ANTHELMINTIC PROBIOTIC COMPOSITIONS AND METHODS

20170348362 · 2017-12-07

    Inventors

    Cpc classification

    International classification

    Abstract

    Compositions and methods for treating or reducing the severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject are described. The methods include administering to the subject a therapeutically effective amount of a recombinant bacterium expressing a crystal protein such as a Bacillus thuringiensis crystal protein (Cry). The crystal proteins may be full length, truncated, variant, or sub-variant Cry proteins. Examples of crystal proteins include Cry5B, Cry21, Cry14A, Cry6A, and Cry13A. The recombinant bacterium may be, for example, a Bacillus subtilis or other Gram-positive bacterium, for instance, a lactic acid fermenting bacterium such as Lactococcus or Lactobacillus. Related compositions and recombinant microorganisms are also described.

    Claims

    1. A method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, the method comprising: administering to the subject a therapeutically effective amount of a composition comprising a recombinant bacterium that has expressed or that is capable of expressing a crystal protein.

    2. The method of claim 1, wherein the crystal protein is selected from the group consisting of Cry5B, Cry21A, Cry14A, Cry13A, and Cry6A.

    3. The method of claim 1, wherein the recombinant bacterium is a Gram-positive bacterium.

    4. The method of claim 1, wherein the recombinant bacterium is a Gram-negative bacterium.

    5. (canceled)

    6. The method of claim 1, wherein the recombinant bacterium is a lactic acid fermenting bacterium.

    7-8. (canceled)

    9. The method of claim 6, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.

    10. The method of claim 1, wherein the recombinant bacterium is administered in combination with at least one additional therapeutic agent.

    11. The method of claim 10, wherein the at least one additional therapeutic agent is a nicotinic acetylcholine receptor agonist.

    12. The method of claim 11, wherein the at least one additional therapeutic agent is administered simultaneously with the therapeutically effective amount of the recombinant bacterium expressing the crystal protein.

    13. The method of claim 11, wherein the at least one additional therapeutic agent is administered sequentially with the therapeutically effective amount of the recombinant bacterium expressing the crystal protein.

    14. The method of claim 11, wherein the nicotinic acetylcholine receptor agonist is from the levamisole family of nicotinic acetylcholine receptor agonists.

    15-16. (canceled)

    17. The method of claim 11, wherein the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine.

    18-19. (canceled)

    20. The method of claim 1, wherein the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from the group consisting of Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides, Schistosome, and Trematodes.

    21. The method of claim 1, wherein the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from the group consisting of hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides stercoralis, and pinworm Enterobius vermiculari.

    22. (canceled)

    23. The method of claim 1, wherein the subject is a mammal selected from the group consisting of human being, feline, rodent, canine, bovine, equine, swine, caprine, ovine, and primate.

    24. (canceled)

    25. The method of claim 1, wherein the crystal protein is a truncated crystal protein.

    26. The method of claim 1, wherein the crystal protein is a variant crystal protein.

    27-34. (canceled)

    35. The method of claim 1, wherein the crystal protein is Cry5B and wherein the Cry5B includes at least amino acids 30 through 693 of SEQ ID NO:1.

    36. The method of claim 1, wherein the crystal protein is Cry13A and wherein the Cry13A includes at least amino acids 30 through 688 of SEQ ID NO:2.

    37. The method of claim 1, wherein the crystal protein is Cry14A and wherein the Cry14A includes at least amino acids 30 through 675 of SEQ ID NO:3.

    38. (canceled)

    39. The method of claim 10, wherein the at least one additional therapeutic agent is a therapeutically effective amount of a second recombinant bacterium that has expressed or that is capable of expressing a second crystal protein.

    40. The method of claim 39, wherein the first and second recombinant bacteria are Gram-positive bacteria.

    41. The method of claim 39, wherein the first and second recombinant bacteria are Gram-negative bacteria.

    42-43. (canceled)

    44. The method of claim 39, wherein the first and second crystal proteins are different crystal proteins.

    45. The method of claim 39, wherein the first and second crystal proteins are independently selected from the group consisting of Cry5B, Cry21A, Cry14A, Cry13A, and Cry6A.

    46. (canceled)

    47. The method of claim 39, wherein the bacterium is a lactic acid fermenting bacterium.

    48-49. (canceled)

    50. The method of claim 47, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.

    51-88. (canceled)

    89. A composition comprising a non-invasive or non-pathogenic bacterium having a nucleic acid construct or vector comprising one or more constitutive promoters operably linked to coding sequences for expression of one or more heterologous crystal proteins.

    90. The composition of claim 89, wherein the one or more crystal proteins is selected from the group consisting of Cry5B, Cry21A, Cry14A, Cry13A, and Cry6A.

    91. The composition of claim 89, wherein the one or more crystal proteins is a truncated crystal protein.

    92. The composition of claim 89, wherein the one or more crystal proteins is a variant crystal protein.

    93-100. (canceled)

    101. The composition of claim 89, wherein the one or more crystal proteins is Cry5B and wherein the Cry5B includes at least amino acids 30 through 693 of SEQ ID NO:1.

    102. The composition of claim 89, wherein the one or more crystal proteins is Cry13A and wherein the Cry13A includes at least amino acids 30 through 688 of SEQ ID NO:2.

    103. The composition of claim 89, wherein the one or more crystal proteins is Cry14A and wherein the Cry14A includes at least amino acids 30 through 675 of SEQ ID NO:3.

    104. (canceled)

    105. The composition of claim 89, wherein the non-invasive or non-pathogenic bacterium is a lactic acid fermenting bacterium.

    106-107. (canceled)

    108. The composition of claim 105, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.

    109-131. (canceled)

    132. The method of claim 1 wherein the bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.

    133. The method of claim 39 wherein each of the first and second recombinant bacterium is independently selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.

    134. The composition of claim 89 wherein the non-invasive or non-pathogenic bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.

    135. (canceled)

    136. An artificial probiotic composition, comprising: (a) an isolated polypeptide having at least percent amino acid sequence identity to a Bacillus thuringiensis crystal protein that is selected from Cry5B comprising the amino acid sequence set forth in SEQ ID NO:1, Cry21A comprising the amino acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5, Cry14A comprising the amino acid sequence set forth in SEQ ID NO:3, Cry13A comprising the amino acid sequence set forth in SEQ ID NO:2, and Cry6A comprising the amino acid sequence set forth in SEQ ID NO:6; and (b) a non-invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in a mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, Lactobacillus and Lactococcus.

    137. The artificial probiotic composition of claim 136 wherein: (i) the Bacillus subtilis is B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, (ii) the Lactobacillus is Lactobacillus rhamnosus or Lactobacillus casei, and (iii) the Lactococcus is Lactococcus lactis.

    138. (canceled)

    139. The artificial probiotic composition of claim 136 wherein the isolated polypeptide is heterologous to and admixed with the probiotic bacterium.

    140-145. (canceled)

    Description

    BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

    [0046] FIG. 1 (FIGS. 1A-16). FIG. 1A illustrates the positions of conserved blocks among certain Cry proteins. de Maagd, R. A., et al. “How Bacillus thuringiensis has evolved specific toxins to colonize the insect world.” TRENDS in Genetics 17(4): 193-99, 195 (FIG. 2a) (April 2001). FIG. 1B illustrates the positions of conserved blocks among certain Cry proteins. Schnepf, E., et al. “Bacillus thuringiensis and Its Pesticidal Crystal Proteins.” Microbiology and Molecular Biology Reviews 62(3): 775-806, 781 (FIG. 3) (September 1998).

    [0047] FIG. 2 illustrates the amino acid sequence of Cry5Ba1 [SEQ ID NO:1].

    [0048] FIG. 3 illustrates the amino acid sequence of Cry13Aa1 [SEQ ID NO:2].

    [0049] FIG. 4 illustrates the amino acid sequence of Cry14Aa1 [SEQ ID NO:3].

    [0050] FIG. 5 (FIGS. 5A-5C). FIG. 5A illustrates the amino acid sequence of Cry21Aa1 [SEQ ID NO:4]. FIG. 5B illustrates the amino acid sequence of Cry21Aa2 (98% identical to Cry21Aa1) [SEQ ID NO:5]. FIG. 5C illustrates the amino acid sequence of Cry6A [SEQ ID NO:6].

    [0051] FIG. 6 illustrates the design of an expression system for heterologous protein secretion in LAB (Lactic Acid Bacteria). Expression cassettes for heterologous protein CV-N for intracellular expression (pTSV1-CVN) and secretion into the medium (pTSV1-CVN).

    [0052] FIG. 7 illustrates secretion of HIV-1 fusion inhibitors by Lactobacillus spp.

    [0053] FIG. 8 shows an example of cloning the pag gene into the pgm promoter system.

    [0054] FIG. 9 illustrates recombinant L. lactis MG1363 strains in which the thyA gene is replaced by the respective full-length or truncated cry gene, with or without a leader sequence, via double homologous recombination.

    [0055] FIG. 10 (FIGS. 10A-10B) illustrate a cloning strategy with an inducible nisin promoter that uses a combination of vector-backbone exchange (VBEx) and ligation independent cloning (LIC).

    [0056] FIG. 11 depicts PY79-Cry5B bioactivity in vitro against C. elegans. The results shown are from dose-dependent mortality assays plotting % live C. elegans (y axis) versus Cry5B concentration (x axis). The PY79-vector strain (vector-PY79) lacked Cry5B (0 μg/ml). Each data point represents the average for three independent experiments with ˜75 to 90 C. elegans organisms per experiment (˜225 to 270 organisms per data point). Error bars represent standard errors.

    [0057] FIG. 12 (FIGS. 12A-12C) shows that PY79-Cry5B had a dose-dependent therapeutic effect against hookworm infection in hamsters. (A) Intestinal hookworm burdens in nine hamsters following treatment with PY79-vector or PY79-Cry5B (10 mg/kg Cry5B) (error bars in all panels show standard errors). The average worm burdens were 18.6±2.6 and 1.3±0.3 for PY79-vector and PY79-Cry5B, respectively. (B) Fecal egg counts on day−1, day+1, and day+3 relative to the day of treatment. The actual egg counts for PY79-vector and PY79-Cry5B were 965±193 and 1,044±99, respectively, on day−1, 1,055±230 and 94±60, respectively, on day+1, and 1,055±227 and 100+42, respectively, on day+3. EPG, eggs per gram of feces. (C) In vivo dose-response experiment with 12 hamsters. The average worm burdens for PY79-vector and PY79-Cry5B at Cry5B concentrations of 0.4 mg/kg, 1.4 mg/kg, and 4 mg/kg were 27.0±3.2, 15.7±7.0, 8.3±0.9, and 5.7±0.9, respectively.

    [0058] FIG. 13 shows results from an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms as described by Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal.pntd.0001900). The four groups (in black, n=7 per group) shown are the intestinal worm burdens from the groups of infected hamsters treated with purified full-length B. thuringiensis Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see FIG. 2) at a single dose of 1 mg (solid circles, 10 mg/kg), 3 mg (solid upright triangles, 30 mg/kg), or 10 mg (solid inverted triangles,100 mg/kg) (715 nmoles/kg), or with placebo (solid squares, ddH.sub.2O), respectively. The treatments were conducted on day 16 P.I. and intestinal worm burdens assessed on day 21 P.I. The worm burdens in each hamster are indicated with a separate symbol. Long horizontal bars represent mean worm burdens; smaller bars indicate SEM (standard error of the mean).

    [0059] FIG. 14 shows dose-response results for indicated dosages of unfractionated Cry5B-containing spore-crystal lysates (SCL) in the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms. The assay was performed according to Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal.pntd.0001900) except instead of purified Cry5B protein the animals received the indicated dosages, via gavage, of Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase, at which point the cells lysed releasing spores, crystals, and bacterial lysate (spore crystal lysate, SCL). The amounts of Cry5B gavaged were determined by taking known volumes of spore crystal lysates, resolving full length Cry5B protein by SDS PAGE, and quantitating the amount of protein in the Cry5B band relative to known amounts of bovine serum albumin (BSA) standards on the gel.

    [0060] FIG. 15 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal. pntd.0001900) following treatment with two different dosages of Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis natto cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase.

    [0061] FIG. 16 shows data obtained in vitro using the C. elegans mortality assay described in FIG. 11 to evaluate the effects on C. elegans of purified Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see FIG. 2) when combined in a mixture either with sporulated B. thuringiensis HD1 or with sporulated B. subtilis PY79. For each data point, the number of spores (HD1 or PY79) was held constant and the quantity of Cry5B was titrated (x-axis).

    [0062] FIG. 17 shows the effects of Cry14A on an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms.

    DETAILED DESCRIPTION

    [0063] Certain presently disclosed embodiments relate to unprecedented advantages, described herein for the first time, that are provided by administering to the gastrointestinal (GI) tract of a mammalian subject a Cry protein as described herein and a probiotic bacterium as also described herein, to achieve unexpectedly potent anthelmintic effects against soil-transmitted helminths (STHs). The presently provided compositions and methods will thus find a wide variety of uses, such as for treating or reducing the severity or likelihood of occurrence of STH infections. Despite recognized anthelmintic properties of bacterial Cry proteins, effective therapeutic delivery of such proteins to GI sites of STH infection and parasite residence has not previously been achieved, where in vivo degradation and poor absorptive properties have heretofore precluded useful exploitation of Cry protein anthelmintic effects.

    [0064] As described herein, orally administering the combination of a bacterial Cry protein with a non-pathogenic, non-toxic, non-invasive bacterium such as a probiotic bacterium surprisingly provides delivery of effective anthelmintic activity to the lower GI tract, where STH parasites reside. Artificial probiotic microbes that are engineered to express heterologous Cry proteins are thus hereby contemplated for anthelmintic therapy according to certain embodiments, which may include oral delivery of one or more of live engineered probiotic bacteria, killed bacteria, and/or bacterial spore-crystal lysates, optionally in further combination with purified Cry proteins and/or other therapeutic agents such as nicotinic acetylcholine receptor agonists or benzimidazole anthelmintic agents. In certain embodiments, unexpectedly superior anthelmintic potency may be achieved by administering the combination of sporulated probiotic bacteria and a heterologous Cry protein. Accordingly, certain herein disclosed embodiments relate to unexpectedly advantageous anthelmintic activity of orally administered artificial probiotic bacteria that have been engineered to express heterologous Cry proteins, and certain other herein disclosed embodiments relate to surprisingly potent anthelmintic effects that reside in a composition which comprises a mixture of certain unmodified probiotic bacteria (e.g., in preferred embodiments Bacillus subtilis natto or Bacillus subtilis PY79) with isolated heterologous Cry proteins (e.g., Cry5A, Cry14A, etc.).

    [0065] Probiotic microbes, for example by way of illustration and not limitation, Bacillus subtilis (e. g., Bacillus subtilis natto, Bacillus subtilis PY79, or other strains described herein and known in the art) and Lactobacillus, are present in the human gastrointestinal tract at densities of up to 10.sup.8/gram (Wells and Mercenier, NAT REV MICROBIOL 6:349-362 (2008)). Bacillus subtilis has been extensively characterized as a safely ingested food additive in humans (see Example 14, infra, references 15-27). Braat et al., (2006) CLIN GASTROENTEROL HEPATOL 4:754-759 gave human patients orally 10.sup.10 Lactococcus lactis twice daily for 7 days as part of a phase I clinical trial. Mice can be given orally 2×10.sup.9 Lactococcus lactis (Waeytens et al., INFLAMM BOWL DIS 14:471-479 (2008)). Therefore, these bacteria can be ingested safely at relatively large concentrations.

    [0066] These Lactobacillus species are human commensal bacteria that naturally reside in the human mouth, intestine, and vagina. Bacillus subtilis and Lactobacillus are acid tolerant and bile resistant and therefore survive passage through the stomach and remain viable in the small intestine, where the Cry protein can be expressed and secreted to the intestinal mucosa. Thus, production of a Bacillus subtilis or Lactobacillus or other probiotic bacterial strain capable of expression and secretion of Cry proteins in the small and large intestines will according to certain herein disclosed embodiments provide a valuable delivery vehicle for Cry proteins. Lactobacilli or Bacillus subtilis genetically engineered to express Cry proteins can be propagated easily to high concentrations, isolated, lyophilized and stored indefinitely. These production technologies are widely used worldwide to produce “dried” starter cultures for food fermentations (e.g., dried baker's yeast). Furthermore, certain probiotic bacteria such as Lactobacillus rhamnosus and Lactobacillus casei have been shown to reduce the burden of intestinal helminthes (McClemens, J., et al Clinical and Vaccine Immunology 20(6) p. 818-826 (2013) and Berrelli, F., et al Frontiers in Cellular and Infection Microbiology 2 Article 141 (2012). Thus, as described herein for the first time, these or other Lactobacilli or probiotic bacteria, e.g., Bacillus subtilis, maybe combined with a Cry protein to achieve a surprisingly effective and synergistic anthelmintic effect.

    [0067] A probiotic microbe, e.g., Lactobacillus or Bacillus subtilis (e.g., B. subtilis strain PY79 or Bacillus subtilis natto), which is known to survive gastric transit and which can act as a live oral delivery vector, may be used in certain embodiments for delivery of Cry proteins in the GI tract. Cry proteins may be cloned, expressed, and ultimately secreted in active form in the GI tract of the subject after administration. Recombinant probiotic bacteria that can successfully and safely express biotherapeutic proteins in humans for clinical benefit already exist, e.g., for secretion of the anti-inflammatory cytokine IL-10 for treatment of colitis. (Steidler, L. et al. Science 289, 1352-1355 (2000); Braat, H. et al. Clin Gastroenterol Hepatol 4, 754-759 (2006); and Steidler, L. et al. Nat Biotechnol 21, 785-789 (2003)). This study demonstrated the safety and tolerability of orally formulated genetically-modified bacteria in humans and also verified that the bacteria were environmentally contained (did not propagate outside the human host). These and other studies indicate that: 1) probiotic bacteria are generally safe; and 2) probiotic bacteria may be genetically modified to synthesize and secrete therapeutic proteins to the mammalian GI tract.

    [0068] Probiotic bacteria are particularly applicable to the control of STHs because 1) probiotic bacteria can transiently (up to 3 weeks) pass through the small and large intestines, thereby secreting anthelmintics into the region where substantially all the STHs reside, 2) recombinant probiotic bacteria can cheaply express large amounts of Cry proteins prior to administration into the GI tract of a mammalian subject, and Cry proteins so expressed, independent of any Cry proteins that may be secreted by probiotic bacteria in the GI tract, have been shown to have a significant impact on STHs, and 3) studies using purified Cry protein to treat hookworms, whipworms, and H. bakeri, all in infected rodents, demonstrated that STHs in the mammalian GI tract can ingest and be killed/intoxicated by Cry proteins.

    [0069] Probiotic bacterium for use in this invention include but are not limited to Lactococcus sp., Lactobacillus sp., Bifidobacterium sp., Streptococcus sp., Leuconostoc sp., Pedicoccus sp., Enterococcus sp. Bacillus sp., and Escherichia sp. Lactococcus sp. includes but is not limited to L. lactis. Lactobacillus sp. includes but is not limited to L. casei, L. paracasei, L. acidophilus, L. bulgaricus, L. delbrueckii subsp. bulgaricus, L. helveticus, L. plantarum, L. salivarius, L. reuteri, L. gasseri, and L. animalis. Bifidobacterium sp. includes but is not limited to B. animalis, B. bifidum, B. breve, B. infantis, and B. longum. Streptococcus sp. includes but is not limited to S. thermophilus. Bacillus sp. includes but is not limited to B. subtilis, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, B. toyonensis, B. thuringiensis, B. clausii, and B. pumilus. Escherichia sp. includes but is not limited to E. coli.

    [0070] Probiotic yeast for use in certain contemplated embodiments of this invention include but are not limited to Saccharomyces sp., e.g., Saccharomyces boulardii.

    [0071] Crystal Proteins

    [0072] One goal according to certain herein disclosed embodiments is expression of anthelmintic Cry proteins (e.g., Crickmore et al., 1998 Microbiology and Molecular Biology Reviews 62(3): 807-813; Schnepf et al., 1998 Microbiology and Molecular Biology Reviews 62(3): 775-806; including but not limited to the B. thuringiensis Cry proteins Cry5B (e.g., SEQ ID NO:1) and its subvariants, Cry13A (e.g., SEQ ID NO:2) and its subvariants, Cry14A (e.g., SEQ ID NO:3) and its subvariants, Cry21A (e.g., SEQ ID NOS:4-5) and its subvariants, and Cry6A and its subvariants (e.g., SEQ ID NO:6)) in probiotic bacterium for delivery into a helminth (e.g., roundworm)-infected vertebrate animal gastrointestinal tract via oral dosing (gavage, drinking, eating, pill, capsule, powder, etc.). The Cry protein may be expressed intracellularly in the bacterium, allowing access to the anthelmintic protein after the bacterium lyses or opens up either due to digestion within the gastrointestinal tract, sporulation of certain bacteria, death of bacteria, ingestion and digestion of bacteria by the parasitic helminths (e.g., roundworms such as hookworms, whipworms, Ascaris, Strongyloides, veterinary parasitic roundworms of the intestine), etc. The Cry protein may also be expressed and secreted extracellularly by the probiotic bacterium so that the protein would be deposited directly into the GI tract where it could be accessed and ingested by any helminth (e.g., roundworm) inhabiting the GI tract. The Cry proteins may also be expressed in such a way that they are exposed to the extracellular environment of the bacterium and remain anchored to the cell wall of the probiotic bacterium.

    [0073] In certain embodiments, a probiotic bacterium as provided herein (which may in certain embodiments be LAB as described herein for certain illustrative purposes but which may in certain other embodiments be another probiotic bacterium such as Bacillus subtilis and others) may be introduced that expresses an individual Cry protein or that simultaneously expresses multiple Cry proteins. Additionally or alternatively, in certain embodiments multiple probiotic bacteria may be introduced, each of which expresses either a different individual Cry protein or simultaneously expresses multiple Cry proteins. In these and related embodiments, it is contemplated that the GI tract may be seeded with probiotic bacteria that express either one Cry protein or multiple Cry proteins at the same time. For example, due to the lack of cross-resistance between Cry5B-resistant roundworms and Cry21A-resistant roundworms, simultaneous expression of Cry5B and Cry21A in the gastrointestinal tract may inhibit the development of parasite resistance to the combination therapy.

    [0074] In certain embodiments, a probiotic bacterium as provided herein (which may in certain embodiments be LAB as described herein for certain illustrative purposes but which may in certain other embodiments be another probiotic bacterium such as Bacillus subtilis and others) which has not been genetically modified to express a heterologous Cry protein may be admixed and introduced into a mammalian GI tract along with purified Cry5B protein, e.g., heterologous Cry5B that has been expressed and purified from Bacillus thuringiensis. As described herein for the first time, a composition so formed by such admixture exhibited heretofore unpredicted biological activity, in a manner such that the specific probiotic bacterium (e.g., Bacillus subtilis natto, Bacillus subtilis PY79) synergized with Cry5B protein to enhance its anthelmintic properties.

    [0075] In the long run, removing antibiotic selection capability (e.g., genetic selection markers) from the plasmids that are employed to introduce heterologous Cry protein-encoding sequences, as well as using probiotic (e.g., lactobacillus or LAB) strains that are unable to replicate outside the vertebrate host, may be desirable in order to environmentally contain the genetically modified bacteria. For example, LAB bacteria have been engineered to be autotrophic in thymidine or thymine synthesis such that they can only grow in the vertebrate intestine where thymidine or thymine is present and not in the environment where thymidine or thymine is not present. See, e.g., Steidler L, et al. “Biological containment of genetically modified Lactococcus lactis for intestinal delivery of human interleukin 10.” Nat Biotechnol 21: 785-789 (2003).

    [0076] Cry-transformed probiotic bacteria such as Bacilli or LAB may be cultured and expression of intracellular, membrane-anchored, or secreted Cry protein by such bacteria may be confirmed using antibodies raised against each Cry protein and standard Western blotting or ELISA techniques.

    [0077] To assess the bioactivity of all constructs, recombinant LAB-expressing Cry protein (full length, truncated, or variants) may be fed to the free-living nematode, C. elegans. Cry protein toxicity on C. elegans using LC50, brood-size, developmental inhibition assays on solid media and in liquid wells may then be quantitated. C. elegans can access the Cry proteins either via protein secreted onto the solid media/into the liquid well or by their ability to grind, open and digest bacteria. Confirmation that the lactobacilli are making bioactive Cry proteins may be obtained. Furthermore, the bioactivity (e.g., LC.sub.50 in μg/mL) may be quantitated and the constructs giving the highest activity determined.

    [0078] Truncations, Variants, and Sub-Variants

    [0079] The crystal proteins may be truncated to enhance their effectiveness. The usefulness of Bt toxins (e.g., crystal proteins) for controlling STHs may be limited by the protein size that STHs can ingest. Some parasitic roundworms poorly ingest proteins larger than about 40 kD. Thus, the effectiveness of any particular Bt toxin may be limited by size exclusion of proteins that STHs take in and so should be small enough to be readily absorbed by the STH gut while retaining toxic activity. There are other compelling reasons to produce a toxin truncated from the full length version. A truncated toxin may be easier to express in probiotic bacteria or yeast. Producing a truncated toxin will also alleviate the requirement that the target STH has the proper proteases present to correctly process full length protoxin (which is inactive) to a truncated, active toxin form. Thus, a truncated toxin will be immediately available for intoxication independent of whether the proper protease processing enzymes are present in the STH target. Truncated toxin may also express at a higher level in probiotic bacteria or yeast because truncated toxins are soluble and less likely to form insoluble inclusions in the cell expressing them, which could be toxic to the cell or which could make the toxin fold incorrectly. Accordingly, it is desirable to produce truncated Bt toxin fragments (e.g., crystal protein fragments). Moreover, fragments of certain Bt toxins have been tested and shown to retain toxic activity and have improved biological properties. By “truncated,” when referring to a Bt toxin protein (crystal protein) is meant a Bt toxin protein that is not full-length but retains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the toxic activity of a corresponding full-length Bt toxin protein.

    [0080] “Variants” or “subvariants” of Cry proteins include polypeptides with one or more substitutions, e.g., no more than 20 substitutions, alternatively no more than 10 substitutions, or substitutions at 10% or fewer of the residues, relative to a corresponding wild-type polypeptide or truncated version thereof. The variant, subvariant, or truncated polypeptide has at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the activity, e.g., toxic activity, of the corresponding wild-type polypeptide or truncated version. Conservative substitutions include substitutions within the following groups: glycine, alanine, threonine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, cysteine; lysine, arginine; aspartic acid, glutamic acid; serine, threonine; asparagine, glutamine; phenylalanine, tyrosine.

    [0081] Nucleic acid molecules encoding amino acid sequence variants, truncated versions, or both, of a Cry protein are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by, for example, oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of protein. Moreover, the invention includes synthetic nucleic acid molecules where nucleotides are modified to include codons preferred in a particular organism, remove codons rarely used in a particular organism, or remove sequences that may inhibit transcription or RNA processing and the like.

    [0082] Cry protein truncations may at least include conserved blocks 1-5. As seen in FIGS. 1A and 1B, alignment of known Cry toxins reveals five conserved sequence blocks (blocks 1-5) that are common to a majority of the proteins and are thought to be located in the active toxin domain. See de Maagd, R. A., et al. “How Bacillus thuringiensis has evolved specific toxins to colonize the insect world.” TRENDS IN GENETICS 17(4): 193-99 (April 2001). Comparison of the carboxy-terminal halves of the sequences have suggested the presence of three additional blocks that lie outside of the active toxic core. See Schnepf, E., et al. “Bacillus thuringiensis and Its Pesticidal Crystal Proteins.” MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS 62(3): 775-806 (September 1998). Thus, Cry protein truncations may be truncated after the conserved amino acid sequence of block 5 (e.g., DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24)). Alternatively, Cry protein truncations may be truncated after the conserved amino acid sequence of block 5 (e.g., DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24)) plus an additional about 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids of the c-terminal domain.

    [0083] The complete amino acid sequence of Cry5Ba1 is listed in FIG. 2. The conserved amino acid sequence DRIEF (SEQ ID NO: 23) in Cry5B ends at amino acid number 693. Thus, a truncated form of Cry5B may include at least amino acids 50 through about 693. A truncated form of Cry5B may extend from about amino acid 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 693. Alternatively or in addition to, a truncated form of Cry5B may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.

    [0084] The complete amino acid sequence of Cry13Aa1 is listed in FIG. 3. The conserved amino acid sequence DRLEF (SEQ ID NO: 24) in Cry13A ends at amino acid number 688. Thus, a truncated form of Cry13A may include at least amino acids 50 through about 688. A truncated form of Cry5B may extend from about amino acid 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 688. Alternatively or in addition to, a truncated form of Cry13A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.

    [0085] The complete amino acid sequence of Cry14Aa1 is listed in FIG. 4. The conserved amino acid sequence DRIEF (SEQ ID NO: 23) in Cry14A ends at amino acid number 675. Thus, a truncated form of Cry14A may include at least amino acids 50 through about 675. A truncated form of Cry5B may extend from about amino acid 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 675. Alternatively or in addition to, a truncated form of Cry14A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.

    [0086] The complete amino acid sequence of Cry21Aa1 and Cry21Aa2 are listed in FIGS. 5A and 5B, respectively. The amino acid sequence of Cry21Aa2 is about 98% identical to the sequence of Cry21Aa1. The conserved amino acid sequence DRIEF (SEQ ID NO: 23) in Cry21A ends at amino acid number 685. Thus, a truncated form of Cry21A may include at least amino acids 50 through about 685. A truncated form of Cry5B may extend from about amino acid 1, 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 685. Alternatively or in addition to, a truncated form of Cry21A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.

    [0087] Anthelmintic Experiments

    [0088] Once heterologous Cry protein expression and bioactivity are confirmed in a desired probiotic bacterium, the modified bacteria may be used for curative-type and preventative-type anthelmintic experiments. By way of non-limiting example, the Bacillus or LAB strain expressing heterologous Cry protein may be any of the Bacilli or LAB mentioned above expressing either full length or truncated heterologous Cry protein (e.g., B. thuringiensis Cry5B, Cry13A, Cry14A, or Cry21A) with that Cry protein expressed intracellularly, anchored at the membrane, or secreted.

    [0089] Antibody Production:

    [0090] Antibodies against recombinant Cry proteins (e.g., Cry5B, Cry21A, Cry14A, Cry13A, and Cry6A, full length and truncated proteins) may be produced and purified according to standard methodologies (e.g., Current Protocols in Immunology, John Wiley & Sons, New York, N.Y. (2009).

    [0091] Bioactivity Tests:

    [0092] To assess the bioactivity of all constructs, recombinant bacilli or lactobacilli expressing heterologous Cry proteins are fed to the free-living nematode, C. elegans. C. elegans can access the Cry proteins either via protein secreted onto the solid media/into the liquid well or by their ability to grind and digest bacteria to open the bacterial cells.

    [0093] Rodent and Parasite Tests:

    [0094] Three intestinal parasitic nematodes—H. bakeri (small intestine nematode parasite) in mice, and Trichuris muris (whipworm) in mice, and A. ceylanicum (hookworm) in hamsters are tested. The tests address: 1) where in the GI tract do heterologous Cry-expressing bacilli or lactobacilli reside and for how long; and 2) how do these bacilli or lactobacilli affect the acquisition and progression of intestinal nematode parasites.

    [0095] Bacillus, Lactobacillus or Lactococcus Tests:

    [0096] Mice are gavaged with high doses of heterologous Cry-expressing Bacillus subtilis, Lactobacillus or Lactococcus (10.sup.9 cfu). A portion of the mice are periodically (twice/week up to one month) euthanized. Small and large intestinal homogenates can be prepared after washing intact tissue with Hanks' balanced salt solution twice and after removing the mucous layer and epithelium by 1 mM DTT twice and then 10 mM EDTA. Plating of these homogenates on medium plates, such as GM17 agar supplemented with an antibiotic appropriate to the selectable marker used on the expression system, will select for the bacterium. In addition, immunoblotting of plate colonies, transferred to nitrocellulose membrane, with anti-Crystal protein antibodies will be used to reveal which of the colonies on the plate are Cry-expressing bacteria. From these experiments, the colony forming units from the homogenates can be determined, indicative of how well the Cry-transformed bacteria are able to colonize the gastrointestinal tract over time (For an example, see Waeytens et al., Inflamm Bowel Dis 2008: 14:471-479).

    [0097] Parasite Tests:

    [0098] Naïve (uninfected mice) are gavaged with the best heterologous Cry-protein expressing Bacillus, Lactobacillus or Lactococcus strain(s) based on expression and bioactivity. Protect against acquisition test: Control mice receive the native (unmodified) Bacillus, Lactobacillus or Lactococcus which is incapable of Cry protein expression. A few days later, both groups of mice are then challenged with H. bakeri. Two weeks later, intestinal worm burdens and fecal egg counts are used to determine if the probiotics protect the mice against a challenge with infectious parasites. Protest against progression test: Mice are infected with H. bakeri. Two weeks later, infected mice are treated with heterologous Cry-protein expressing or control bacilli, lactobacilli, or lactococci, respectively. Intestinal worm burdens and fecal egg counts are used to determine if the probiotics provide anthelmintic therapy in mice with pre-existing nematode infections.

    [0099] Exemplary Parasites

    [0100] The present invention relates in certain preferred embodiments to the control of parasitic worms, e.g., nematodes and platyhelminths, using crystal proteins from Bacillus and their derivatives. Parasitic worms within the scope of the invention include but are not limited to those in Class Adenophorea, e.g., Order Mononchida, Family Plectidae, and Order Stichosomida, Family Mermithidae and Tetradonematidae; Class Secernentea, e.g., Order Rhabditida, Family Carabonematidae, Cephalobidae, Chambersiellidae, Heterorhabditidae, Oxyuridae, Panagrolaimidae, Rhabditidae, Steinernematidae, Syrphonematidae, Syrphonematidae, or Thelastomatidae; Order Spirurida, Family Filariidae, Onchocercidae, Physalopteridae, Syngamidae, Spiruridae, Subuluridae, or Thelaziidae; Order Diplogasterida, Family Diplogasteridae; and Order Tylenchida, Family Allantonematidae, Aphelenchidae, Aphelenchoididae, Entaphelenchidae, Fergusobiidae, Phaenopsitylenchidae, Sphaerulariidae, Anguinidae, Dolichodoridae, Belonolaimidae, Pratylenchidae, Hoplolamidae, Heteroderidae, Criconematidae, Tylenchulidae or Tylenehidae. In one embodiment, the parasite is from Class Secernentea, Order Ascaridida, Family Ascarididae; Class Adenophorea, Order Trichurida, Family Trichuridae; Class Secernentea, Order Strongylida, Family Ancylostomatidae (ancylostomidae) or Trichostrongylidae; or Class Secernentea, Order Spirurida, Family Dracunculidae, Filariidae, or Onchocercidae.

    [0101] The parasite may be a helminth. Helminths within the scope of the invention include but are not limited to those from Phylum Annelida, Class Polychaetae, Class Myzostomida, Class Clitellata, Subclass Hirudinea, Order Gnathobdellidae, Order Rhynchobdellidae; Phylum Platyhelminthes (Flatworms), Class Turbellaria, Class Monogenea, Order Monopisthocotylea, Order Polyopisthocotylea, Class Trematoda, Subclass Aspidogasrea, Subclass Digenea; Super Order Anepitheliocystida, Order Strigeatida, Family Schistosomatidae, Subfamily Schistosomatinae, Genus Schistosoma, Order Echinostomatida, Family Fasciolidae, Family Paramphistomatidae, Family Echinostomatidae; Super Order Epitheliocystida, Order Plagiorchiida, Family Dicrocoeliidae, Family Troglotrematidae, Order Opisthorchiida, Family Heterophyidae, Family Opisthorchiidae, Class Cestoda, Subclass Cestodaria, Subclass Eucestoda, Order Pseudophyllidea, Family Diphyllobothriidae, Order Cyclophyllidea, Family Taeniidae, Family Hymenolepididae, Family Dilepididae, Family Mesocestoididae, Order Tetraphyllidea, Order Proteocephalata, or Order Spatheobothridea. For example, Cry proteins with the scope of the invention may be employed to prevent, inhibit or treat Roundworm, Whipworm, Hookworm, Schistosome, or Trematodes.

    [0102] The parasite may also be a gastrointestinal tract parasitic roundworms/nematodes. The gastrointestinal tract parasitic roundworms/nematodes may include but are not limited to the following species: Haemonochus, Cooperia, Ostertagia, Trichostrongylus, Teladorsagia. Nematodirus, Ancylostoma, Cyathostominea/Cyathostomin/Cyathostome, Strongylus, Parascaris, Ascaris, Trichuris, Oesophagostomum/Oesophagustomum, Trichiuris, Bunostomum, Oxyuris, Chabertia, Habronema, Draschia, Triodontophorus, Toxocara, Toxascaris, and Uncinaria. Haemonochus species includes but is not limited to Haemonchus contortus and Haemonchus placei, Cooperia species includes but is not limited to Cooperia oncophora, Cooperia pectinata, and Cooperia curticei, Ostertagia species includes but is not limited to Ostertagia ostertagi, Ostertagia (Teladorsagia) circumcincta, and Ostertagia trifurcate. Trichostrongylus species includes but is not limited to Trichostrongylus axei, Trichostrongylus colubriformis, and T. circumcincta. Teladorsagia species includes but is not limited to Teladorsagia (Ostertagia) circumcincta. Nematodirus species includes but is not limited to Nematodirus spathiger. Ancylostoma species includes but is not limited to Ancylostoma caninum, Ancylostoma braziliense, and Ancylostoma tubaeforme. Cyathostominea/Cyathostomin/Cyathostome nematodes are also included. Strongylus species (small and large) includes but is not limited to Strongylus vulgaris, Strongylus equinus, and Strongylus edentatus. Parascaris species includes but is not limited to Parascaris equorum. Strongyloides species includes but is not limited to Strongyloides westeri. Ascaris species includes but is not limited to Ascaris suum. Trichuris species includes but is not limited to Trichuris globulosa, Trichuris suis, Trichuris campanula, and Trichuris vulpis. Oesophagostomum Oesophagustomum species includes but is not limited to Oesophagustomum dentatum, Oesophagustomum quadrispinulatum, Oesophagostomum columbianum, and Oesophagostomum venulosum. Trichiuris species includes but is not limited to Trichiuris ovis. Bunostomum species includes but is not limited to Bunostomum trigonocephalum. Oxyuris species includes but is not limited to Oxyuris equi (pin worms). Chabertia species includes but is not limited to Chabertia ovine. Habronema species includes but is not limited to Habronema microstoma and Habronema muscae. Draschia species includes but is not limited to Draschia megastoma. Triodontophorus species includes but is not limted to Triodontophorus minor and Triodontophorus serrates. Toxocara species includes but is not limted to Toxocara canis and Toxocara cati. Toxascaris species includes but is not limted to Toxascaris leonine. Uncinaria species includes but is not limted to Uncinaria stenocephala. Human parasitic roundworms of the gastrointestinal tract include but are not limited to the hookworms Ancylostoma duodenale and Necator americanus, the whipworm Trichuris trichiura, the roundworm Ascaris lumbricoides, the threadworm Strongyloides stercoralis, and the pinworm Enterobius vermiculari.

    [0103] As used herein, unless the context makes clear otherwise, “treatment,” and similar words such as “treated,” “treating” etc., indicates an approach for obtaining beneficial or desired results, including and preferably clinically desirable results. Treatment can involve optionally either the amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition.

    [0104] As used herein, unless the context makes clear otherwise, “reducing the likelihood of occurrence,” “prevention,” and similar words such as “prevented,” “preventing” etc., include approaches for preventing, inhibiting, or decreasing the likelihood of the onset or recurrence of a disease or condition, in a manner that exhibits statistical significance, for example, when compared to the results obtained when the indicated method steps are omitted. Similarly, also included are preventing, inhibiting, or decreasing the likelihood of the occurrence or recurrence of the symptoms of a disease or condition, or optionally delaying the onset or recurrence of a disease or condition, or delaying the occurrence or recurrence of the symptoms of a disease or condition. As used herein, “prevention” and similar words also include reducing the intensity, effect, symptoms and/or burden of a disease or condition prior to onset or recurrence of the disease or condition. Methods according to these and related embodiments may be practiced using an effective amount or a therapeutically effective amount of an agent that substantially eradicates, reduces the severity of, or reduces the likelihood of occurrence of a soil-transmitted helminth (STH) infection. As used herein, an “effective amount” or a “therapeutically effective amount” of a composition, agent or substance is that amount sufficient to obtain a desired biological effect, such as beneficial results, including clinical results.

    [0105] In certain preferred embodiments, the herein described compositions for treating or reducing the severity or likelihood of occurrence of an STH infection will be formulated as pharmaceutical compositions, which will preferably be formulated for oral delivery. Pharmaceutical compositions are formulated so as to allow the agent(s) contained therein to be bioavailable upon administration of the composition to a human.

    [0106] It will be appreciated that the practice of the several embodiments of the present invention will employ, unless indicated specifically to the contrary, conventional methods in virology, immunology, microbiology, molecular biology and recombinant DNA techniques that are within the skill of the art, and many of which are described below for the purpose of illustration. Such techniques are explained fully in the literature. See, e.g., Current Protocols in Molecular Biology or Current Protocols in Immunology, John Wiley & Sons, New York, N.Y. (2009); Ausubel et al., Short Protocols in Molecular Biology, 3.sup.rd ed., Wiley & Sons, 1995; Sambrook and Russell, Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Maniatis et al. Molecular Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., 1985); Transcription and Translation (B. Hames & S. Higgins, eds., 1984); Animal Cell Culture (R. Freshney, ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984) and other like references.

    [0107] Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. These and related techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. Unless specific definitions are provided, the nomenclature utilized in connection with, and the laboratory procedures and techniques of, molecular biology, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for recombinant technology, molecular biological, microbiological, chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

    [0108] As used in this specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the content clearly dictates otherwise. Throughout this specification, unless the context requires otherwise, the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers. Each embodiment in this specification is to be applied mutatis mutandis to every other embodiment unless expressly stated otherwise.

    EQUIVALENTS

    [0109] While particular steps, elements, embodiments and applications of the present invention have been shown and described herein for purposes of illustration, it will be understood, of course, that the invention is not limited thereto since modifications may be made by persons skilled in the art, particularly in light of the foregoing teachings, without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

    [0110] The following Examples are presented by way of illustration and not limitation.

    Example 1

    Expression of Cry Proteins in Lactobacillus (LAB)

    [0111] Cry proteins (full length protoxins and truncated toxins; 4 constructs total) are cloned and expressed in two Lactobacilli, L. acidophilus and L. gasseri. The Klaenhammer group at North Carolina State University has sequenced the genome of L. acidophilus NCFM and L. gasseri ATCC33323 and developed numerous genetic tools for gene cloning and expression of proteins, enzymes, and vaccines in these microbes. See, e.g., Mohamadzadeh, et al. PNAS 106, 4331-6 (2009)) and Goh, Y. J. et al. APPL ENVIRON MICROBIOL 75, 3093-105 (2009))

    [0112] To enhance translation efficiency and Cry protein expression, codon optimization can be employed in which the codon use of a given Cry protein is altered to match that of the most frequently used codons found in the probiotic bacterium of interest. An example of successful application of this technique is given in Pusch et al., J Acquir Immune Defic Syndr 40:512-520 (2005). An example of a codon optimization tool that can be found by simple googling “codon optimization tool” is the website http://www.jcat.de/, which includes genome information from probiotic bacteria. Thus, this website can be used to codon optimize a Cry protein for expression in a particular probiotic bacterium. Level of product and/or secretion of Cry proteins (e.g., Cry5B and Cry21A) are determined using Western blotting with antibodies. The use of different probiotic species, different Cry proteins (e.g., Cry5B and Cry21A), and different versions of each (full length and truncated constructs) will maximize likelihood of success in Cry protein expression. The genetic constructs may also include a genetic strategy for containment of genetically modified bacterium, e.g., a thymidine auxotroph. (Steidler, L. et al., Nat. Biotechnol. 21: 785-89 (2003))

    [0113] Anthelmintic Cry proteins (including and not limited to Cry5B and its subvariants, Cry13A and its subvariants, Cry14A and its subvariants, and Cry21A and its subvariants) are expressed, as both intracellularly expressed and secreted forms, in lactic acid bacteria (LAB) such as Lactobacillus plantarum NCIMB8826 or ATCC 14917, Lactococcus lactis MG1363, and Lactobacillus gasseri ATCC 9857 using the pTSV1 and pTSV2 vectors. (See Pusch O, et al. “Bioengineering lactic acid bacteria to secrete the HIV-1 virucide cyanovirin.” J ACQUIR IMMUNE DEFIC SYNDR 40: 512-520 (2005) and Pusch O, et al. “An anti-HIV microbicide engineered in commensal bacteria: secretion of HIV-1 fusion inhibitors by lactobacilli.” AIDS 20: 1917-1922 (2006)) This expression system (pTSV1 and pTSV2 vectors) includes derivatives of the pTREX1 broad Gram-positive host range vector as well as the pUC origin of replication and ampicillin resistance gene to enable them to be used as shuttle vectors in E. coli. Expression is driven by the phage promoter LPS2 followed by the translation initiation region from L. lactis promoter 11. These elements contain Shine-Dalgarno as well as ATG and ATGA start/stop translation inititaiton codons. FIGS. 6 and 7 describe these vectors and their use for heterologous expression of other proteins. The vectors are assembled using PCR and restriction sites and common molecular biology techniques. See id.

    [0114] FIG. 6 depicts the design of an expression system for heterologous protein secretion in LAB—expression cassettes for Cry5B for intracellular expression (pTSV1-Cry5B) and secretion into the medium (pTSV2-Cry5B). Restriction sites used for cloning are in bold. Usp45 leader indicates gene fusions with the leader sequence of the lactococcal secreted protein Usp45, followed by its original signal peptidase cleavage site DTNSD (SEQ ID NO: 25) (D) for enhanced secretion (pTSV2-Cry5B). Vertical black arrows indicate the signal peptidase cleavage site (SPCS), followed by Cry5B directly (pTSV2-Cry5B) or propeptide sequence DTNSD (SEQ ID NO: 25) (pTSV2-Cry5B/pTSV2-D-Cry5Bco). Cry5B co indicates codon optimization of Cry5B for expression in recombinant LAB. TT1 and TT2 indicate transcription terminators; LPS2 P, LPS2 bacteriophage promoter; SD, Shine-Dalgarno motif; ATG and ATGA (start/stop), translation initiation start codons; P11 TIR, translation initiation region from L. lactis promoter 11 See Pusch, O. et al., “Bioengineering Lactic Acid Bacteria to Secrete the HIV-1 Virucide Cyanovirin” J Acquir Immune Defic Syndr 40(5): 512-20 (Dec. 15, 2005).

    [0115] FIG. 7 depicts a pTSV2 expression and secretion cassette. Fusion inhibitor sequences are codon adjusted to the codon usage of L. plantarum and are introduced into unique EcoRI and BamHI restriction sites. Expression is driven by the phage promoter LPS2. See Pusch, O et al., “An anti-HIV microbicide engineered in commensual bacteria: secretion of HIV-1 fusion inhibitors by lactobacilli.” AIDS 20: 1917-22 (2006).

    [0116] Using either a unique engineered restriction site (e.g., Bcl 1, Nae 1, or other appropriate restriction site compatible with each Cry gene and the vectors) or PCR sewing, the Cry gene is fused downstream in-frame of the ATGA sequence in the P11 TIR region. In the case of intracellular Cry protein expression, this pTSV1 vector system is sufficient. In the case of secreted Cry protein expression, the lactococcal signal leader derived from the usp45 gene of L. lactis is fused just downstream of the ATGA sequence (vector pTSV2) and upstream of the Cry gene, which will allow the Cry protein to be fused to the signal sequence. In all cases, the TT2 transcription terminator is placed downstream of the Cry gene sequence. Both full-length (pro-toxin) and truncated (e.g., amino acids 1-697 of Cry5B and similar truncations in Cry13A, Cry14A, and Cry21A, which removes the protoxin domain just after conserved block 5 (or box V)) Cry proteins are expressed this way. The advantage of truncated Cry proteins is that they may be easier to express or secrete due to their smaller size. To aid in secretion of the Cry protein, the negatively charged peptide DTNSD (SEQ ID NO: 25) (the first five amino acids of the secreted L. lactis Usp435 protein) may be fused (using recombinant DNA techniques) to the N-terminus of the Cry protein. See id. In addition, the codon usage of the Cry protein can be optimized using codon usage found in each LAB to permit higher levels of expression in that LAB. See id. Once assembled, the vectors (each Cry protein, full length and truncated versions, intracellular expression and extracellular secretion versions) are transformed into L. lactis, L. plantarum, L. gasseri, or other LAB using standard techniques. See id. It has been found that expression from these vectors are compatible with these three (and likely many more) LAB. See id.

    [0117] In addition to expression of intracellular Cry protein and secreted Cry protein, the vectors are modified to allow expression of Cry protein anchored in the membrane of the LAB. For these studies, the Cry proteins (either full length or truncated) are fused at their C-termini to the C-terminal membrane anchoring domain of lactococcal cell surface-associated proteinase (PrtP). See Norton P M, et al. “Factors affecting the immunogenicity of tetanus toxin fragment C expressed in Lactococcus lactis.” FEMS IMMUNOL MED MICROBIOL 14: 167-177 (1996). The domain is fused to the Cry protein using standard DNA recombinant techniques.

    Example 2

    Expression of Cry Proteins in Bifidobacteria

    [0118] An expression system for Bifidobacteria has been described. See Shkoporov A N, et al. “Production of human basic fibroblast growth factor (FGF-2) in Bifidobacterium breve using a series of novel expression/secretion vectors.” BIOTECHNOL LETT 30: 1983-1988 (2008). Cry proteins are cloned and expressed in Bifidobacteria such as B. breve UCC2003, B. longum VMKB44, and B. bifidum ATCC 15696 using a vector system (pESH46, pESH47, pESH86) that employs the promoter/TIR and terminator regions of the hup gene or the promoter/TIR region of the gap gene along with the terminator of the hup gene. Expression under these promoters allows for intracellular production of Cry proteins (full length and truncated). To allow for secretion, the first 11 N-terminal amino acids of a mature polypeptide of the bifidobacterial Sec2 secreted protein is fused to the N-terminus of the Cry proteins. These constructs are transformed into Bifidobacteria and are tested for expression and bioactivity as described below.

    Example 3

    Expression of Cry Proteins in Bacillus

    [0119] Bacillus cereus (e.g., var. toyoi, var. toyoii), Bacillus toyonensis, Bacillus thuringiensis (e.g., var. HD1), or Bacillus subtilis (e.g., var. PY79, var. natto; can be used as a probiotic) is used to express Cry proteins using either sporulation promoters (early sporulation Cry3A, late sporulation Cry5B) or a constitutive promoter (e.g., the mbg promoter). See, e.g., Shao X, et al. “Surface display of heterologous proteins in Bacillus thuringiensis using a peptidoglycan hydrolase anchor.” MICROB CELL FACT 8: 48 (2009). In the latter case, a secretion signal is added to the Cry protein constructs to allow for secretion of the proteins (full length or truncated). These constructs are transformed into B. cereus, B. toyonensis, B. thuringiensis, and B. subtilis strains and are tested for expression and bioactivity as described below. In, addition, strong expression promoters (constitutive and inducible) have been made for B. Subtilis, and these and other genetic elements described herein are referred to as being “operably linked” when they are present in a polynucleotide construct and situated in a manner that permits them to exert the desired function, such as promotion of specific gene transcription (See, e.g. Phan T T, et al. “Novel plasmid-based expression vectors for intra- and extracellular production of recombinant proteins in Bacillus subtilis.” PROTEIN EXPR PURIF 46: 189-195 (2006). Secreted versions of proteins are made by addition of the signal peptide of the amyQ gene. See id. Thus, similar expression/curative experiments are carried out using Bacillus subtilis as the probiotic strain.

    Example 4

    Expression of Cry Proteins in Lactobacillus Gasseri (e.g., NCK334), Lactobacillus Johnsonii (e.g., NCK89), Lactobacillus Acidophilus (e.g., NCK56), and Lactobacillus Reuteri (e.g., NCK932)

    [0120] Cry proteins (Cry5B, Cry13A, Cry14A, Cry21A, full length and truncated) are expressed on the pTRK882 shuttle vector, which uses the operably linked strong constitutive expression promoter Ppgm and terminator Term908. See, e.g., Mohamadzadeh M, et al. “Dendritic cell targeting of Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice from lethal challenge.” PROC NATL ACAD SCI USA 106: 4331-4336 (2009). This vector is made by using recombinant DNA techniques to clone the pgm promoter and terminator into the pTRK563 shuttle vector. See, e.g., Russell W M and Klaenhammer T R “Identification and cloning of gusA, encoding a new beta-glucuronidase from Lactobacillus gasseri ADH.” APPL ENVIRON MICROBIOL 67: 1253-1261 (2001). FIG. 8 depicts plasmids for expression of rPA peptide fusions. Schematic for expression of Cry protein in the pTRK895/896 expression system is shown. Determinants of replication are shown as black arrows; transcriptional terminators as black boxes. erm=erythromycin resistance gene. Ppgm is the strong constitutive promoter for the pgm gene of L. acidophilus. Mohamadzadeh M, et al. PROC NATL ACAD SCI USA 106: 4331-4336 (2009). The genes are cloned into the vector using restriction sites such as BamHI and/or NotI. A secreted version of the Cry proteins is obtained as per example 1 above (fusing the lactococcal signal leader derived from the usp45 gene of L. lactis). Codon optimization and use of the negatively charged peptide DTNSD (SEQ ID NO: 25) are employed to improve expression as in example 1. These constructs are transformed into bacteria. See, e.g., Walker D C, et al. “Electrotransformation of lactobacillus acidophilus group A1.” FEMS MICROBIOL LETT 138: 233-237 (1996). Expression and bioactivity will be tested as described below.

    Example 5

    Gene Replacement and Generation of a Lactococcus Thymidine Auxotroph

    [0121] A genetically modified Lactococcus lactis MG1363 is created by replacing the thymidylate synthase gene (thyA) with the full length coding sequence of Cry5B, Cry21A, Cry14A, or Cry13A and truncated derivatives of each (e.g. residues 1-697 for Cry5B). Because thyA is required for L. lactis to propagate, replacement of the gene with any of the mentioned cry genes will disallow the bacterium from growing without a source of thymidine or thymine. This prevents its buildup in the environment where thymidine sources are scarce; however allow the bacterium to proliferate in the GI tract. See, e.g., Steidler L, et al. NAT BIOTECHNOL 21: 785-789 (2003). Using synthetic oligonucleotides, 1.5 or 2 kb regions immediately upstream and downstream of the thyA start and stop codons from L. lactis MG1363 genomic DNA are amplified. These amplicons are fused to the 5′ and 3′ ends of a full-length or truncated cry gene by overlap extension PCR. Similarly, these thyA-flanking regions are also fused to cry genes that have been modified to contain the sequences allowing for partial or complete secretion of the Cry protein directly downstream of it. To the 5′ end of the respective full-length or truncated cry gene, a 27 residue Usp45 leader peptide is added for secretion of the expressed Cry protein. For the anchorage of expressed Cry proteins outside the membrane, a 201-residue leader and pro-sequence of PrtP from L. casei will be added. See Holck A and Naes H “Cloning, sequencing and expression of the gene encoding the cell-envelope-associated proteinase from Lactobacillus paracasei subsp. paracasei NCDO 151.” J GEN MICROBIOL 138: 1353-1364 (1992). These fusion products are cloned into conditionally non-replicative plasmids (see Law J, et al. “A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes.” J BACTERIOL 177: 7011-7018 (1995)) to produce recombinant L. lactis MG1363 strains in which the thyA gene is replaced by the respective full-length or truncated cry gene, with or without a leader sequence, via double homologous recombination. Exchange between thyA and cry5B genes is depicted in FIG. 9. Gray lines represent target areas for recombination, thick black lines represent nontarget MG1363 chromosome fragments and thin black lines represent the exchange vector. 1, 2 and 3 represent PCR primer pairs (F and R), designed in such a way that PCR using primer pair 1 shows collinearity between chromosomal DNA located 5′ of the target area and cry5B (PCR1), that PCR using primer pair 2 shows collinearity between chromosomal DNA located 3′ of the target area and cry5B (PCR2), and that PCR using primer pair 3 shows the presence of thyA (PCR3). Stages include (1) introduction of the nonreplicative vector; (2) 5′ crossover, forced by erythromycin selection and identified by PCR1; (3) second crossover in the absence of Em, identified through screening by PCR2; and (4) acquisition of desired transgenic chromosome organization. Steidler L, et al. NAT BIOTECHNOL 21: 785-789 (2003).

    [0122] Chromosomal mutants of L. lactis that are selected for the testing of the biological activity of expressed Cry proteins are those that contain the least amount of foreign DNA and contain an intact thyA promoter region directly upstream of the insertional deletion. Mutants of this sort are detected by southern blotting using a combination of thyA and cry gene probes. The ability of each strain to produce intracellular, secretory or membrane-bound Cry5B, Cry21A, Cry14A, or Cry13A and their truncated forms respectively are then tested in vivo. Expression and bioactivity are tested as described below.

    Example 6

    NICE Driven Expression of CRY Proteins in Lactococcus Lactis

    [0123] An alternative expression system for multidomain proteins in L. lactis is the highly inducible Nisin-controlled gene expression system sold by MoBiTec GmbH, Germany. Nisin is a natural food preservative produced by L. lactis and is nontoxic to humans. In fact, it has been show that 30% of consumer milk products contain substantial amounts of nisin. See Beasley S S and Saris P E “Nisin-producing Lactococcus lactis strains isolated from human milk.” APPL ENVIRON MICROBIOL 70: 5051-5053 (2004). L. lactis NZ9000, a derivative of MG1363 in which the transduction signals nisR and nisK were inserted into the chromosome, is used as a host for the expression of Cry proteins. The full CDS or truncated forms of either Cry5B, Cry21A, Cry14A, or Cry13A will be placed downstream of the inducible nisin promoter by using a combination of vector-backbone exchange (VBEx) and ligation independent cloning (LIC), a cloning strategy that has been well characterized and shown in FIG. 10. In FIG. 10A, in the LIC procedure, cry5B is amplified using primers containing LIC-specific overhangs. The plasmid is linearized by Swal restriction in the LIC cassette. Single-stranded overhangs of the PCR product and vector are generated using T4 DNA polymerase. The complementary overhangs of PCR product and vector anneal upon mixing. The resulting heteroduplex is transformed efficiently into E. coli. In FIG. 10B, in the VBEx strategy, the L. lactis expression vector pNZxLIC is cut at the two introduced SFiI sites. Plasmid pERL consists of the pSH71 replicon from pNZxLIC fused to an erythromycin marker. Plasmid pRExLIC consists of the cat marker and LIC sequence from pNZxLIC, fused to the E. coli pBR322 replicon and the bla marker. This vector is subjected to the LIC procedure (a); then the pNZxLIC vector is restored by mixing pERL and pRExLIC-cry5B, digestion with Sfil, ligation and selection on the ability to replicated in L. lactis in the presence of chloramphenical. Geertsma E R and Poolman B “High-throughput cloning and expression in recalcitrant bacteria.” NAT METHODS 4: 705-707 (2007). This strategy eliminates the use of large shuttle vectors and generates genuine expression plasmids for recalcitrant bacteria. Using nLIC or cLIC primers, each respective full length or truncated cry gene is amplified and cloned into the appropriate vectors in Table 2 below for the VBEx procedure. See id. Expression, secretion, and bioactivity of Cry proteins in each recombinant L. lactis NZ9000 strain is then characterized. Expression and bioactivity are tested as described below. Nisin is included either in the growth medium (bacterial growth) or in the water/food (mice) to induce expression.

    TABLE-US-00002 TABLE 2 Vector name Protein sequence Protein sequence after TEV protease cleavage Expression host pREnLIC M-His.sub.10-G-TEV site-protein G-protein L. lactis NZ9000 pREcLIC MGGGFA-protein-TEV site-His.sub.10 MGGGFA-protein-ENLYFQ L. lactis NZ9000 pREcLIC-GFP MGGGFA-protein-TEV site-GFP-His.sub.10 MGGGFA-protein-ENLYFQ L. lactis NZ9000 pRE-USP45-nLIC M-ssUSP45.sup.21-His.sub.10-G-TEV site-protein G-protein L. lactis NZ9000 pBADnLIC M-His.sub.10-G-TEV site-protein G-protein E. coli pBADcLIC MGGGFA-protein-TEV site-His.sub.10 MGGGFA-protein-ENLYFQ E. coli pBADcLIC-GFP MGGGFA-protein-TEV site-GFP-His.sub.10 MGGGFA-protein-ENLYFQ E. coli pBAD-OmpA-nLIC M-ssOmpA.sup.21-His.sub.10-G-TEV site-protein G-protein E. coli

    [0124] Other vectors for the expression of the full length or truncated forms of either Cry5B, Cry21A, Cry14A, or Cry13A include the E. coli/Lactococcus shuttle vector pMSP3535H3, which incorporates the nisin immunity gene (nisi) and the NICE expression system on the same plasmid. See Oddone G M, et al. “Incorporation of nisl-mediated nisin immunity improves vector-based nisin-controlled gene expression in lactic acid bacteria.” Plasmid 61: 151-158 (2009). This system has been used to express recombinant proteins in a variety of gram-positive organisms including L. lactis, Lactobacillus paracasei, Streptococcus mutans, Enterococcus faecalis, Streptococcus gordonii. See id. Full length or truncated forms of either Cry5B, Cry21A, Cry14A, or Cry13A, with and without leader peptide sequences for partial or full secretion, are cloned into pMSP3535H3 downstream of the nisin promoter. The constructs are transformed into plasmid free L. lactis MG1363 recombinant strains and are characterized for expression, secretion and bioactivity of Cry proteins. Expression and bioactivity are tested as described below.

    Example 7

    Expression of Cry Proteins in Probiotic E. Coli Using the Arabinose Operon

    [0125] The VBEx procedure also extends to other host organisms with plasmids. One of the most intensively studied probiotics is Escherichia coli Nissle 1917 (EcN). See, e.g., Schroeder B, et al. “Preventive effects of the probiotic Escherichia coli strain Nissle 1917 on acute secretory diarrhea in a pig model of intestinal infection.” DIG DIS SCI 51: 724-731 (2006). Using the appropriate E. coli LIC/VBEx vectors in Table 2, probiotic EcN strains expressing the full length or truncated forms of either Cry5B, Cry21A, Cry14A, or Cry13A are generated in the same fashion as described above for L. lactis. Expression of these proteins is dependent upon arabinose, with the genes being placed downstream of the arabinose operon (pBAD). Expression and bioactivity are tested as described below.

    Example 8

    Curative Experiment A—Protocol for Infections, Anthelmintic Treatment, and Determination of Treatment Efficacy (Small Intestine Roundworm Parasite)

    [0126] Six week old female Swiss Webster mice are infected per os with a suspension of 200±10 Heligmosomoides bakeri infective third-stage larvae in 0.1 mL of distilled water. The outbred strain Swiss Webster is used to better “mimic” treating a genetically diverse host (like humans). Each mouse is gavaged on day 15 post-infection (PI) with 0.1 mL of buffer, 0.1 mL of high dose LAB control (transformed with empty vector) or 0.1 mL of high dose LAB expressing Cry protein (6-10 animals/group). Progression of the infection is determined by fecal egg counts every other day beginning 3 days before treatment. Mice are placed individually in empty plastic cages for 1 h each morning, and the fecal pellets are collected into 50 mL centrifuge tubes. The number of eggs present is counted using the modified McMaster technique. See Hu Y, et al. “Bacillus thuringiensis Cry5B protein is highly efficacious as a single-dose therapy against an intestinal roundworm infection in mice.” PLOS NEGL TROP DIS 4: e614 (2010). At 1, 2, or 3 weeks after treatment, the animals from all three groups are euthanized and the intestinal worm burdens are counted. Using fecal egg counts and intestinal worm burdens, the ability of Cry-expressing LAB to cure small intestinal roundworm infections are ascertained.

    Example 9

    Curative Experiment B—Trichuris Muris: Whipworm (Large Intestine Roundworm Parasite)

    [0127] Twenty-one (21) 6-8 week old female AKR mice are infected per os with 200 infectious-staged T. muris eggs. Thirty (30) days post-infection, the mice are treated per os (7/group) with a single 0.1 mL dose of buffer, 0.1 mL high dose of LAB control (transformed with empty vector), or 0.1 mL of high dose LAB expressing Cry protein. Fecal egg counts are taken three days before treatment and then every other day until necropsy (same protocol to collect eggs as per H. bakeri). The mice are euthanized either 1, 2 or 3 weeks after treatment and worm burdens in the large intestine are determined. Using fecal egg counts and intestinal worm burdens, the ability of Cry-expressing LAB to cure large intestinal roundworm infections are ascertained.

    Example 10

    Curative Experiment C—Ancylostoma Ceylanicum: Hookworm (Blood Feeding, Small Intestinal Roundworm Parasite)

    [0128] Twenty one (21) 4-week old Syrian hamsters are infected per os with 150 infectious staged L3 A. ceylanicum hookworm larvae. Fourteen (14) days post-infection, the hamsters are treated per os with a single 0.1 mL dose of buffer, 0.1 mL high dose of LAB control (transformed with empty vector), or 0.1 mL of high dose LAB expressing Cry protein. Body weight, hemoglobin levels, and fecal egg counts (beginning three days before treatment) are monitored every other day until day 21, 28, or 35, at which point the animals are euthanized and worm burdens in the small intestine are determined. Using fecal egg counts, hemoglobin levels, and intestinal worm burdens, the ability of Cry-expressing LAB to cure blood-feeding small intestinal roundworm infections are ascertained.

    Example 11

    Preventative-Type Experiment A

    [0129] Swiss Webster mice as above (6-10 each group, three groups) receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression. Some (about 2-21) days later, all groups of mice are then challenged with 200 H. bakeri infectious larvae as described above. Two weeks later after infection challenge, fecal egg counts are determined every other day for one to two weeks, after which time the mice are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the mice against a challenge with a small intestine roundworm parasite (i.e., prevented infection).

    Example 12

    Preventative-Type Experiment B

    [0130] AKR mice as above (6-10 each group, three groups) receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression. Some (about 2-21) days later, all groups of mice are then challenged with 200 T. muris infectious eggs as above. Thirty (30) days after infection challenge, fecal egg counts are determined every other day for one to two weeks, after which time the mice are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the mice against a challenge with a large intestine roundworm parasite (i.e., prevented infection).

    Example 13

    Preventative-Type Experiment C

    [0131] Hamsters as above (6-10 each group, three groups) receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression. Some (about 2-21) days later, all groups of hamsters are then challenged with 150 A. ceylanicum infectious larvae as above. Two weeks after infection challenge, fecal egg counts are determined every other day for one to two weeks, after which time the hamsters are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the hamsters against a challenge with a small intestine blood-feeding roundworm parasite (i.e., prevented infection). In addition to experiments with rodents described above, similar experiments could be carried out with other mammals, e.g., felines, canines, bovines, equines, swines, caprines, ovines, and primates.

    Example 14

    Bacillus Subtilis Strain Engineered for Treatment of STHs

    [0132] Construction and verification of strains and preparation of lysates. The B. subtilis strain PY79 was transformed with the plasmid vector pHT3101 (PY79-vector) or with a pHT3101-derived cry5B plasmid (PY79-Cry5B) (29). Natural competence was generated in PY79 by use of a standard medium shift protocol (30). To generate spore lysates and spore crystal lysates, PY79 strains were sporulated for 96 h at 37° C., spun down, washed once with prechilled 0.5MNaCl, and washed again with prechilled sterile double-distilled water. Final pellets were stored at −80° C. until use.

    [0133] Transformants were screened by PCRs using the following primers on all three strains (PY79, PY79-vector, and PY79-Cry5B): Cry5B primer forward 1 (CGTTCAAAATCATCCGTAAATG) (SEQ ID NO: 26) with Cry5B primer reverse 1 (AAATGCATGAACCACTTCCAC) (SEQ ID NO: 27) (predicted product of 586 nucleotides [nt]), Cry5B primer forward 2 (TGGCAACAATTAATGAGT TGTATCCAG) (SEQ ID NO: 28) with Cry5B primer reverse 2 (CTGCCTTGACAAATGG CTACT) (SEQ ID NO: 29) (predicted product of 497 nt), and pHT3101 primer forward (CACCCCAGGCTTTACACTTTA) (SEQ ID NO: 30) with pHT3101 primer reverse (AGG CGATTAAGTTGGGTAACG) (SEQ ID NO: 31) (predicted product of 220 nt with empty vector pHT3101 and 6.5 kb with the cry5B insert). Templates were prepared as follows.

    [0134] Single colonies of PY79, PY79-vector, and PY79-Cry5B were picked from plates and suspended in 50 μl of sterile double-distilled water. These bacterial solutions were boiled for 3 min and then snap-frozen in liquid nitrogen for 3 min. The procedure was repeated for a total of three cycles of boiling-freezing. Supernatants were collected and used as PCR templates. Cycles were carried out using Taq polymerase under the following conditions: 94° C. for 3 min and then 35 cycles of 94° C. for 30 s, 54° C. for 45 s, and 72° C. for 1 min, followed by 72° C. for 10 min. All amplified products were sequenced to confirm identities. To determine putative transcription factor binding sites, 1.5 kb of the region upstream of the cry5B start codon was entered into the DBTBS database (31; http://dbtbs.hgc.jp/), and the P value was set to 0.05. Two putative sigma E binding sites were revealed, 43 and 712 bases upstream of the start codon.

    [0135] The identity of the strains was further confirmed by analysis of selected proteins. Cell lysates were fractionated by 8% SDS-PAGE, and protein bands were excised from the gels. Proteins were prepared for mass spectrometric sequencing by in-gel digestion with trypsin and then analyzed by high-pressure liquid chromatography (HPLC) in combination with tandem mass spectroscopy (MS/MS) using electrospray ionization as described previously (32). The collected data were analyzed using MASCOT (Matrix Sciences) and Protein Pilot 4.0 (AB Sciex) for peptide identifications.

    [0136] SEM. In preparation for scanning electron microscopy (SEM) imaging, the samples were drop-cast on a polished Si chip and dried in a vacuum. The samples were then sputter coated with iridium in an Emitech K575X sputter coater. The sputter current was 85 mA, the argon pressure was 2 Pa, and the deposition time was 7 s, resulting in a film thickness of <10 nm. The samples were imaged with an FEI XL30 ESEM FEG instrument, using a 10-kV beam energy and a spot size of 3.

    [0137] C. elegans bioassays and A. ceylanicum curative experiments. Ancylostoma ceylanicum hookworms were maintained in golden Syrian hamsters (14). All animal experiments were carried out under protocols approved by the UCSD Institutional Animal Care and Use Committees (IACUC). All housing and care of laboratory animals used in this study conformed to the Guide for the Care and Use of Laboratory Animals (33) and all requirements and regulations issued by the USDA, including regulations implementing the Animal Welfare Act (P.L. 89-544) as amended (see 18-F23). Caenorhabditis elegans was maintained according to standard procedures (34).

    [0138] The concentration of Cry5B protein in PY79-Cry5B spore crystal lysates was determined as previously described for BtCry5B spore crystal lysates (13). Dose-dependent C. elegans mortality bioassays (three independent trials) were carried out as previously described (13), including use of tetracycline at 30 μg/ml, except that the assays were carried out for 6 days and each well contained-25 to 30 animals (with triplicate wells per experiment and three independent experiments). The 50% lethal concentration (LC50) was calculated using PROBIT (35).

    [0139] For in vivo curative experiments, male hamsters were infected per os with 150 A. ceylanicum infectious larvae. On day 17 postinoculation (p.i.), a fecal sample was collected from each hamster, and the number of eggs was counted using the modified McMaster technique (13). On the basis of these fecal egg counts, the hamsters were segregated to ensure that the groups (control and treatment) had roughly equivalent infection levels. On day 18 p.i., hamsters were weighed individually and given either PY79-Cry5B spore lysate or a spore dose equivalent of PY79-vector spore lysate per os through a blunt-ended gavage needle. Feces were collected on days 1 and 3 post-treatment to determine fecal egg counts (13). The hamsters were sacrificed on day 22 p.i., and intestinal parasite burdens were determined as described previously (14). The one-tailed Mann-Whitney test was performed to compare the two groups for significance in the experiment using a dose of 10 mg/kg of body weight (data were calculated and plotted using Prism 5 [GraphPad Software Inc., La Jolla, Calif.]). Fecal egg counts were compared using one-tailed Student's t test. For the dose-response experiment, results for each treatment group were compared to those for the control group by one-way analysis of variance and Dunnett's method.

    [0140] Results

    [0141] Cry5B was well produced in Bacillus subtilis PY79. A recombinant cry5B plasmid engineered for B. thuringiensis (29) was purified from B. thuringiensis and transformed into B. subtilis strain PY79 by standard transformation techniques. This plasmid, based upon the E. coli-B. thuringiensis shuttle vector pHT3101 (36), contained the endogenous Cry5B promoter and 3′-untranslated region driving expression of the wild-type cry5B gene (29). To generate an empty vector control strain, empty vector pHT3101 was also transformed into PY79. The presence of the cry5B gene in the PY79-Cry5B strain and its absence from both the parent PY79 strain and the control strain (PY79-vector) were confirmed by PCR. PCR detection of the plasmid in the PY79-vector strain and its absence from the parent PY79 strain were also confirmed. PY79 was able to maintain both the cry5B plasmid and pHT3101 under standard antibiotic selection with erythromycin, indicating that the origin of replication for B. thuringiensis functioned in B. subtilis, as demonstrated previously (37).

    [0142] The PY79-Cry5B and PY79-vector strains were sporulated. Robust expression of a protein of the size of Cry5B was detected by PAGE only in the PY79-Cry5B strain. Mass spectroscopy confirmed that the protein was indeed Cry5B. On the basis of quantitation relative to bovine serum albumin (BSA) standards on polyacrylamide gels, Cry5B was expressed at 10 mg/liter culture, which was ˜7.5-fold lower than the Cry5B expression level in B. thuringiensis (75 mg/liter) (29). Two other bands common to both PY79-vector and PY79-Cry5B were identified by mass spectroscopy as the 60-kDa chaperonin protein and an oligopeptide-binding protein from B. subtilis 168, the parent strain of PY79 (38). These assays confirmed that Cry5B was expressed in the PY79-Cry5B strain and that the strain was B. subtilis PY79.

    [0143] Crystal proteins expressed during sporulation of B. thuringiensis assemble into crystalline inclusions in the mother cell compartment that are often bipyramidal in shape (39). This assembling is also true of Cry5B produced in B. thuringiensis (40). Whereas no crystals were detected by SEM upon sporulation of the PY79-vector strain, many SEM-detectable small crystalline inclusions were present upon sporulation of the PY79-Cry5B strain. Some of these crystals were bipyramidal in shape; others appeared to be truncated versions of such crystals. Thus, Cry5B not only was expressed in PY79 but also assembled into crystalline inclusions.

    [0144] Cry5B made by PY79 was bioactive. To test whether or not Cry5B made by PY79 was bioactive, dose-dependent mortality assays were set up using the laboratory roundworm C. elegans in a standard 48-well format (13, 41). The Cry5B component of PY79-Cry5B spore crystal lysates was quantitated relative to BSA standards on polyacrylamide gels. Fourth-stage larvae were incubated for 6 days in wells containing PY79-Cry5B spore crystal lysates containing fixed amounts of Cry5B. Antibiotics were included to prevent infection of the roundworms by bacteria (42). Cry5B made by PY79 was found to kill C. elegans, with an LC50 of 4.3 μg/ml (95% confidence interval, 3.6 to 5.0 μg/ml) (FIG. 11). This LC50 was similar to the LC50 of Cry5B purified from B. thuringiensis (7 to 9 μg/ml) (35) under comparable conditions (25° C., 6 days). Conversely, C. elegans exposed to PY79-vector spore lysates (with a spore count equivalent to the highest dose used with PY79-Cry5B) was >99% viable (122/123 worms were alive). Thus, PY79 spore lysates were not lethal to C. elegans, and PY79 was able to produce bioactive Cry5B.

    [0145] PY79-Cry5B was therapeutic against experimental hookworm infection in hamsters. Nine hamsters were infected with the hookworm parasite A. ceylanicum. At 18 days post-inoculation, five hamsters were treated per os with a single dose of PY9-vector spore lysate, and four were treated with a single dose of PY79-Cry5B spore crystal lysate (equivalent spore counts were used in both treatment groups; the amount of Cry5B was determined relative to BSA standards on protein gels). The single dose of Cry5B used was 10 mg/kg, chosen based on published doses of clinical anthelmintics used in the same model of hookworm disease (Table 3). Feces were collected before and after treatment in order to determine worm loading and changes to parasite egg output. At 22 days post-infection, animals were sacrificed and intestinal worm burdens determined. With a single dose, hookworm burdens were reduced 93% relative to those of the control group (P=0.009) (FIG. 12A). Strong effects could also be seen in the reduction of parasite eggs excreted into feces (91% reduction) (FIG. 12B). To determine if there was an effective dose-response relationship and if significant therapy could be provided at lower doses, another experiment was carried out with three hamsters per group and Cry5B doses of 0.4, 1.4, and 4 mg/kg. Significant clearance of parasites was seen at 1.4 and 4 mg/kg Cry5B in PY79 (69% and 79% reductions, with P values of 0.023 and 0.012, respectively).

    [0146] The experiments in this Example demonstrated for the first time that Bacillus subtilis can be engineered to provide a significant therapeutic effect against an existing parasitic disease. This pilot study employed PY79, a laboratory strain of B. subtilis that has been used as a model for the delivery of viable bacterial therapies in humans and livestock and that is closely related to a food-grade B. subtilis species. PY79 was made to express and correctly present the BtCry5B protein in a manner that was bioactive against the laboratory roundworm C. elegans. A single 10-mg/kg dose (71 nmol/kg) of Cry5B administered as a Cry5B-PY79 spore crystal lysate reduced A. ceylanicum hookworm burdens in hamsters by 93%, and a dose as small as 1.4 mg/kg was able to provide significant therapy. In previously published data, purified Cry5B delivered at 10 mg/kg reduced hookworm burdens by 65% (14); the data disclosed herein suggest that delivery of Cry5B via PY79 spore crystal lysates was superior to delivery via purified protein.

    [0147] The expression of Cry5B in B. subtilis employed the endogenous BtCry5B promoter and may have been influenced at least partly by two putative sigma E elements upstream of the cry5B start codon. Sigma E is a sporulation-specific promoter that is active in B. subtilis and is also known to be involved in crystal protein production in B. thuringiensis (43, 44). The engineered strain used for the present study included antibiotic resistance genes associated with the cry5B plasmid. Given the genetic tools associated with B. subtilis (45), a Cry5B-expressing B. subtilis therapeutic product for humans is contemplated that includes the cry5B gene integrated into the genome and that lacks any antibiotic resistance genes

    [0148] The 93% elimination (P=0.0.009) of A. ceylanicum hookworm parasites from hamsters by use of a single 10-mg/kg (71 nmol/kg) dose compared favorably to the results of anthelmintics used clinically (Table 3). For example, a 10-mg/kg (49 μmol/kg) dose of levamisole resulted in a 60% reduction of A. ceylanicum burdens in hamsters, a 10-mg/kg (17 μmol/kg) dose of pyrantel resulted in an 87% reduction in A. ceylanicum burdens, a 10-mg/kg (22 μmol/kg) dose of tribendimidine resulted in a 75% reduction of A. ceylanicum burdens, and a 1.25-mg/kg (4.7 μmol/kg) dose of albendazole resulted in an 88% reduction of A. ceylanicum burdens (46, 47). In addition to high efficacy, Cry5B had a different mechanism of action from that of chemical anthelmintics; Cry5B has been shown to be a pore-forming protein that binds to invertebrate-specific glycolipids and attacks the plasma membrane of the nematode intestine (34, 35, 48-50).

    [0149] As described herein PY79-Cry5B was comparable to many current drugs in its efficacy on a mg/kg basis, and on a molar level, it appeared to be superior (e.g., the molar dose of Cry5B used in the present experiments was 66 times lower than the molar dose of albendazole mentioned above). The present results validated the B. subtilis-Cry5B approach.

    [0150] Also contemplated are increasing B. subtilis-Cry5B specific activity, e.g., by Cry5B point mutations that increase roundworm-killing activity (51) and by optimization of fermentation conditions that can also increase crystal protein specific activity (52). Given that Bacillus bacteria can be produced and stored cheaply and in large quantities (53), the present results demonstrated the feasibility of Cry5B delivery by food-grade B. subtilis for the treatment of STH diseases.

    TABLE-US-00003 TABLE 3 Comparison of efficacies of PY79-Cry5B and clinically used anthelmintics against A. ceylanicum infections in hamsters Dose % Parasite Treatment.sup.a (_mol/kg) reduction P value Reference Levamisole 49 60 0.057 47 Pyrantel 17 87 0.057 47 Tribendimidine 22 75 >0.05? 46 Albendazole 4.7 88 <0.001 47 (1.25 mg/kg) Cry5B 0.071 93 0.009 This Example .sup.aTreatments were administered at 10 mg/kg unless otherwise stated.

    REFERENCES

    [0151] 1. Bethony J, Brooker S, Albonico M, Geiger S M, Loukas A, Diemert D, Hotez P J. 2006. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet 367:1521-1532. [0152] 2. Hall A, Hewitt G, Tuffrey V, de Silva N. 2008. A review and metaanalysis of the impact of intestinal worms on child growth and nutrition. Matern. Child Nutr. 4(Suppl 1):118-236. [0153] 3. Knopp S, Steinmann P, Keiser J, Utzinger J. 2012. Nematode infections: soil-transmitted helminths and trichinella. Infect. Dis. Clin. North Am. 26:341-358. [0154] 4. Tchuem Tchuente L A. 2011. Control of soil-transmitted helminths in sub-Saharan Africa: diagnosis, drug efficacy concerns and challenges. Acta Trop. 120(Suppl 1):S4-S11. [0155] 5. Hotez P J. 2008. Forgotten people, forgotten diseases: the neglected tropical diseases and their impact on global health and development. ASM Press, Washington, D.C. [0156] 6. Keiser J, Utzinger J. 2010. The drugs we have and the drugs we need against major helminth infections. Adv. Parasitol. 73:197-230. [0157] 7. Humphries D, Mosites E, Otchere J, Twum W A, Woo L, Jones-Sanpei H, Harrison L M, Bungiro R D, Benham-Pyle B, Bimi L, Edoh D, Bosompem K, Wilson M, Cappello M. 2011. Epidemiology of hookworm infection in Kintampo North Municipality, Ghana: patterns of malaria coinfection, anemia, and albendazole treatment failure. Am. J. Trop. Med. Hyg. 84:792-800. [0158] 8. Soukhathammavong P A, Sayasone S, Phongluxa K, Xayaseng V, Utzinger J, Vounatsou P, Hatz C, Akkhavong K, Keiser J, Odermatt P. 2012. Low efficacy of single-dose albendazole and mebendazole against hookworm and effect on concomitant helminth infection in Lao PDR. PLoS Negl. Trop. Dis. 6:e1417. doi:10.1371/journal.pntd.0001417. [0159] 9. Stothard J R, Rollinson D, Imison E, Khamis I S. 2009. A spot-check of the efficacies of albendazole or levamisole, against soil-transmitted helminthiases in young Ungujan children, reveals low frequencies of cure. Ann. Trop. Med. Parasitol. 103:357-360. [0160] 10. Geary T G, Woo K, McCarthy J S, Mackenzie C D, Horton J, Prichard R K, de Silva N R, Olliaro P L, Lazdins-Helds J K, Engels D A, Bundy D A. 2010. Unresolved issues in anthelmintic pharmacology for helminthiases of humans. Int. J. Parasitol. 40:1-13. [0161] 11. Holden-Dye L, Walker R J. 2007. Anthelmintic drugs. WormBook 2007: 1-13. [0162] 12. Cappello M, Bungiro R D, Harrison L M, Bischof L J, Griffitts J S, Barrows B D, Aroian R V. 2006. A purified Bacillus thuringiensis crystal protein with therapeutic activity against the hookworm parasite Ancylostoma ceylanicum. Proc. Natl. Acad. Sci. U.S.A 103:15154-15159. [0163] 13. Hu Y, Georghiou S B, Kelleher A J, Aroian R V. 2010. Bacillus thuringiensis Cry5B protein is highly efficacious as a single-dose therapy against an intestinal roundworm infection in mice. PLoS Negl. Trop. Dis. 4:e614. doi:10.1371/journal.pntd.0000614. [0164] 14. Hu Y, Zhan B, Keegan B, Yiu Y Y, Miller M M, Jones K, Aroian R V. 2012. Mechanistic and single-dose in vivo therapeutic studies of Cry5B anthelmintic action against hookworms. PLoS Negl. Trop. Dis. 6:e1900. doi:10.1371/journal.pntd.0001900. [0165] 15. Cutting S M. 2011. Bacillus probiotics. Food Microbiol. 28:214-220. [0166] 16. Casula G, Cutting S M. 2002. Bacillus probiotics: spore germination in the gastrointestinal tract. Appl. Environ. Microbiol. 68:2344-2352. [0167] 17. Duc L H, Hong H A, Barbosa T M, Henriques A O, Cutting S M. 2004. Characterization of Bacillus probiotics available for human use. Appl. Environ. Microbiol. 70:2161-2171. [0168] 18. Hoa N T, Baccigalupi L, Huxham A, Smertenko A, Van P H, Ammendola S, Ricca E, Cutting A S. 2000. Characterization of Bacillus species used for oral bacteriotherapy and bacterioprophylaxis of gastrointestinal disorders. Appl. Environ. Microbiol. 66:5241-5247. [0169] 19. Hoa T T, Duc L H, Isticato R, Baccigalupi L, Ricca E, Van P H, Cutting S M. 2001. Fate and dissemination of Bacillus subtilis spores in a murine model. Appl. Environ. Microbiol. 67:3819-3823. [0170] 20. Hong H A, Huang J M, Khaneja R, Hiep L V, Urdaci M C, Cutting S M. 2008. The safety of Bacillus subtilis and Bacillus indicus as food probiotics. J. Appl. Microbiol. 105:510-520. [0171] 21. D'Arienzo R, Maurano F, Mazzarella G, Luongo D, Stefanile R, Ricca E, Rossi M. 2006. Bacillus subtilis spores reduce susceptibility to Citrobacter rodentium-mediated enteropathy in a mouse model. Res. Microbiol. 157: 891-897. [0172] 22. Duc L H, Hong H A, Fairweather N, Ricca E, Cutting S M. 2003. Bacterial spores as vaccine vehicles. Infect. Immun. 71:2810-2818. [0173] 23. Hoang T H, Hong H A, Clark G C, Titball R W, Cutting S M. 2008. Recombinant Bacillus subtilis expressing the Clostridium perfringens alpha toxoid is a candidate orally delivered vaccine against necrotic enteritis. Infect. Immun. 76:5257-5265. [0174] 24. La Ragione R M, Casula G, Cutting S M, Woodward M J. 2001. Bacillus subtilis spores competitively exclude Escherichia coli O78:K80 in poultry. Vet. Microbiol. 79:133-142. [0175] 25. La Ragione R M, Woodward M J. 2003. Competitive exclusion by Bacillus subtilis spores of Salmonella enterica serotype Enteritidis and Clostridium perfringens in young chickens. Vet. Microbiol. 94:245-256. [0176] 26. Permpoonpattana P, Hong H A, Phetcharaburanin J, Huang J M, Cook J, Fairweather N F, Cutting S M. 2011. Immunization with Bacillus spores expressing toxin A peptide repeats protects against infection with Clostridium difficile strains producing toxins A and B. Infect. Immun. 79: 2295-2302. [0177] 27. Song M, Hong H A, Huang J M, Colenutt C, Khang D D, Nguyen T V, Park S M, Shim B S, Song H H, Cheon I S, Jang J E, Choi J A, Choi Y K, Stadler K, Cutting S M. 2012. Killed Bacillus subtilis spores as a mucosal adjuvant for an H5N1 vaccine. Vaccine 30:3266-3277. [0178] 28. Conlan J V, Khamlome B, Vongxay K, Elliot A, Pallant L, Sripa B, Blacksell S D, Fenwick S, Thompson R C. 2012. Soil-transmitted helminthiasis in Laos: a community-wide cross-sectional study of humans and dogs in a mass drug administration environment. Am. J. Trop. Med. Hyg. 86:624-634. [0179] 29. Marroquin L D, Elyassnia D, Griffitts J S, Feitelson J S, Aroian R V. 2000. Bacillus thuringiensis (Bt) toxin susceptibility and isolation of resistance mutants in the nematode Caenorhabditis elegans. Genetics 155:1693-1699. [0180] 30. Dubnau D, Davidoff-Abelson R. 1971. Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor-recipient complex. J. Mol. Biol. 56:209-221. [0181] 31. Sierro N, Makita Y, de Hoon M, Nakai K. 2008. DBTBS: a database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic Acids Res. 36:D93-D96. [0182] 32. Shevchenko A, Wilm M, Vorm O, Mann M. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68:850-858. [0183] 33. National Research Council. 1996. Guide for the care and use of laboratory animals. National Academies Press, Washington, D C. [0184] 34. Hu Y, Xiao S H, Aroian R V. 2009. The new anthelmintic tribendimidine is an L-type (levamisole and pyrantel) nicotinic acetylcholine receptor agonist. PLoS Negl. Trop. Dis. 3:e499. doi:10.1371/journal.pntd.0000499. [0185] 35. Hu Y, Platzer E G, Bellier A, Aroian R V. 2010. Discovery of a highly synergistic anthelmintic combination that shows mutual hypersusceptibility. Proc. Natl. Acad. Sci. U.S.A 107:5955-5960. [0186] 36. Lereclus D, Arantes O, Chaufaux J, Lecadet M. 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 51:211-217. [0187] 37. Yang Y, Qi Y, Huang Y. 1996. Cloning and expression of full-length delta-endotoxin crylA(c) gene in three kinds of prokaryotic systems using shuttle vector pHT3101. Wei Sheng Wu Xue Bao 36:173-180. [0188] 38. Youngman P, Perkins J B, Losick R. 1984. Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposonborne erm gene. Plasmid 12:1-9. [0189] 39. Cannon R J C. 1996. Bacillus thuringiensis use in agriculture: a molecular perspective. Biol. Rep. 71:561-636. [0190] 40. Hu Y, Aroian R V. 2012. Promise of Bacillus thuringiensis crystal proteins as anthelmintics, p 267-281. In Caffrey C R (ed), Parasitic helminths: targets, screens, drugs, and vaccines. Wiley-VCH Verlag Gmh & Co, KGaA, Weinheim, Germany. [0191] 41. Bischof L J, Huffman D L, Aroian R V. 2006. Assays for toxicity studies in C. elegans with Bt crystal proteins. Methods Mol. Biol. 351:139-154. [0192] 42. Kho M F, Bellier A, Balasubramani V, Hu Y, Hsu W, Nielsen-LeRoux C, McGillivray S M, Nizet V, Aroian R V. 2011. The pore-forming protein Cry5B elicits the pathogenicity of Bacillus sp. against Caenorhabditis elegans. PLoS One 6:e29122. doi:10.1371/journal.pone.0029122. [0193] 43. Baum J A, Malvar T. 1995. Regulation of insecticidal crystal protein production in Bacillus thuringiensis. Mol. Microbiol. 18:1-12. [0194] 44. Buasri W, Panbangred W. 2012. Large crystal toxin formation in chromosomally engineered Bacillus thuringiensis subsp. aizawai due to sigmaE accumulation. Appl. Environ. Microbiol. 78:1682-1691. [0195] 45. Brans A, Filee P, Chevigne A, Claessens A, Joris B. 2004. New integrative method to generate Bacillus subtilis recombinant strains free of selection markers. Appl. Environ. Microbiol. 70:7241-7250. [0196] 46. Tritten L, Nwosu U, Vargas M, Keiser J. 2012. In vitro and in vivo efficacy of tribendimidine and its metabolites alone and in combination against the hookworms Heligmosomoides bakeri and Ancylostoma ceylanicum. Acta Trop. 122:101-107. [0197] 47. Tritten L, Silbereisen A, Keiser J. 2011. In vitro and in vivo efficacy of monepantel (AAD 1566) against laboratory models of human intestinal nematode infections. PLoS Negl. Trop. Dis. 5:e1457. doi:10.1371/journal.pntd.0001457. [0198] 48. Griffitts J S, Aroian R V. 2005. Many roads to resistance: how invertebrates adapt to Bt toxins. Bioessays 27:614-624. [0199] 49. Griffitts J S, Haslam S M, Yang T, Garczynski S F, Mulloy B, Morris H, Cremer P S, Dell A, Adang M J, Aroian R V. 2005. Glycolipids as receptors for Bacillus thuringiensis crystal toxin. Science 307:922-925. [0200] 50. Los F C, Kao C Y, Smitham J, McDonald K L, Ha C, Peixoto C A, Aroian R V. 2011. RAB-5- and RAB-11-dependent vesicle-trafficking pathways are required for plasma membrane repair after attack by bacterial poreforming toxin. Cell Host Microbe 9:147-157. [0201] 51. Wang F, Liu Y, Zhang F, Chai L, Ruan L, Peng D, Sun M. 2012. Improvement of crystal solubility and increasing toxicity against Caenorhabditis elegans by asparagine substitution in block 3 of Bacillus thuringiensis crystal protein Cry5Ba. Appl. Environ. Microbiol. 78:7197-7204. [0202] 52. el-Bendary M A. 2006. Bacillus thuringiensis and Bacillus sphaericus biopesticides production. J. Basic Microbiol. 46:158-170. [0203] 53. Schallmey M, Singh A, Ward O P. 2004. Developments in the use of Bacillus species for industrial production. Can. J. Microbiol. 50:1-17.

    Example 15

    Bioactivity of Compositions Comprising Cry5b and Probiotic Bacteria

    [0204] This example describes additional data that were obtained using the above-described bioassays for anthelmintic activity.

    [0205] FIG. 13 shows results from an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms as described by Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal.pntd.0001900). The four groups (in black, n=7 per group) shown are the intestinal worm burdens from the groups of infected hamsters treated with purified full-length B. thuringiensis Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see FIG. 2) at a single dose of 1 mg (solid circles, 10 mg/kg), 3 mg (solid upright triangles, 30 mg/kg), or 10 mg (solid inverted triangles,100 mg/kg) (715 nmoles/kg), or with placebo (solid squares, ddH.sub.2O), respectively. The treatments were conducted on day 16 P.I. and intestinal worm burdens assessed on day 21 P.I. The worm burdens in each hamster are indicated with a separate symbol. Long horizontal bars represent mean worm burdens; smaller bars indicate SEM (standard error of the mean).

    [0206] FIG. 14 shows dose-response results for indicated dosages of unfractionated Cry5B-containing spore-crystal lysates (SCL) in the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms. The assay was performed according to Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal.pntd.0001900) except instead of purified Cry5B protein the animals received the indicated dosages, via gavage, of Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase. The amounts of Cry5B gavaged were determined by taking known volumes of spore crystal lysates, resolving full length Cry5B protein by SDS PAGE, and quantitating the amount of protein in the Cry5B band relative to known amounts of bovine serum albumin (BSA) standards on the gel.

    [0207] FIG. 15 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal. pntd.0001900) following treatment with two different dosages of Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis natto cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase. B. subtilis natto was transformed with the same Cry5B expressing plasmid described in Example 14 (Hu et al. Appl. Environ. Microbiol. 2013, 79(18):5527). Because B. subtilis natto is not naturally competent, B. subtilis natto cells were made competent by artificially introducing the ComK competency plasmid into the B. subtilis natto strain via protoplast transformation (Ashikaga et al., J Bacteriol. 2000; 182(9):2411-5; Romero, D., et al J Microbiol Meth. 2006; 66(3):556-9). The resultant strain was able to take up any DNA and the ComK plasmid, being unstable, was readily lost by growing under non-selective pressure).

    [0208] FIG. 16 shows data obtained in vitro using the C. elegans mortality assay described in FIG. 11 to evaluate the effects on C. elegans of purified Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see FIG. 2) when combined in a mixture either with sporulated B. thuringiensis HD1 or with sporulated B. subtilis PY79. For each data point, the number of spores (HD1 or PY79) was held constant and the quantity of Cry5B was titrated (x-axis).

    [0209] FIG. 17 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal. pntd.0001900) following treatment (5 mg/kg) by gavage on day 18 P.I. with either B. thuringiensis strain HD1 spore lysates transformed with empty vector (“control”, spore lysates from the acrystaliferous mutant B. thuringiensis strain HD1, which does not produce any Cry proteins) or spore crystal lysates from B. thuringiensis strain HD1 that has been engineered to express Cry14A (for sequence see FIG. 4) using a plasmid encoding Cry14A under the control of the operably linked Cry3A promoter. Hookworm burdens were assessed on day 20 post-infection (P.I.).

    Example 16

    Gene Replacement and Generation of a Bacillus Subtilis Auxotroph

    [0210] cry5B gene was integrated into the B. subtilis genome by a strategy that simultaneously deleted the chromosomal thyA gene, which encodes thymidylate synthetase. A cry5B cassette, flanked by the upstream and downstream regions of B. subtilis thyA, was assembled in vitro by standard PCR techniques. B. subtilis natto was transformed with this construct in a single step. Transformants simultaneously acquired two properties: auxotrophy for thymine nucleotides and the production of Cry5B protein. Because thymine auxotrophs in B. subtilis are known to be naturally resistant to trimethoprim and other antifolate compounds, selection for growth in the presence of trimethoprim plus thymine selected for the desired integration event without the introduction of an antibiotic resistance marker. The construct contained no foreign DNA at all except for the cry5B gene itself. The auxotroph permitted easy replication under laboratory conditions but the strain was environmentally dead and unable to replicate in the wild (e.g., following defecation by a human).

    [0211] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

    [0212] The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.

    [0213] These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.