 111(3):290-300. (20) Grant J, White K, MacLean M, Baker A. MicroRNAs in pulmonary arterial remodeling. Cell Mol Life Sci 2013; 1-16. (21) Bouchie A. First microRNA mimic enters clinic. Nat Biotechnol 2013 Jul. 9; 31(7):577. (22) Stefulj J, Jernej B, Cicin-Sain L, Rinner I, Schauenstein K. mRNA expression of serotonin receptors in cells of the immune tissues of the rat. Brain Behav Immun 2000 September; 14(3):219-24. (23) Yang G B, Qiu C L, Zhao H, Liu Q, Shao Y. Expression of mRNA for multiple serotonin (5-HT) receptor types/subtypes by the peripheral blood mononuclear cells of rhesus macaques. J Neuroimmunol 2006 September; 178(1-2):24-9. (24) Yin J, Albert R H, Tretiakova A P, Jameson B A. 5-HT1B receptors play a prominent role in the proliferation of T-lymphocytes. Journal of Neuroimmunology 2006 December; 181(1-2):68-81. (25) Austin E D, Rock M T, Mosse C A et al. T lymphocyte subset abnormalities in the blood and lung in pulmonary arterial hypertension. Respir Med 2010 March; 104(3):454-62. (26) Savai R, Pullamsetti S S, Kolbe J et al. Immune and inflammatory cell involvement in the pathology of idiopathic pulmonary arterial hypertension. Am J Respir Crit Care Med 2012 Nov. 1; 186(9):897-908. (27) Mair K M, MacLean M R, Morecroft I, Dempsie Y, Palmer™. Novel interactions between the 5-HT transporter, 5-HT(1B) receptors and Rho kinase in vivo and in pulmonary fibroblasts. British Journal of Pharmacology 2008 October; 155(4):606-16. (28) Seuwen K, Magnaldo I, Pouyssegur J. Serotonin stimulates DNA synthesis in fibroblasts acting through 5-HT1B receptors coupled to a Gi-protein. Nature 1988 Sep. 15; 335(6187):254-6.