BACTERIAL STRAINS AND METHOD FOR PRODUCING OLIGOSACCHARIDES
20230183766 · 2023-06-15
Inventors
- Julien Durand (Toulouse, FR)
- Fabien Letisse (Toulouse, FR)
- Pietro Tedesco (Toulouse, FR)
- Gabrielle Veronese (Toulouse, FR)
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12N9/1288
CHEMISTRY; METALLURGY
C12P19/00
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/2471
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a strain deposited with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5499. The present invention also relates to the in vitro use of strains for producing oligosaccharides and/or in a process for producing oligosaccharides.
The present invention finds an application, in particular in the bioproduction field, for example the production of compounds, for example of bio-compounds.
Claims
1. An Escherichia coli strain whose recA1, gyrA96, thi-1, glnV44 relA1 hsdR17, endA1, lacZ, nanKETA, lacA, melA, wcaJ, mdoH, ptsG, manX, manY, and pfkA are inactivated.
2. The strain according to claim 1, deposited with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5499.
3. The strain according to claim 1 further comprising a Δmaa and a ΔmanA mutation.
4. The strain according to claim 3, deposited with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5681.
5. The strain according to claim 3, in which a promoter of the GalP gene is an HIF promoter.
6. The strain according to claim 1 further comprising an expression vector of a glycoside-phosphorylase selected from a β-glycoside- or a α-glycoside-phosphorylases.
7. The strain according to claim 6, in which the β-glycoside—or the α-glycoside-phosphorylase is selected from the group comprising α-1, 3-glucopyranosyl-L-rhamnose-phosphorylases, α-1, 2-glucosyl-glycerol-phosphorylases, trehalose phosphorylases, laminaribiose-phosphorylases, D-galactosyl-β-1, 4-L-rhamnose phosphorylases, β-1, 4-mannosyl-glucose phosphorylases, β-1, 2-oligomannan phosphorylases-1, 2-mannobiose phosphorylases, β-1, 4-mannopyranosyl-[N-glycan]-phosphorylases/β-1, 4-mannopyranosyl-chitobiose-phosphorylases, β-1, 4-mannooligosaccharide phosphorylases, β-1, 3-mannooligosaccharide phosphorylases, β-1, 3-mannosyl-glucose phosphorylases, and β-1, 4-mannosyl-glucuronate phosphorylases.
8. The strain of claim 1 for in vitro use for producing oligosaccharides or in a process for producing oligosaccharides.
9. An in vitro or in cellulo method for producing oligosaccharides comprising the steps of: a) transforming the strain according to claim 1 with an expression vector of an enzyme, b) culturing of the transformed strain obtained in step a) or culturing a strain according to claim 1 in a culture medium, and c) recovering of the produced oligosaccharides.
10. The method according to claim 9, wherein the recovering of the produced oligosaccharides is performed in the culture medium.
11. The method of claim 9, wherein the method at step a) comprises step a′) of transforming said strain with an expression vector of at least one transport protein or permease.
12. The method of claim 11, wherein the culture medium comprises at least one non-phosphorylated carbohydrate selected from the group comprising N-acetyl-(xD-glucosamine, galactose, glucose, lactose, glycerol, mannose, N-acetyl-glucosamine β-1,4-N-acetyl-glucosamine, and fucose.
13. The method according to claim 9, wherein the enzyme is selected from a β-glycoside- or an α-glycoside-phosphorylase.
14. The method according to claim 13, wherein the enzyme is selected from α-1, 3-glucopyranosyl-L-rhamnose-phosphorylases, α-1,2-glucosyl-glycerol-phosphorylases, trehalose-phosphorylases, laminaribiose-phosphorylases, D-galactosyl-β-1,4-L-rhamnose phosphorylases, β-1,4-mannosyl-glucose-phosphorylases, β-1,2-oligomannan phosphorylases, β-1, 2-mannobiose-phosphorylases, β-1,4-mannopyranosyl-[N-glycan]-phosphorylases, β-1, 4-mannopyranosyl-chitobiose-phosphorylases, β-1, 4-mannooligosaccharide-phosphorylases, β-1, 3-mannooligosaccharide phosphorylases, β-1,3-mannosyl-glucose phosphorylases, and β-1,4-mannosyl-glucuronate phosphorylases.
15. The method according to claim 9, wherein the medium is chosen from a rich medium, LB (Lysogeny broth), Superbroth, TB (Terrific Broth), YPD (Yeast Extract-Peptone Dextrose) medium, a minimum medium, M9 medium or M63 medium supplemented with a carbon source, a selective medium, and YNB medium (Yeast Nitrogen Base)
16. The strain according to claim 3 further comprising an expression vector of a glycoside-phosphorylase selected from β-glycoside- or α-glycoside-phosphorylases.
17. The strain according to claim 16, in which the β-glycoside- or α-glycoside-phosphorylase is chosen from α-1, 3-glucopyranosyl-L-rhamnose-phosphorylases, α-1, 2-glucosyl-glycerol-phosphorylases, trehalose phosphorylases, laminaribiose-phosphorylases, D-galactosyl-β-1, 4-L-rhamnose phosphorylases, β-1, 4-mannosyl-glucose phosphorylases, -1, 2-oligomannan phosphorylases, β-1, 2-mannobiose phosphorylases, β-1, 4-mannopyranosyl-[N-glycan]-phosphorylases, β-1, 4-mannopyranosyl-chitobiose-phosphorylases, β-1, 4-mannooligosaccharide phosphorylases, β-1, 3-mannooligosaccharide phosphorylases, β-1, 3-mannosyl-glucose phosphorylases, and β-1, 4-mannosyl-glucuronate phosphorylases.
18. A method for in vitro or in cellulo production of oligosaccharides comprising the steps of: a) transforming the strain according to claim 3 with a vector for expressing an enzyme, b) culturing of the transformed strain obtained in step a) or culturing a strain according to claim 3 in a culture medium, and c) recovering the oligosaccharides produced.
19. The method according to claim 18, wherein the enzyme is selected from a β-glycoside- or an α-glycoside-phosphorylases.
20. The method of claim 19, wherein the enzyme is selected from α-1,3-glucopyranosyl-L-rhamnose-phosphorylases, α-1,2-glucosyl-glycerol-phosphorylases, trehalose phosphorylases, laminaribiose-phosphorylases, D-galactosyl-β-1,4-L-rhamnose phosphorylases, β-1,4-mannosyl-glucose phosphorylases, -1,2-oligomannan phosphorylases, β-1,2-mannobiose phosphorylases, β-1,4-mannopyranosyl-[N-glycan]-phosphorylases, β-1,4-mannopyranosyl-chitobiose-phosphorylases, β-1,4-mannooligosaccharide phosphorylases, β-1,3-mannooligosaccharide phosphorylases, β-1,3-mannosyl-glucose phosphorylases, and β-1,4-mannosyl-glucuronate phosphorylases.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
EXAMPLES
Example 1: Manufacture and Characterization of the Strain Filed with the CNCM Under Number CNCM I-5499
[0192] In the example below, the strain filed with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5499 is also designated PFKA strain.
1. Preparation and Production of the PFKA Strain (CNCM N° I-5499)/Phenotypic Validation
[0193] The strain filed with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5499 was obtained by genetic modification of the Escherichia coli MDO strain.
[0194] The E. coli MDO strain, was obtained and characterized in the laboratoire Chimie et Biotechnologie des Oligosaccharides (CBO) (CERMAV-CNRS CS40700, 38041 Grenoble cedex 9, France) from the Escherichia coli ZLKA strain as described in Fierfort and Samain “Genetic engineering of Escherichia coli for the economical production of sialylated oligosaccharides” J Biotechnol. 2008 Apr. 30; 134β-4):261-5. [3].
[0195] The E. coli ZLKA strain derives from the E. coli K-12 DH1 (endA1 recA1 gyrA96 thi-1 gLnV44 relA1 hsdR17) strain whose lacZ, nanKETA and lacA genes have been inactivated as described in Fierfort and Samain “Genetic engineering of Escherichia coli for the economical production of sialylated oligosaccharides” J Biotechnol. 2008 Apr. 30; 134β-4):261-5 [3].
[0196] The E. coli MDO strain is characterized by the inactivation of the melA, wcaJ and mdoH genes as well as the insertion of the Plac promoter upstream of the gmd gene encoding a GDP-mannose 4,6-dehydratase. As a result, the phosphomannomutase manB gene, which is located downstream of the gmd gene, is inducible by isopropyl β-D-1-thiogalactopyranoside (IPTG). The complete genotype of the MDO strain is as follows: endA1 recA1 gyrA96 thi-1 gLnV44 relA1 hsdR17 lacZ-wcaF, Plac nanKETA lacA melA wcaJ mdoH.
[0197] In the present example, kanamycin and ampicillin were used at a final concentration of 50 μg/mL to ensure remaining of the pWKS-GalP and pBAD-Teth-1788 or pBAD-Uhgb_MP plasmids respectively in the cells. The final concentration of IPTG used for the induction of galP and manB was 60 μM. The final concentration of L-arabinose for the induction of the gene encoding the glycoside-phosphorylase (Teth-1788, UhgbMP or δ-1,3-mannooligosaccharide phosphorylase) was 10 mM. The IPTG was added to the culture medium at the time of inoculation and the L-arabinose is added to the culture at the start of the exponential growth phase (DO.sub.600≈0.4).
1.1. Insertion of the Plac Promoter Upstream of the GMD Gene
[0198] A DNA fragment of 302 base pairs (bp) including the sequence of the Plac expression promoter was integrated into the chromosome between the stop codon of the wcaF gene and the start codon of the gmd gene. Two DNA sequences, a 0.88 kb segment ending 5 bp downstream of the stop codon of the wcaF gene and a 0.96 kb segment starting 13 bp upstream from the start codon of the gmd gene were amplified by PCR from the genomic DNA sequence of E. Coli K-12, used as a template. The PCR cycle was 1 cycle of 30 seconds (s) at 98° C., 35 cycles of 15 s at 98° C., 15 s at 69° C. and 30 s at 72° C., 1 cycle of 5 minutes at 72° C. The Polymerase used was Phusion, (NEB). The PL1 (5′ CTCGAGAGGCGATATTTTTCCCTGTATCC SEQ ID NO 1) and PL2 (5′GGTTTGCGTATTATTCAGTTTCAACGCGTTCG SEQ ID NO 2) primers were used to amplify the upstream fragment and the PL5 (5′CTGGAGCTCAGAGGAATAATACATGTCAAAAGTCG SEQ ID NO 3) and PL6 (5′ CTCGAGACAACAGCGATAATCACATCACC SEQ ID NO 4) primers were used to amplify the downstream fragment. A 0.3 kb DNA segment including the sequence of the Plac promoter was amplified by PCR using the pBluescript II KS plasmid (Addegen) as template and the following primers: PL3 (5′ GTTGAAACTGAATAATACGCAAACCGCCTCTC SEQ ID NO 5) and PL4 (5′ ATGTATTATTCCTCTGAGCTCCAGCTTTTGTTCC SEQ ID NO 6). The PL2 and PL3 primers have 5′ flanking sequences which make them complementary to each other. The PL4 and PL5 primers were designed in a similar manner. The three amplified DNA fragments were spliced by overlapping using the PL1 and PL6 primers. The thus obtained 2.1 kb DNA fragment was digested with the XhoI restriction enzyme and then cloned in the SalI restriction site of the pKO3 suicide vector. The chromosomal insertion of the Plac promoter was then carried out according to the protocol described in Link, A. J., Phillips, D., Church, G. M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228-6237. [7]. The pKO3 plasmid was provided by the Church laboratory (Harvard University, USA). Positive clones were screened by PCR (The PCR cycle was 1 cycle of 3 minutes at 95° C., 35 cycles of 30 s at 95° C., 30 s at 53° C. and 1 minute at 68° C., 1 cycle 5 minutes at 68° C. The polymerase used was DNA Taq polymerase (NEB) for the presence of an amplified fragment of 1.396 kb DNA using the PL3 and PL7 primers 5′TCGAGGTCATTAGCCACCA SEQ ID NO 7).
1.2. Generation of Deletion Mutants
[0199] The selected ptsG, manXYZ and pfkA genes were inactivated using the pKO3 protocol as described in Link, A. J., Phillips, D., Church, G. M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228-6237, 1997 [7]. To obtain the deletion mutant of the ptsG gene, a 351 bp DNA segment located between nucleotides 568 and 919 of ptsG was deleted and replaced by the 5′AGC sequence as follows: two DNA segments flanking the sequence to be deleted were amplified by PCR. The PCR cycle was 1 cycle of 30 s at 98° C., 35 cycles of 15 s at 98° C., 15 s at 70° C. and 30 s at 72° C., 1 cycle of 5 minutes at 72° C. The polymerase used was Phusion (NEB) using the genomic DNA of the E. coli K-12 strain as a template. The 900 bp upstream fragment was amplified with the (5′CTAGGATCCGCCGAAAATTGGGCGGTGAATAAC SEQ ID NO 8) and (5′GTAAAGCTTCTGGTAAGCAGCCCAGAGAAG SEQ ID NO 9) primers and the 958 bp downstream fragment was amplified with the (5′CTCAAGCTTGCGCCGATCCTGTACATCATCC SEQ ID NO 10) and (5′CGTGTCGACCGTTAATCCTAATCTGCCACGCACC SEQ ID NO 11) primers. The two amplified fragments were ligated at their terminal HindIII restriction site and cloned together at the BamHI and SalI restriction sites of the pKO3 suicide vector. The deletion was then carried out according to the protocol described in Link, A. J., Phillips, D., Church, G. M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228-6237 [7].
[0200] In the genetic background/strain described above, a 1.219 kb fragment located between nucleotides 332 of manX and 522 of manY was deleted to obtain the deletion mutant of the manXYZ genes, as follows: two DNA fragments flanking the sequence to be deleted were amplified by PCR using the genomic DNA of the E. coli K-12 strain as a template. The 915 bp upstream fragment was amplified with the (5′ACTCGAGAATGGCGATGAAGAGAG SEQ ID NO 12) and (5′CCAGTGCCACCAGTTCATC SEQ ID NO 13) primers and the 902 bp downstream fragment was amplified with the (5′CAAGCTTCGATTCCGGAAGTGGTGAC SEQ ID NO 14) and (5′AGGATCCATGCCCCCATGACAAACAG SEQ ID NO 15) primers. The two amplified fragments were ligated at their terminal HindIII restriction site and cloned together at the BamHI and Sal restriction sites of the pKO3 suicide vector. The deletion was then carried out according to the protocol described in Link, A. J., Phillips, D., Church, G. M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228-6237 [7]. The thus obtained strain was named “MGX”.
[0201] To obtain the deletion mutant of the pfkA gene in the genetic background of the MGX strain, a 396 bp DNA segment located between nucleotides 146 and 542 of the pfkA gene was deleted and replaced by the (5′AAGCTT) sequence as follows: two DNA segments flanking the sequence to be deleted were amplified by PCR using the genomic DNA of E. coli K-12 as template. The 890 bp upstream fragment was amplified with the (5′GGATCCAGGCGTCGGGGATATCGTG SEQ ID NO 16) and (5′AAGCTTCGGTCTTCATACAGACCCAGATAGC SEQ ID NO 17) primers and the 931 bp downstream fragment was amplified with the (5′AAGCTTGGCCATTGCCGGGGGCTGTG SEQ ID NO 18) and (5′CTCGAGCCACCGTGTGACTGACGAATC SEQ ID NO 19) primers. The two amplified fragments were ligated at their terminal HindIII restriction site and cloned at the BamHI and Sal restriction sites of the pKO3 suicide vector. The deletion was then carried out according to the protocol described in Link, A. J., Phillips, D., Church, G. M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228-6237 [7]. The thus obtained strain is named “PFKA”.
1.3. Cloning the Galp Gene on a Plasmid (Primers and Plasmid Sequence)
[0202] A 1.471 kb DNA fragment containing the sequence of the galP gene was amplified by PCR. The PCR cycle was 1 cycle of 30 s at 98° C., 35 cycles of 15 s at 98° C., 15 s at 68° C. and 30 s at 72° C., 1 cycle of 5 minutes at 72° C. The polymerase used was Phusion (NEB) using the genomic DNA of the E. coli K-12 strain as template with the following primers: (5′TTGTCGACTTAAGGAGGGCATCATGCCTGAC SEQ ID NO 20) and (5′GTTCTAGATGACTGCAAGAGGTGGCTTCC SEQ ID NO 21). The amplified fragment was then cloned at the Sal and Xbal restriction sites of the pWKS130 expression vector as described in Rong Fu Wang, Kushner, S. R., 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100, 195-199 [10] to form the pWKS-GalP plasmid. The resulting plasmid sequence is represented in
[0203] Table 7 below groups together the different strains and their genotype.
TABLE-US-00008 TABLE 7 GENOTYPE OF THE GENERATED MUTANTS Chassis strain Genotype MDO endA1 recA1 gyrA96 thi-1 glnV44 relA1 hsdR17 lacZ- wcaF::Plac nanKETA lacA melA wcaj mdoH MGX1 MDO + ptsG manXYZ pKWS-galP PFKAl MDO + ptsG manXYZ pfkA pKWS-galP
1.4. Genetic Validation of the Deletion Mutant of the Genes Encoding the PTS Transporters and the PFKA Gene
[0204] A verification of the effectiveness of the deletions of the targeted genes was performed via PCR controls on the MDO, MGX and PFKA strains.
Pts Transport System Gene Deletion Mutants
[0205] Mutants in the PTS transport system were constructed by deleting a 350 bp fragment of the ptsG gene and a 1200 bp fragment of the manXYZ operon as described above.
[0206] The PCRs were carried out using genomic DNA from each strain as template using the following primers for checking the ptsG gene fragment deletion,
TABLE-US-00009 ptsG_FW: (5′CTTCTCTCAGTGGGCTGCTTACCAG 3′ SEQ ID NO 23), ptsG_RV: (5′CCGTTAATCCTAATCTGCCACGCACC 3′ SEQ ID NO 24).
[0207] The PCR cycle was 1 cycle of 3 minutes at 95° C., 35 cycles of 30 s at 95° C., 30 s at 55° C. and 1 minute at 68° C., 1 cycle of 5 minutes at 68° C. The Polymerase used was the DNA Taq polymerase (NEB). The expected size of the amplified fragments is 1300 bp for the wild-type (WT) strain and 950 bp for the MGX and PFKA strains if the genetic constructions are correct and comprise the deletion.
[0208] The following primers were used for checking the manXYZ operon fragment deletion:
TABLE-US-00010 manXYZ_FW (SEQ ID NO 25) 5′ TGTTAGGCGAGCAGGAAAACGTCG 3′ manXYZ_RV (SEQ ID NO 26) 5′ ACCAATCACACCCAGAGCAACCAG 3′.
[0209] In this case, the expected size of the amplified fragments is 1600 bp for the wild-type (WT) strain and 450 bp for the MGX and PFKA strains if the genetic constructions are correct and comprise the deletion.
[0210] The PCR control is carried out by migration of the amplified fragment in a 1% agarose gel in a MUPID-ONE electrophoresis tank (Eurogentec, Liege, Belgium). 5 μL of PCR product are homogenized with 1 μL of 6×″ loading buffer (NEB, Ipswich, Mass.) then deposited on a gel for migration in a 1×TAE buffer (Sigma, Seelze, Germany). 5 μL of 1 kB size marker (NEB) are also deposited in another well. The migration is performed at 100 V for 30 minutes. The gel is then incubated for 10 minutes in a solution containing 0.01% of ethidium bromide (Euromedex, Souffelweyersheim, France). The detection of the amplified fragments is performed via Gel DOC EZ (Biorad, Berkeley, Calif.) according to the manufacturer's instructions.
[0211]
[0212] As represented and demonstrated in
PFKA Gene Deletion Mutants
[0213] The pfkA gene deletion mutant was constructed by deleting a 400 bp fragment of the pfkA gene as described above. The PCRs were carried out using genomic DNA from each strain as template using the following primers for checking the pfkA gene fragment deletion,
TABLE-US-00011 pfkA_FW: (SEQ ID NO 27) 5′ CATTTTGCATTCCAAAGTTCAGAGG 3′, pfkA_RV: (SEQ ID NO 28) 5′ TCATCGGTTTCAGGGTAAAGGAATCT 3′
[0214] The PCR cycle was 1 cycle of 3 minutes at 95° C., 35 cycles of 30 s at 95° C., 30 s at 55° C. and 1 s at 68° C., 1 cycle of 5 minutes at 68° C. The polymerase used was the DNA Taq polymerase (NEB). The expected size of the amplified fragments is 1000 bp for the MDO and MGX strains and 600 bp for the PFKA strain if the genetic constructions are correct and comprise the deletion.
[0215] The PCR control is carried out by migration of the ADN amplified fragment in a 1% agarose gel in a MUPID-ONE electrophoresis tank (Eurogentec, Liege, Belgium). 5 μL of PCR product are homogenized with 1 μL of 6×″ loading buffer (NEB, Ipswich, Mass.) then deposited on a gel for migration in a 1×TAE buffer (Sigma, Seelze, Germany). 5 μL of 1 kB size marker (NEB) are also deposited in another well. The migration is performed at 100 V for 30 minutes. The gel is then incubated for 10 minutes in a solution containing 0.01% of ethidium bromide (Euromedex, Souffelweyersheim, France). The detection of the amplified DNA fragments is performed via Gel DOC EZ (Biorad, Berkeley, Calif.) according to the manufacturer's instructions.
[0216]
[0217] As represented and demonstrated in
1.5. Phenotypic Validation of the Deletion Mutant of Genes Encoding Pts Transporters and Overexpressing the Galp Gene
[0218] It is known that the deletion of the ptsG and manXYZ genes decreases the capacity of glucose transport in the cell of E. Coli. (Quanfeng Liang, 1 Fengyu Zhang, 1 Yikui Li, 1 Xu Zhang, 1 Jiaojiao Li, 1 Peng Yang, 1 and Qingsheng Qia, 1 Comparison of individual component deletions in a glucose-specific phosphotransferase system revealed their different applications Sci Rep. 2015; 5: 13200. Published online 2015 Aug. 19. [28], Sonja Steinsiek and Katja Bettenbrock Glucose Transport in Escherichia coli Mutant Strains with Defects in Sugar Transport Systems, J Bacteriol. 2012 November; 194(21): 5897-5908. [29]). To check that the deletion mutants of the genes encoding proteins of the transport systems known as “PTS” (PhosphoTransferase System)—strain named MGX—has the expected phenotype, the MDO and MGX strains were cultured in a minimum M9 medium (minimum M9 medium—M9 salts: Na2HPO.sub.4 12H.sub.2O 17.4 g/L, KH.sub.2PO.sub.4 3.02 g/L, NaCl 0.51 g/L, NH.sub.4Cl 2.04 g/L. Trace metals and salts: Na2EDTA 2 H.sub.2O 15 mg/L, ZnSO4 7 H.sub.2O 4.5 mg/L, CoCl.sub.2 6H.sub.2O 0.3 mg/L, MnCl2 4H.sub.2O 1 mg/L, H.sub.3BO.sub.3 1 mg/L, Na2MoO.sub.4 2 H.sub.2O 0.4 mg/L, FeSO4 7 H.sub.2O 3 mg/L, CuSO4 5 H.sub.2O 0.3 mg/L. MgSO.sub.4 0.5 g/L CaCl.sub.2) 4.38 mg/L, Thiamine hypochloride 0.1 g/L) using glucose as unique carbon source. In addition, to check that the overexpression of the galP gene allows to restore all or part of the glucose transport capacity and therefore the growth rate, the pWKS-GalP plasmid was transformed in the MGX strain. The resulting strain selected on LB+Kanamycin medium was named MGX1 (see above). This MGX1 strain was also cultured in the M9 medium with glucose.
[0219] One hundred microliters of culture overnight (10 to 12 hours of culture in LB medium (Tryptone 10 g/L, Yeast extract 5 g/L, NaCl, 10 g/L) of the E. coli MDO, MGX and MGX1 strains were transferred into 250 mL baffled Erlenmeyer flasks containing 50 mL of minimum M9 medium supplemented with D-glucose (3 g/L) as unique carbon source. The thus inoculated Erlenmeyer flasks were incubated for 16 h at 37° C. with an orbital stirring of 220 revolutions per minute. The cells were then collected by centrifugation (Sigma, Seelze, Germany) for 10 min at 2 000 g at room temperature, i.e. 25° C., washed with sterile M9 medium and used to inoculate the 250 ml baffled Erlenmeyer flasks containing 50 mL of M9 medium supplemented with D-glucose (3 g/L) at OD.sub.600 nm˜0,1. To trigger the expression of the galP gene carried by the pWKS-GalP plasmid, IPTG was added to the MGX1 strain culture medium at a final concentration of 60 μM. The cultures of the strains were carried out at 37° C. with an orbital stirring of 220 revolutions per minute (220 revolutions per minute). The growth was followed by measuring turbidimetry at an optical density of 600 nm using a Genesys 6 spectrophotometer (Thermo, USA). The results are shown in
[0220] As represented in
1.6. Phenotypic Validation of the PTS-PFKA Deletion Mutant
A. GROWTH CAPACITY
[0221] The growth capacity of the MDO, MGX, MGX1, PFKA1 strains was determined by independent culture of said strains, cultured in the M9 medium supplemented with glucose.
[0222] One hundred microliters of culture overnight (10 to 16 hours of culture in LB medium (Tryptone 10 g/L, Yeast extract 5 g/L, NaCl, 10 g/L) of the E. coli MDO, MGX and MGX1, PFKA1 strains were transferred into 250 mL baffled Erlenmeyer flasks containing 50 mL of M9 medium supplemented with D-glucose (3 g/L) as unique carbon source. The Erlenmeyer thus inoculated flasks were incubated for 16 h at 37° C. with an orbital stirring of 220 revolutions per minute (220 rpm). The cells were then collected by centrifugation (Sigma, Seelze, Germany) for 10 min at 2 000 g at room temperature, i.e. 25° C., washed with sterile M9 medium and used to inoculate the 250 ml baffled Erlenmeyer flasks containing 50 mL of M9 medium supplemented with D-glucose (3 g/L) at OD600 nm ˜0.1. To trigger the expression of the galP gene carried by the pWKS-GalP plasmid, IPTG was added to the culture medium of the MGX1 and PFKA1 strains at a final concentration of 60 μM. The cultures of the strains were carried out at 37° C. with an orbital stirring of 220 revolutions per minute (220 rpm). The growth was followed by measuring turbidimetry at an optical density of 600 nm using a Genesys 6 spectrophotometer (Thermo, USA).
[0223] The growth capacity of the strains was determined by measuring the growth rate as described in Growth Rates Made Easy Barry G. Hall, Hande Acar, Anna Nandipati, Miriam Barlow Author Notes Molecular Biology and Evolution, Volume 31, Issue 1, January 2014, Pages 232-238, https://doi.org/10.1093/molbev/mst187 28 Oct. 2013 of the different strains.
The obtained results are represented in Table 8 below.
TABLE-US-00012 TABLE 8 GROWTH RATE OF THE DIFFERENT STRAINS CULTURED IN GLUCOSE M9 MEDIUM (3 G/L) Chassis strain Growth rate in glucose M9 medium (h.sup.−1) MDO 0.45 MGX 0.18 MGX1 0.32 PFKA1 0.15
[0224] As indicated above, the pfkA gene, encoding the phosphofructokinase, was deleted from the genome of the E. coli MGX strain, generating the E. coli PFKA strain (see above). The obtained results clearly show that the absence of pfkA caused a decrease in the growth rate in M9 medium with glucose (3 g/L), and this strain is no longer capable of growing in M9 medium supplemented with glucose (data not shown). The introduction of the GalP gene in this genetic background (E. coli PFKA strain) made it possible to obtain the designated E. coli PFKA1 strain. The measured growth rate of the E. coli PFKA1 strain was close to that of the MGX strain showing a “restoration” of the strain growth capacity despite the absence of the pfkA gene (0.15 h.sup.−1 or one third of the growth rate of the MDO strain).
B. Metabolomic Analysis
[0225] Another characteristic phenotypic feature of the pfkA gene deletion mutant is the intracellular accumulation of Glucose-6-Phosphate (G6P) and Fructose-6-Phosphate (F6P) (Ishii, N., Nakahigashi, K., Baba, T., Robert, M., Soga, T., Kanai, A., Hirasawa, T., Naba, M., Hirai, K., Hoque, A., Ho, P. Y., Kakazu, Y., Sugawara, K., Igarashi, S., Harada, S., Masuda, T., Sugiyama, N., Togashi, T., Hasegawa, M., Takai, Y., Yugi, K., Arakawa, K., Iwata, N., Toya, Y., Nakayama, Y., Nishioka, T., Shimizu, K., Mori, H., Tomita, M., 2007. Multiple High-Throughput Analyses Monitor the Response of E. coli to Perturbations. Science 316, 593-597. [4]). Checking the accumulation of Glucose-1-Phosphate (G1P) and Mannose-1-Phosphate (M1P), necessary phosphorylated monosaccharides for the synthesis of oligosaccharides by glycoside-phosphorylases (GP), in the PFKA1 strain was carried out by quantitative analysis of the metabolome (intracellular metabolites). In particular, the determination of the concentration of hexose phosphates, in particular of Glucose-1-Phosphate (G1P) and Mannose-1-Phosphate (M1P) was carried out as follows.
B.1. Sampling and Extraction of Intracellular Metabolites
[0226] One hundred microliters of a culture in LB (lysogeny broth) medium (10 g/l of NaCl), overnight (i.e. 12 to 16 hours), of the different strains were used to inoculate 50 ml baffled Erlenmeyer flasks containing 10 mL of M9 medium supplemented with glucose at a final concentration of 3 g/L. The Erlenmeyer flasks were incubated for 24 h at 37° C. with an orbital stirring of 220 revolutions per minute (rpm). The cells were then collected by centrifugation (Sigma, Seelze, Germany) for 10 min at 2 000 g and at room temperature, (25° C.), then washed with M9 medium diluted five times, and used to inoculate, at an optical density of 600 nm of OD.sub.600 nm=0.1, 50 mL baffled Erlenmeyer flasks containing 50 mL of diluted M9 medium supplemented with 3 g/L of glucose and incubated at 37° C. with an orbital stirring of 220 revolutions per minute (rpm). The cellular growth was followed by measuring turbidimetry at an optical density of 600 nm using a Genesys 6 spectrophotometer (Thermo, USA). In the exponential growth phase, 120 μL of the culture was sampled and immediately mixed with 1.25 mL of a solution of acetonitrile/methanol/H.sub.2O (4:4:2) at −20° C. to simultaneously block the metabolic activity and extract metabolites; 60 μL of a cell extract containing completely .sup.13C-labeled metabolites were added to each sample to be used as internal standards as described in Mashego, M. R., Wu, L., Van Dam, J. C., Ras, C., Vinke, J. L., Van Winden, W. A., Van Gulik, W. M., Heijnen, J. J., 2004. MIRACLE: mass isotopomer ratio analysis of U.sup.−13C-labeled extracts. A new method for accurate quantification of changes in concentrations of intracellular metabolites. Biotechnol. Bioeng. 85, 620-628. [9] and Wu, L., Mashego, M. R., van Dam, J. C., Proell, A. M., Vinke, J. L., Ras, C., van Winden, W. A., van Gulik, W. M., Heijnen, J. J., 2005. Quantitative analysis of the microbial metabolome by isotope dilution mass spectrometry using uniformly 13C-labeled cell extracts as internal standards. Anal. Biochem. 336, 164-171. [12]
[0227] The samples were placed at −20° C. for 20 minutes, then centrifuged for 10 minutes at 10,000 g at 4° C. to remove cell debris. The supernatant was then dried under vacuum using a vacuum concentrator (SC110A SpeedVac Plus, ThermoSavant, Waltham, Mass., USA) and stored at −80° C. until analysis.
B.2. IC-ESI-HRMS Analysis of Metabolites
[0228] For the analysis, the samples were taken up in 120 μL of ultrapure water, then analyzed by ion chromatography (Thermo Scientific Dionex ICS-5000+ system, Dionex, Sunnyvale, Calif., USA) coupled to a mass spectrometer (LTQ Orbitrap mass spectrometer, Thermo Fisher Scientific, Waltham, Mass., USA) equipped with an electrospray type ionization source. The ion chromatography method is a variant of that described by Kiefer et al., 2007 (Kiefer, P., Nicolas, C., Letisse, F., Portais, J.-C., 2007. Determination of carbon labeling distribution of intracellular metabolites from single fragment ions by ion chromatography tandem mass spectrometry. Anal. Biochem. 360, 182-188. [5]). The KOH gradient was changed as follows: 0 min, 0.5 mM; 1 min, 0.5 mM; 9.5 min, 4.1 mM; 12.5 min, 30 mM; 24 min, 50 mM; 36 min, 60 mM; 36.1 min, 90 mM; 43 min, 90 mM; 43.5 min, 0.5 mM; 48 min, 0.5 mM. All gradients are linear. KOH gradient related signal deletion was performed by an electrochemical anionic suppressor (AERS 300-2 mm, Dionex, Sunnyvale, Calif., USA). The applied electrolysis current was 87 mA, in external regeneration mode using ultrapure water. The sample injection volume was 35 μL. Mass spectrometry analysis was carried out in negative mode, at a resolution of 30,000 in “fullscan” mode, with the following source parameters: source capillary temperature, 350° C.; source temperature, 300° C.; “sheath gas” flow rate, 50 a.u. (arbitrary unit); auxiliary gas, 5 a.u; S-Lens radio frequency (RF) level, 60%; and ionization spray voltage, 3.5 kV. Data were acquired with the Xcalibure software and processed with the TraceFinder 3.1 software (Thermo Fisher Scientific, Waltham, Mass., USA). Using calibration curves, the intracellular concentrations of each metabolite for the different strains were determined.
[0229] As demonstrated in
[0230] In addition, the results clearly demonstrate that the strains according to the invention allow the synthesis of oligosaccharides and advantageously their excretion in the culture medium. Thus, the production, recovery and isolation of oligosaccharides do not require any alteration or destruction of the strains, advantageously allowing a continuous production.
Example 2: Production of Oligosaccharides with the Strain Filed with the CNCM (Collection Nationale De Culture De Microorganismes, Institut Pasteur, 25 Rue Du Docteur Roux, 75724 Paris Cedex 15, France), Under Number CNCM I-5499
[0231] In this example the strain filed with the CNCM under number CNCM I-5499, also named PFKA1 strain or E. Coli PFKA1 strain in Example 1 above was used for the production of oligosaccharides. To do this, the strain was transformed with expression vectors as follows.
1. Transformation of the PFKA1 Strain with the Plasmids Carrying the Genes Encoding a GP
1.1. Cloning of the Gene Encoding the Teth514-1788 Enzyme in the Pbad-Hisa and Ptrc Plasmids (Primers and Plasmid Sequence)
[0232] The gene encoding the Teth514-1788 protein of the Thermoanaerobacter sp. X-514 strain (Teth514-1788, Genbank accession number ABY93073.1) belonging to the GH130 family of the CAZy classification (http://www.cazy.org/) (Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., Henrissat, B., 2014. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 42, D490-D495 [30]) was synthesized and cloned in the pBAD HisA vector by the Biomatik company (Biomatik, Ontario, Canada) between the NcoI and XhoI restriction sites.
[0233] The obtained plasmid sequence corresponds to sequence SED ID NO 29 represented in
[0234] The gene encoding the Teth514-1788 protein was also cloned in the pTRC-His-A vector between the BamH1 and EcoR1 restriction sites. The pTRC-His-A vector and the insert (coding sequence of the Teth514-1788 enzyme) were digested with the BamH1 and EcoR1 restriction enzymes according to the supplier's protocol (https://international.neb.com/protocols/2014/05/07/double-digest-protocol-with-standard-restriction-enzymes [47]). Beforehand, the BamH1 and EcoR1 restriction sites were added to the ends of the insert by polymerase chain reaction (PCR) using the primers fw: 5′-GAGGAAGGATCCATGGGCATTAAACTG-3′ (SEQ ID NO 31) and rev: 5′-GCTGCAGATGAATTCTTAATGGTG-3′ (SEQ ID NO 32) according to the supplier's protocol: https://international.neb.com/protocols/0001/01/01/pcr-protocol-m0530 [48]. The ligation of the insert and the vector purified on agarose gel is carried out by the T4 DNA ligase according to the supplier's protocol (https://international.neb.com/protocols/0001/01/01/dna-ligation-with-t4-dna-ligase-m0202 [49]).
[0235] The transformed strain was cultured in a M9 medium supplemented with mannose (20 g.Math.L.sup.−1) at 37° C. with stirring at 180 rpm for 6 days. The addition of 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) in the culture medium when the OD.sub.600 is ˜ 0.4 allows the expression of the gene which leads to the synthesis of a (His).sub.6-Teth514-1788 recombinant protein, of 38.9 kDa.
[0236] The E. coli PFKA1 strain was transformed either with the pBAD-His-Teth514-1788 plasmid or with the pTRC-His-Teth514-1788 plasmid.
[0237] The transformation process was identical regardless of the plasmid and corresponded to the standard protocol for transforming chemocompetent cells. (https://www.addgene.org/protocols/bacterial-transformation/[50])
[0238] The Teth514-1788-(His)6 protein is also named herein Teth-1788.
[0239] The transformed strains were cultured in Erlenmeyer flask in a M9 medium supplemented with mannose (
[0240] Protein expression profiles were determined by SDS-PAGE Any KD electrophoresis gel from Bio-Rad. The cell pellets are lysed in 5 mM Tris HCl buffer containing lysosyme (Euromedex ref 5934-C) at 0.5 mg.Math.mL-1 and DNAse (NEB, ref M0303L) at 50 μL (100 U) in 100 mL of 5 mM Tris HCl buffer. All the pellets were taken up in a buffer volume to be at an OD600 of 45 and incubated for 30 min at 37° C., then frozen at −20° C. The samples were thawed, centrifuged 25 min at 5000 g. 15 μL of each supernatant was taken up with 5 μL of loading dye blue (NEB, ref 50994905) were incubated 10 min at 95° C. before being placed on gel for a migration of 35 min at 100V in an electrophoresis tank in order to check if the Teth-1788 protein was indeed produced in the PFKA1 strain transformed with the pBAD-His-Teth514-1788 or pTRC-His-Teth514-1788 vectors.
[0241] As demonstrated in
[0242] This example clearly demonstrates that the E. coli PFKA1 strain can be i) transformed with expression vectors; and/or ii) used for the expression of genes encoding recombinant proteins
1.2 Cloning of the Gene Encoding the Uhgb_Mp Enzyme in the Pbad-Hisa and Ptrca Plasmids (Primers and Plasmid Sequence)
[0243] The gene encoding the “Unknown human gut bacteria_Mannoside-Phosphorylase” protein, a β-1,4-mannopyranosyl-chitobiose phosphorylase belonging to the GH130 family (Uhgb_MP, Genbank accession number ADD61463.1) was cloned in the pBAD HisA vector with primers:
TABLE-US-00013 Uhgb fw: (SEQ ID NO 33) 5′-CACCATGAGTATGAGTAGCAAAGTTATT-3′ and Uhgb rev: (SEQ ID NO 34) 5′-GATGATGCTTGTACGTTTGGTAAATTC-3′.
[0244] The cloning process was that described in the document http://tools.thermofisher.com/content/sfs/manuals/pentr_dtopo_man.pdf [51].
[0245] The obtained plasmid sequence corresponds to sequence SED ID NO 30 represented in
[0246] The gene encoding the Uhgb_MP-(His).sub.6 fusion protein was also cloned in the pTRC-His-A vector between the BamH1 and EcoR1 restriction sites. The transformed strain was placed in culture in a M9 medium supplemented with mannose (20 g.Math.L.sup.−1) at 37° C. with stirring (180 revolutions per minute (rpm), Infors HT Multitron) for 6 days. The addition of 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) in the culture medium when the OD.sub.600 is ≈0.4 for the expression of the gene by adding isopropyl-β-D-thiogalactopyranoside (IPTG) which lead to the synthesis of a (His).sub.6-Uhgb_MP fusion protein, of 43.6 kDa.
[0247] The E. coli PFKA1 strain was transformed either with the pBAD-His-Uhgb_MP plasmid or with the pTRC-His-Uhgb_MP plasmid.
[0248] The scheme of
1.3 Cloning of the Gene Encoding a β-1,3-Mannooligosaccharide Phosphorylase Enzyme in the PBAD-HISA Plasmid (Primers and Plasmid Sequence)
[0249] The synthetic gene encoding the protein of a β-1,3-mannooligosaccharide phosphorylase was provided by the Biomatik Limited company (Cambridge, Ontario, Canada) with an optimization of the use of codons for gene expression in E. coli. This enzyme belongs to the GH130 family (accession number GigaBase 340101.Vvad_PD3074). This gene originally in the pET23a(+) plasmid was cloned in the pBAD HisA plasmid by the “In-Fusion cloning” method with primers: fw: 5′—GAGGAATTAACCATGCTGAGCGTGGAAAAACGCTG-3′ (SEQ ID NO 35) and rev: 5′-AGCTGCAGATCTCGATCAGTGGTGGTGGTGGTGGTGCTCGA−3′ (SEQ ID NO 36).
[0250] The cloning process was that described on the cloning kit supplier site: https://www.takarabio.com/learning-centers/cloning/in-fusion-cloning-overview [58].
[0251] The obtained plasmid sequence corresponds to sequence SED ID NO 37 represented in
[0252] The transformed strain was cultured in a M9 medium supplemented with mannose (20 g.Math.L.sup.−1) at 37° C. with stirring at 180 rpm for 6 days. The E. coli PFKA1 strain was transformed with the pBAD-β-1,3-mannooligosaccharide phosphorylase plasmid.
[0253] The scheme of
1.4 Cloning of the Gene Encoding a Laminaribiose Phosphorylase Enzyme in the PBAD-HISA Plasmid (Primers and Plasmid Sequence)
[0254] The gene encoding the ACL0729 protein of the Acholeplasma laidlawii PG-8A strain (ACL0729, Genbank accession number ABX81345.1) belonging to the GH94 family of the CAZy classification (http://www.cazy.org/) (Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., Henrissat, B., 2014. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 42, D490-D495 [30]) was synthesized and cloned in the pBAD HisA vector by the GeneCust company (GeneCust, Boynes, France) between the NcoI and XhoI restriction sites.
[0255] The obtained plasmid sequence corresponds to sequence SED ID NO 38 represented in
2. Production of β-1,2-Mannobiose, β-1,3-Mannobiose, β-1,4-Mannobiose and Laminaribiose (β-1,3-Glucobiose)
2.1. Production of β-1,2-Mannobiose
[0256] Overnight cultures (10 to 15 hours) in LB medium of the non-transformed E. coli PFKA1-pBAD-Teth-1788 and PFKA1 strains (control condition) were used to inoculate at a OD.sub.600≈0.1 a culture of 50 mL of M9 medium supplemented with 3 g/L D-Mannose as the unique carbon source in a 250 mL baffled Erlenmeyer flask. The Erlenmeyer flasks were incubated for 24 h at 37° C. with an orbital stirring of 220 rpm. After 24 hours, the cells were harvested by centrifugation for 10 min at 2 000 g at room temperature, i.e. 24° C., washed by cell suspension in a M9 medium and used to inoculate at OD.sub.600≈0.1 a 500 mL bioreactor containing 350 mL of “modified” M9 medium (M9 modified salts: KH.sub.2PO.sub.4 3.02 g/L, NaCl 0.51 g/L, NH.sub.4Cl 2.04 g/L, (NH.sub.4)2SO.sub.4 5 g/L. Trace metals and salts: Na2EDTA 2 H.sub.2O 15 mg/L, ZnSO.sub.4 7H.sub.2O 4.5 mg/L, CoCl.sub.2 6H.sub.2O 0.3 mg/L, MnCl2 4H.sub.2O 1 mg/L, H.sub.3BO.sub.3 1 mg/L, Na2MoO.sub.4 2 H.sub.2O 0.4 mg/L, FeSO4 7 H.sub.2O 3 mg/L, CuSO.sub.4 5 H.sub.2O 0.3 mg/L. MgSO.sub.4 0.5 g/L CaCl.sub.2) 4.38 mg/L, Thiamine hypochloride 0.1 g/L) supplemented with 10 g/L of D-mannose. The fermentation parameters, namely a pH of 7.0, a temperature of 37° C., a partial pressure of dissolved O.sub.2 (pO2) of 30% or more, a stirring of 500 rpm or more were monitored and controlled by means of a Multifors bioreactor system (Infors, Switzerland). The growth was estimated by measuring the turbidimetry of the culture medium at an optical density of 600 nm using a Genesys 6 spectrophotometer (Thermo, USA). Culture samples of the PFKA1-pBAD-Teth-1788 strain and the PFKA1 control strain were collected at different culture times and analyzed by nuclear magnetic resonance (NMR).
2.2. Identification of Products by Nmr
[0257] Regular samples of the culture medium (1 mL) were centrifuged for 2 min at 18 000 g and 500 μL of the supernatants were mixed with 100 μL of D.sub.2O containing 2.35 g/L of tetra-deuterated 3-(trimethylsilyl)-1-propanesulfonic acid (TSPd4), compound used as an internal standard for NMR analysis. .sup.1H-NMR spectra were acquired with an Avance 500 MHz NMR spectroscope equipped with a 5 mm BBI probe (Bruker, Rheinstatten, Germany). The processing of the spectra and the quantification of the metabolites were carried out with the Topspin 3.1 software (Bruker, Rheinstatten, Germany). The culture supernatants obtained with the PFKA1-pBAD-Teth-1788 or PFKA1 strains were thus analyzed throughout the culture.
[0258] The obtained results clearly demonstrate that the strain according to the invention advantageously allows the production of oligosaccharides. In addition, the obtained results clearly demonstrate that the strain according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0259] In other words, the results clearly demonstrate that the strain according to the invention allows the synthesis of oligosaccharides and advantageously their excretions in the culture medium.
2.3. Analysis of the Presence of β-1,2-Mannobiose in the Culture Supernatant by High-Performance Anion Exchange Chromatography with Pulsed Amperometry Detection (HPAEC-PAD)
[0260] Confirmation of the presence of β-1,2-mannobiose in the extracellular medium was carried out via an orthogonal analysis method. The analyzed samples corresponded to culture supernatants of the PFKA1 strain transformed with pBAD-Teth-1788 or of the PFKA1 strain as described above.
[0261] Samples of 1 mL of culture supernatants were subjected to heat shock for 10 min at 95° C., then centrifuged for 10 minutes at 15,000 g and were filtered on a 0.22 μm membrane. A 25-fold dilution of the filtered samples in ultrapure water was carried out before analysis. The separation of the molecules was carried out on a 2×250 mm PA100 Dionex Carbopac column (Thermo Fisher) with an elution gradient at 0.25 mL/min with the eluents A (H.sub.2O), B (150 mM NaOH) and C (150 mM NaOH+500 mM sodium acetate) as follow: 0-3 min, 50% A-50% B; 3 min, 100% B; 3-6 min, 100% B; 6-12 min, 50% B-50% C; 12 min, 5% B-95% C; 12-15 min, 5% B-95% C; 15 min, 50% A-50% B; 15-23 min, 50% A-50% B. The detection was carried out by a Dionex ED40 module having a gold electrode and anAg/AgCl pH reference.
[0262] Furthermore, an in vitro production (without the strain) from an enzymatic reaction mixture with Teth-1788 β-1,2-mannobiose phosphorylase was carried out using 300 mM mannose, 15 mM α-D-Mannose 1-Phosphate, 0.16 mg.Math.mL.sup.−1 Teth-1788 enzyme in a total volume of 10 mL of 20 mM tris-HCl buffer, pH7. The reaction was carried out for 24 hours in a water bath at 37° C. under stirring. The obtained β-1,2-mannobiose was purified as described in Chiku K, Nihira T, Suzuki E, Nishimoto M, Kitaoka M, et al. (2014) Discovery of Two b-1,2Mannoside Phosphorylases Showing Different Chain-Length Specificities from Thermoanaerobacter sp. X-514. PLoS ONE 9(12): e114882. doi:10.1371/journal.pone.0114882 [61]
[0263] The obtained results, namely the chromatograms are represented in
2.4. Production Profile of β-1,2-Mannobiose in Bioreactor
[0264] A study of the production of β-1,2-mannobiose was followed by NMR during cultures in bioreactor with the MDO, MGX, MGX1 and PFKA1 strains.
[0265] The strains were transformed beforehand with the pBAD-Teth-1788 plasmid. The culture conditions of each of the strains were identical to those mentioned above.
[0266] The determination of the concentrations was carried out by NMR from supernatant samples of the culture medium according to the process described in Nord LI, Vaag P, Duus JØ Quantification of organic and amino acids in beer by 1H NMR spectroscopy Anal Chem. 2004 Aug. 15; 76(16):4790-8 [59] or Gloriadel Campo, InakiBerregi, RaúlCaracena, J. IgnacioSantos “Quantitative analysis of malic and citric acids in fruit juices using proton nuclear magnetic resonance spectroscopy” Analytica Chimica Acta, Volume 556, Issue 2, 25 Jan. 2006, Pages 462-468 [60] using 1 mM TSP (Trimethylsilylpropanoic acid) as an internal standard to calculate the concentration of β-1,2-mannobiose.
[0267] The final concentration of β-1,2-mannobiose in the culture medium was 1.80 mM and the yield of β-1,2-mannobiose per g of consumed mannose is 9.02% (g/g).
[0268] In the same way and by following the same protocol, the production of β-1,2-mannobiose was evaluated in bioreactor for the MDO, MGX and MGX1 strains, transformed with the pBAD-HisA-Teth514-1788 plasmid according to the process described above in order to determine the effect of each mutation on the production of β-1,2-mannobiose. Table 9 groups together the calculated production characteristics for the different strains from the concentrations of β-1,2-mannobiose and of residual mannose determined by NMR.
TABLE-US-00014 TABLE 9 TITERS AND YIELDS OF β-1,2-MANNOBIOSE IN THE CULTURE SUPERNATANTS IN BIOREACTOR OF THE MDO, MGX, MGX1 AND PFKA1 STRAINS EXPRESSING THE TETH-1788 ENZYME. THE CONCENTRATIONS ARE EXPRESSED IN MM AND THE YIELDS IN A PERCENTAGE OF MANNOSE CONVERTED INTO β- 1,2-MANNOBIOSE Man.sub.2 Titer % Yield (g Strain Characteristic (mM) Man.sub.2/g Man) MDO-Teth- Control strain ND ND 1788 MGX-Teth- PTS-, no GalP; non-induced 0.21 1.02 1788 manB MGX1- PTS-with induced GalP, 0.59 2.91 Teth-1788 induced manB PFKA1- PTS-with GalP; deletion of 1.8 9.02 Teth-1788 pfka; induced manB ND. Not detected
[0269] As demonstrated above, in the culture medium of the MDO strain, the β-1,2-mannobiose is not detected while in the MGX strain, it is present in very low but quantifiable concentration (0.21 mM). Also, it seems that the deletion of the gene encoding the PTS allows the import of the mannose in the cell in a non-phosphorylated form, which is one of the glycoside-phosphorylase substrates. The MGX1 strain shows an increase in the β-1,2-mannobiose production (0.59 mM). This increase may be related to two factors: 1) improvement of the mannose transport by overexpression of GalP and 2) increase of the intracellular concentration of mannose-1-Phosphate (M1P) (in comparison with the MGX strain) due to overexpression of the manB gene, the product of which, the ManB protein, catalyzes the formation of M1P from Mannose-6-Phosphate (M6P). M1P is the second glycoside phosphorylase substrate and the intracellular level of M1P is important for the biosynthesis of β-1,2-mannobiose. Surprisingly and unexpectedly, the production of β-1,2-mannobiose by the PFKA1 strain is tripled with respect to the MGX1 strain (1.8 mM), which represents an increase by approximately a factor of 9 with respect to the MGX strain. Advantageously, the intracellular increase in M1P possibly has an effect in obtaining this result.
[0270] As demonstrated above, the strain according to the invention advantageously and surprisingly allows to significantly increase the production of oligosaccharides. In addition, the results obtained clearly demonstrate that the strain according to the invention allows to significantly increase the production yields of oligosaccharides and thus to optimize/reduce the production costs.
Purification of in Cellulo Synthesized β-1,2-Mannobiose
[0271] An analysis of the β-1,2-mannobiose produced by the PFKA1-pBAD-Teth1788 strain was carried out. To do this, 12 mL of culture supernatant of the PFKA1-pBAD-Teth1788 strain were subjected to a heat shock for 8 min at 95° C., centrifuged for 10 min at 15 000 g at 15° C. The supernatant was filtered through a membrane (sartorius, Minisart) in cellulose acetate with pores of 0.22 μm before being lyophilized and taken up in 500 μL of H.sub.2O in total, in 2 vials with insert (250 μL each). The purification was carried out with a HPLC 1260 infinity (Agilent) coupled to an UltiMate 3000 automatic fraction collector (Thermo scientific). An asahipak NH2P-50 4E column (Shodex) allows the separation of the compounds via isocratic elution of an acetonitrile/H.sub.2O mixture (70/30 respectively), at a flow rate of 1 mL/min. The compounds were detected by refractive index (RI). The purity of β-1,2-mannobiose was estimated before (
TABLE-US-00015 TABLE 10 PERCENTAGE OF AREA UNDER THE CURVE peak 1 2 3 4 5 6 number Contaminant Contaminant β-1,2-man.sub.2 Contaminant Contaminant Contaminant Relative 1.04 2.10 91.47 4.07 0.67 0.65 area (%)
[0272] From the chromatograms, the obtained titers and purification yields were calculated from standard curves represented in
[0273] Table 11 below summarizes the obtained yield and purification results.
TABLE-US-00016 TABLE 11 PURIFICATION YIELDS OF B-1,2-MANNOBIOSE FROM 12 ML OF PFKA1-PBAD-TETH-1788 CULTURE SUPERNATANT. Culture supernatant volume β-1,2-mannobiose (purified) mass 12 mL 6.8 mg Titer in the culture supernatant after purification: 567 mg .Math. L.sup.−1 Titer in the culture supernatant before purification, calculated from the NMR data, 950 mg .Math. L.sup.−1 and from the HPAEC-PAD data, 1260 mg .Math. L.sup.−1. Purification yield: 45% (HPAEC-PAD), 60% (NMR)
[0274] As demonstrated above, the strain according to the invention advantageously allows to produce oligosaccharides in high yields. Moreover, as demonstrated above, the strain according to the invention advantageously allows the accumulation of the produced oligosaccharides in the culture medium. In addition, the recovery of the produced oligosaccharide is facilitated from the culture medium.
3. Production of β-1,4-Mannobiose
3.1. Production of β-1,4-Mannobiose and NMR Identification
[0275] Cultures of the non-transformed (control condition), transformed with the pBAD-UhgbMP plasmid or transformed with the pTRC-UhgbMP plasmid E. coli PFKA1 strain were produced in an Erlenmeyer flask according to the protocol described in Example 1. A study of the growth profile of these 3 cultures was carried out. Growth profile analysis was carried out as described above.
[0276] A culture supernatant with the E. coli PFKA1-pBAD-UhgbMP strain was analyzed by NMR by applying the same parameters as those previously described.
[0277] The obtained results therefore clearly demonstrate that the strain according to the invention advantageously allows the production of oligosaccharides. In addition, the obtained results clearly demonstrate that the strain according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0278] In addition, the results clearly demonstrate that the strain according to the invention allows the synthesis of oligosaccharides and advantageously their excretion in the culture medium. Thus the production, recovery and isolation of oligosaccharides do not require any alteration or destruction of the strain, advantageously allowing a continuous production.
3.2. Confirmation of the Production β-1,4-Mannobiose by HPAEC-PAD
[0279] The samples were analyzed by HPAEC-PAD by applying the same protocol as that described previously (see section 3).
[0280] As demonstrated in
[0281] As represented in
[0282] In addition, the obtained results demonstrate that the produced oligosaccharides are excreted in the medium advantageously allowing a conservation of the strain/culture and also advantageously an easier isolation/recovery of the produced oligosaccharide.
4. Production of B-1,3-Mannobiose
4.1. Production of β-1,3-Mannobiose and NMR Identification
[0283] A culture of the E. coli PFKA1 strain transformed with the pBAD-β-1,3-mannooligosaccharide phosphorylase plasmid was carried out in an Erlenmeyer flask according to the protocol described in Example 1. The culture supernatant with the PFKA1-pBAD-β-1,3-mannooligosaccharide phosphorylase strain was analyzed by NMR at the beginning (3 hours) and at the end of culture (4 days) by applying the same parameters as those previously described.
[0284] The obtained results therefore clearly demonstrate that the strain according to the invention advantageously allows the production of oligosaccharides. In addition, the obtained results clearly demonstrate that the strain according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0285] In addition, the results clearly demonstrate that the strain according to the invention allows the synthesis of oligosaccharides and advantageously their excretion in the culture medium.
4.2. Confirmation of the Production β-1,3-Mannobiose by HPAEC-PAD
[0286] The samples were analyzed by HPAEC-PAD by applying the same protocol as that described previously (see section 3).
[0287] As demonstrated in
[0288] As represented in
[0289] As demonstrated in
5. Production of Laminaribiose (β-1,3-Glucobiose)
5.1. Production of Laminaribiose and NMR Identification
[0290] The E. coli PFKA1 strain transformed with the pBAD-His-laminaribiose phosphorylase plasmid (pBAD-ACL0729) according to the classic protocol for transforming chemo-competent cells (https://www.addgene.org/protocols/bacterial-transformation/[50]) and the non-transformed PFKA1 strain were cultured in an Erlenmeyer flask according to the protocol described in Example 2 paragraph 1.4.
[0291]
[0292] The supernatants of the two cultures, with the PFKA1-pBAD-ACL0729 strain and non-transformed pFKA1 were analyzed by NMR after 49 hours of culture and compared by applying the same parameters as those previously described.
[0293] The obtained results therefore clearly demonstrate that the strain according to the invention advantageously allows the production of oligosaccharides. In addition, the obtained results clearly demonstrate that the strain according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0294] In addition, the results clearly demonstrate that the strain according to the invention allows the synthesis of oligosaccharides and advantageously their excretion in the culture medium.
5.2. Confirmation of the Production Laminaribiose by HPAEC-PAD
[0295] The samples were analyzed by HPAEC-PAD by applying the same protocol as that described above (Example 2 paragraph 3).
[0296] As demonstrated in
[0297] As represented in
[0298] Table 12 corresponds to the integration of the peaks obtained by HPAEC-PAD on a standard range of commercial laminaribiose (std Laminaribiose) at different concentrations: 1 mg/L, 5 mg/L, 10 mg/L, 50 mg/L or 100 mg/L (laminaribiose commercial standard calibrator range from 1 to 100 mg), on samples of supernatants of cultures of the non-transformed E. coli PFKA1 strain (PFKA1) at different culture times: 40 hours, 49 hours or 65 hours and on samples of supernatant of the cultures of the E. coli PFKA1 strain transformed with the pBAD-ACL0729 plasmid (PFKA1 pBAD-ACL0729) at different culture times: 40 hours, 49 hours or 65 hours. Culture supernatant samples were diluted 20 times before measurement.
TABLE-US-00017 TABLE 12 INTEGRATION OF THE PEAKS OBTAINED BY HPAEC-PAD AND THE CORRESPONDING AMOUNT OF LAMINAROBIOSE. Ret.Time Area Quantity Quantity min nC*min (mg .Math. L.sup.−1) (mM) ED_1 ED_1 ED_1 ED_1 Injection name Laminaribiose Laminaribiose Laminaribiose Laminaribiose PFKA1 pBAD- 14.19 7.01 6.63 0.019 ACL0729 40 h (dil20) PFKA1 pBAD- 14.19 7.28 6.93 0.020 ACL0729 49 h (dil20) PFKA1 pBAD- 14.20 6.92 6.52 0.019 ACL0729 65 h (dil20) std 14.19 88.09 98.66 0.288 Laminaribiose 100 mg/l std 14.20 47.61 52.70 0.154 Laminaribiose 50 mg/l std 14.20 10.27 10.32 0.030 Laminaribiose 10 mg/l std 14.18 5.08 4.44 0.013 Laminaribiose 5 mg/l std 14.18 1.06 n.d. n.d. Laminaribiose 1 mg/l PFKA1_40 h n.d. n.d. n.d. n.d. (dil20) PFKA1_49 h 14.19 0.10 n.d. n.d. (dil20) PFKA1_65 h 14.21 0.04 n.d. n.d. (dil20) In Table 12 above “Ret. Time” means retention time and “n.d.” not determined.
[0299] As demonstrated in Table 12, after 49 hours of culture, the culture supernatant of the E. coli PFKA1-pBAD-ACL-0729 strain shows a laminaribiose titer of 139 mg.Math.L.sup.−1. As demonstrated in
Example 3: Manufacture and Characterization of the Strain Filed with the CNCM Under Number CNCM I-5681
[0300] From the strain described in Example 1, the following modifications were provided to obtain further improved yields for the conversion of mannose into mannobiose. In the example below, the strain filed with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5681 is also designated CS1 or CS0ΔmaaΔmanA or OLI-CS1 strain.
1. Preparation and Production of the Sc1 Strain Filed with the CNCM Under Number CNCM I-5681 and Phenotypic Validation
1.1 Deletion of the Maa Gene:
[0301] The production of mannobiose with the E. coli PFKA1 strain, also referred to as CS0, cultured in minimal medium, comes along with the production of a compound, detected by NMR. This compound would correspond to an acetylated sugar, formed in the cell cytosol by maltose acetyltransferase, encoded by the maa gene (Leila Lo Leggio, Florence Dal Degan, Peter Poulsen, Søren Møller Andersen, and Sine Larsen. The Structure and Specificity of Escherichia coli Maltose Acetyltransferase Give New Insight into the LacA Family of Acyltransferases. Biochemistry 2003, 42, 18, 5225-5235; DOI: 10.1021/bi0271446 [63]). This enzyme is known to be able to add an acetyl group to a wide range of sugars. This reaction is made possible by the particular physiology of the PFKA1 (CS0) strain since the inactivation of genes encoding PTS system elements leads to the internalization of monosaccharides without chemical modification. In order to eliminate this contaminant, the maa gene was inactivated according to the protocol described in Datsenko and Wanner (Kirill A. Datsenko, Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences June 2000, 97 (12) 6640-6645; DOI: 10.1073/pnas.120163297 [62]). A DNA fragment containing the kanamycin resistance gene and flanked by Flippase Recognition Target (FRT) sites was amplified by adding to the ends of the two primers, 50 bp corresponding to the 5′ and 3′ ends of the maa gene. The primers used for PCR amplification were as follows:
TABLE-US-00018 FW: (SEQ ID NO: 39) 5′ ATGAGCACAGAAAAAGAAAAGATGATTGCTGGTGAGTTGTATCGCTC GGCGTGTAGGCTGGAGCTGCTTC 3′ and RV: (SEQ ID NO 40) 5′ TTACAATTTTTTAATTATTCTGGCTGGATTACCGCCCACGACAACGT TGTCATATGAATATCCTCCTTAG 3′
[0302] The NEB phusion DNA polymerase was used to amplify the cassette using 1 ng of plasmid as a template, according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 1 min at 98° C., 5 cycles of 30 sec at 98° C., 30 sec at 55° C. and 1 min at 72° C., 30 cycles of 30 sec at 98° C., 1 min at 72° C. and 1 cycle of 5 min at 72° C. The fragment thus amplified by PCR was purified from a gel and then quantified with a Nanodrop spectrophotometer.
[0303] The E. Coli PFKA1 (CS0) strain was chemically transformed with the pKD46 plasmid at 30° C. on LB agars supplemented with ampicillin at 50 μg/ml. The pKD46 plasmid possesses lambda, R and exo phage genes under the control of the arabinose promoter. Transformants carrying the pKD46 plasmid were cultured in 5 mL of LB medium containing 50 μg/mL of ampicillin and L-arabinose (0.2% w/v) at 30° C. to an OD.sub.600 of 0.6, then concentrated 100 times and washed three times with 10% cold glycerol. Electroporation of cells as obtained, was carried out using a Cell-Porator with a voltage amplifier and 0.1 cm chambers according to the manufacturer's instructions, using 50 μL of cells and 200 ng of the PCR fragments obtained above. One milliliter of SOC medium (2% tryptone; 0.5% yeast extract; 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl.sub.2, 10 mM MgSO.sub.4, and 20 mM glucose) was added to the cells having undergone this treatment and, incubated for 2 hours at 37° C., then spread on a LB agar supplemented with 50 μg/mL of kanamycin to select the Km transformants. The elimination of the maa gene was confirmed by PCR on colony as described below using the following primers:
TABLE-US-00019 FW: (SEQ ID NO: 41) 5′ GATGATTGCTGGTGAGTTGTATCG 3′ and RV: (SEQ ID NO: 42) 5′ TTAATTATTCTGGCTGGATTACCG 3′
[0304] The NEB taq DNA polymerase was used to amplify a fragment of the maa gene using 1 μL of a cell colony dissolved in 50 μL of sterile water according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 5 min at 95° C., 35 cycles of 30 sec at 95° C., 30 sec at 55° C. and 1.5 min at 68° C., and 1 cycle of 5 min at 68° C. Once the colonies having lost the gene were identified, the elimination of the kanamycin resistance cassette was carried out by transforming, one of the positive colonies with the pCP20 plasmid. The plasmid pCP20 plasmid is an ampicillin-resistance plasmid with temperature sensitive replication and an induction of the FLP synthesis by heat shock. The Kanamycin-resistant (KmR) mutants were transformed with the pCP20 plasmid, and the ampicillin-resistant transformants were selected at 30° C. Transformants were isolated on LB agar non-selectively at 43° C. and then tested for loss of all antibiotic resistances.
[0305] The PFKA1 strain, also designated CS0 in which the maa gene has been inactivated, is referred to as CS0Δmaa.
1.2 Strain Phenotypic Validation
[0306] The E. coli PFKA1, also referred to as PFKA1, E. coli CS0 or CSO, and CS0Δmaa carrying the pBAD-Teth1788 plasmid were cultured in M9 mineral medium supplemented with mannose at a concentration of 6 g/L. The cultures were carried out in duplicate or in triplicate in 250 mL baffled Erlenmeyer flasks containing 50 ml of culture medium, at 37° C. and under orbital stirring at 200 rpm. The growth was followed by measuring turbidimetry at 600 nm. Kanamycin and ampicillin were added to a final concentration of 50 μg/mL, to ensure maintenance of the plasmids in the cells. IPTG (final concentration of 60 μM) and arabinose (final concentration of 10 mM) were added to the medium to induce the protein expression. Extracellular metabolites were identified and quantified by NMR. Samples of the culture were collected at different culture times and centrifuged for 2 min at 18,000 g. 500 μL of those supernatants were mixed with 100 μL of D.sub.2O containing 2.35 g/L of tetra-deuterated 3-(trimethylsilyl)-1-propanesulfonic acid (TSPd4), molecule used as an internal standard for NMR analysis. .sup.1H-NMR spectra were acquired with an Avance 500 MHz NMR spectroscope equipped with a 5 mm BBI probe (Bruker, Rheinstatten, Germany). The processing of the spectra and the quantification of the metabolites were carried out with the Topspin 3.1 software (Bruker, Rheinstatten, Germany). The obtained results are represented in
[0307] As represented in
[0308] This example clearly demonstrates that the CS0Δmaa strain advantageously allows the production of oligosaccharides, for example of mannobiose, without the production of acetylated sugar.
1.3. Deletion of the Mana Gene
[0309] The inventors have surprisingly demonstrated that the deletion of the manA gene advantageously allows to maximize the conversion of mannose into mannobiose.
[0310] The deletion of the manA gene was carried out according to the Datsenko and Wanner protocol (Kirill A. Datsenko, Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences June 2000, 97 (12) 6640-6645; DOI: 10.1073/pnas.120163297 [62]). A DNA fragment containing the kanamycin resistance gene and flanked by “Flippase Recognition Target” (FRT) sites was amplified by adding to the ends of the two primers, 50 bp corresponding to the 5′ and 3′ ends of the manA gene. The primers used for PCR amplification were as follows:
TABLE-US-00020 FW: (SEQ ID NO: 43) 5′ ATTATGCGCAGCACAGCCACTCTCCATTCAGGTTCATCCAAACAAAC ACAGTGTAGGCTGGAGCTGCTTC 3′ and RV: (SEQ ID NO: 44) 5′ ACACGCGCTAAACGGCCGTGGCCTTTGACAGTCACCGGTGATTCGTT GGCCATATGAATATCCTCCTTAG 3′
[0311] The NEB phusion DNA polymerase was used to amplify the cassette using 1 ng of pKD4 plasmid as a template, according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 1 min at 98° C., 5 cycles of 30 sec at 98° C., 30 sec at 55° C. and 1 min at 72° C., 30 cycles of 30 sec at 98° C., 1 min at 72° C. and 1 cycle of 5 min at 72° C. The fragment thus amplified by PCR was purified from a gel and then quantified with a Nanodrop spectrophotometer.
[0312] The CS0Δmaa strain was transformed with the pKD46 plasmid at 30° C. on LB agars supplemented with ampicillin at 50 μg/ml. Transformants carrying the pKD46 plasmid were cultured in 5 mL of LB medium containing 50 μg/mL of ampicillin and L-arabinose (0.2% w/v) at 30° C. to an OD.sub.600 of 0.6, then concentrated 100 times and washed three times with 10% cold glycerol. Electroporation of cells as obtained, was carried out using a Cell-Porator with a voltage amplifier and 0.1 cm chambers according to the manufacturer's instructions, using 50 μL of cells and 200 ng of the PCR fragments obtained above. 1 ml of SOC medium (see composition above) was added to the cells having undergone this treatment and, incubated for 2 hours at 37° C., then spread on a LB agar supplemented with 50 μg/rnL of kanamycin to select the Km transformants. The elimination of the manA gene was confirmed by PCR on colony (according to the process below) using the following primers:
TABLE-US-00021 FW: (SEQ ID NO: 45) 5′ GTGCGGGTCTGACGCCTAAATAC 3′ and RV: (SEQ ID NO: 46) 5′ GATGGGTTTCAATCTTCTTGCCT 3′.
[0313] The NEB taq DNA polymerase was used to amplify a fragment of the manA gene using 1 μL of a cell colony dissolved in 50 μL of sterile water according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 5 min at 95° C., 35 cycles of 30 sec at 95° C., 30 sec at 55° C. and 1.5 min at 68° C., and 1 cycle of 5 min at 68° C. Once the colonies having lost the gene were identified, the elimination of the kanamycin resistance cassette was carried out by transforming, one of the positive colonies with the pCP20 plasmid. The Kanamycin-resistant (KmR) mutants were transformed with the pCP20 plasmid, and the ampicillin-resistant transformants were selected at 30° C. Transformants were isolated on LB agar non-selectively at 43° C. and then tested for loss of all antibiotic resistances.
[0314] The strain thus obtained corresponds to the PFKA1 strain, also referred to as CSO, in which the maa gene and the manA gene have also been inactivated.
[0315] The PFKA1 strain, also referred to as CSO, in which the maa gene and the manA gene have been inactivated is referred to as CS0ΔmaaΔmanA or CS1.
1.4. Construction of the pTC-galP Plasmid
[0316] Induction of galP by IPTG in a high copy plasmid (pWKS) results in a significant additional energy cost for the bacteria, which can affect the cell function. Therefore, the galP gene was introduced into a medium copy plasmid under the control of a strong constitutive promoter. For this purpose, the pTC-galP plasmid was constructed, using the constitutive promoter of E. coli pIHF and the pA15 replication origin. The plasmid cloning was carried out by homologous recombination by amplifying 3 different DNA fragments with homologous ends to assemble the different elements of the plasmid.
[0317] The ADN fragments were amplified as follows:
[0318] a) Replication origin and kanR using the pZA23 plasmid as a template with the following primers:
TABLE-US-00022 FW: (SEQ ID NO: 47) 5′ AAATAGGCGCTCACGATTAAAAGGAAGCTGAGTTGGCTGC 3′ RV: (SEQ ID NO 48) 5′ TAGCTTTGCACTGTTTCAGAGTGAAGACGAAAGGGCCTCG 3′
The NEB phusion DNA polymerase was used to amplify the cassette using 1 ng of pKD4 plasmid as a template, according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 1 min at 98° C., 5 cycles of 30 sec at 98° C., 30 sec at 60° C. and 1 min at 72° C., 30 cycles of 30 sec at 98° C., 1 min at 72° C. and 1 cycle of 5 min at 72° C. The fragment thus amplified by PCR was purified from a gel and then quantified with a Nanodrop spectrophotometer.
[0319] b) IHF promoter of the pBS1C3-IHF plasmid with the following primers:
TABLE-US-00023 FW: (SEQ ID NO: 49) 5′ CGAGGCCCTTTCGTCTTCACTCTGAAACAGTGCAAAGCTA 3′ RV: (SEQ ID NO: 50) 5′ TGTTTTTTAGCGTCAGGCATCTCTAGGATTCCTCCGGTTC 3′
The NEB phusion DNA polymerase was used to amplify the cassette using 1 ng of pBS1C3-IHF plasmid as a template, according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 1 min at 98° C., 5 cycles of 30 sec at 98° C., 30 sec at 60° C. and 1 min at 72° C., 30 cycles of 30 sec at 98° C., 1 min at 72° C. and 1 cycle of 5 min at 72° C. The fragment thus amplified by PCR was purified from a gel and then quantified with a Nanodrop spectrophotometer.
[0320] c) GalP transporter using the pWKS-galP plasmid as a template with the following primers:
TABLE-US-00024 FW: (SEQ ID NO 51) 5′ GAACCGGAGGAATCCTAGAGATGCCTGACGCTAAAAAACA 3′ RV: (SEQ ID NO 52) 5′ GCAGCCAACTCAGCTTCCTTTTAATCGTGAGCGCCTATTT 3′
[0321] The NEB phusion DNA polymerase was used to amplify the cassette using 1 ng of pWKS-galP plasmid as a template, according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 1 min at 98° C., 5 cycles of 30 sec at 98° C., 30 sec at 62° C. and 1 min at 72° C., 30 cycles of 30 sec at 98° C., 1 min at 72° C. and 1 cycle of 5 min at 72° C. The fragment thus amplified by PCR was purified from a gel and then quantified with a Nanodrop spectrophotometer.
[0322] The three purified fragments were incubated together and cloning was performed using the inFusion® Takara cloning kit according to the manufacturer's instructions, which allowed to perform the ligation reaction and the transformation of chemically competent E. coli Top10 cells. Selection was performed on LB agars supplemented with 50 μg/mL of kanamycin.
[0323] The correct assembly of the plasmid was confirmed by colony PCR using the following primers:
TABLE-US-00025 FW: (SEQ ID NO: 53) 5′ TCTGAAACAGTGCAAAGCTA 3′ and RV: (SEQ ID NO: 54 5′ TTAATCGTGAGCGCCTATTT 3′
[0324] The NEB taq DNA polymerase was used to amplify a DNA fragment between the sequence of the IHF promoter and that of the galP gene using 1 μL of a cell colony dissolved in 50 μL of sterile water according to the manufacturer's instructions. The PCR amplification was carried out as follows:
[0325] 1 cycle of 5 min at 95° C., 35 cycles of 30 sec at 95° C., 30 sec at 55° C. and 1.5 min at 68° C., and 1 cycle of 5 min at 68° C.
[0326] Positive colonies were cultured in 5 ml of LB liquid medium supplemented with 50 μg/mL of kanamycin overnight at 37° C. Then, “miniprep” of the pTC-galP plasmid were carried out with the Qiagen preparation kit to recover and concentrate the pTC-galP plasmid.
1.5. Production of Mannobiose on a Mixture of Glycerol and Mannose.
[0327] A) The Obtained CS1 (Csoamaaamana) Strain Transformed with the Pairs of PWKS-GALP/PBAD-Teth88 (A1) or Ptc-Galp/Pbad-Teth88 (C1) Plasmids
[0328] Growth was carried out in 250 mL baffled Erlenmeyer flasks containing 50 mL of M9 medium, at 37° C. and under orbital stirring of 200 rpm. The M9 medium was supplemented with 6 g/L of glycerol and 1 g/L of mannose, 0.06 mM of IPTG and 10 mM of L-arabinose. The analysis of the culture medium supernatant was carried out by NMR as described above.
[0329] The strains were cultured after culture a supernatant sample was analyzed with to determine the concentration of β-1,2-mannobiose, according to the process described in Example 2 above, present as a function of the pWKS-galP/pBAD-Teth88 (A1) or pTC-galP/pBAD-Teth88 (C1) plasmids, present in the CS1 strain. The β-1,2-mannobiose concentration measured for the CS1 strain transformed with the pWKS-galP/pBAD-Teth88 (A1) plasmids was 0.78 mM in the supernatant of the culture medium and 0.91 mM in the supernatant for the CS1 strain transformed with the pTC-galP/pBAD-Teth88 (C1) plasmids. A determination of the conversion rate of mannose into β-1,2-mannobiose was also estimated and corresponded to 48% and 60% respectively.
[0330] This example therefore clearly demonstrates that the CS1 strain, also named CS0ΔmaaΔmanA, corresponding to the PFKA1 strain in which the maa gene and the manA gene have been inactivated advantageously allows a production of oligosaccharides. In addition, the obtained results clearly demonstrate that a strain example according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0331] This example also demonstrates that a strain example according to the invention advantageously allows a production of oligosaccharides with high production yields.
[0332] In other words, the results clearly demonstrate that a strain example according to the invention advantageously allows the synthesis of oligosaccharides and advantageously their excretions in the culture medium.
B) Production of β-1,2-Mannobiose in a Bioreactor
[0333] A bioreactor production of β-1,2-mannobiose by the CS1 strain with the pair of C1 plasmids was carried out. For this bioreactor experiment, the composition of the M9 salts was modified as follows: KH2PO4 3.02 g/L, NaCl 0.51 g/L, NH4C1 2.04 g/L, (NH.sub.4)2SO.sub.4 5 g/L. All other components for the culture are the same as those described for the culture above. The cultures in a bioreactor were carried out in 500 ml of this M9 medium supplemented with 3 g/L of D-mannose and 20 g/L of glycerol. The analysis of the supernatant was carried out by NMR as described in Example 2. At the end of the culture, a supernatant sample was analyzed to determine the concentration of β-1,2-mannobiose, according to the process described in Example 2 above. The determined β-1,2-mannobiose concentration was 1.21 mM and the conversion rate 58%, similar to the values obtained during the aforementioned culture in Erlenmeyer flasks.
[0334] A comparison of the production of β-1,2-mannobiose in bioreactor was also carried out with the MDO, MGX, MGX1, PFKA1, CS0 Δmaa strains, expressing the Teth-1788 enzyme
[0335] Table 13 groups together the calculated production characteristics for the different strains from the concentrations of β-1,2-mannobiose and of residual mannose determined by NMR.
TABLE-US-00026 TABLE 13 TITERS AND YIELDS OF B-1,2-MANNOBIOSE IN THE CULTURE SUPERNATANTS IN BIOREACTOR OF THE MDO, MGX, MGX1, PFKA1, CS0 ΔMAA, AND CSI (ΔMAA ΔMANA) STRAINS EXPRESSING THE TETH-1788 ENZYME. THE CONCENTRATIONS (TITER) ARE EXPRESSED IN MM AND THE YIELDS IN PERCENTAGE OF MANNOSE CONVERTED INTO B-1,2-MANNOBIOSE. Man2 Titer % Yield (g Man2/ Strain Characteristic (mM) g Man) MDO-Teth-1788 Control strain ND.sup.1 ND MGX-Teth-1788 PTS-, no GalP; non-induced 0.21.sup.1 1.02 man B MGX1-Teth- PTS-with induced GalP, 0.59.sup.1 2.91 1788 induced manB PFKA1-Teth- PTS-with GalP; deletion of 1.8.sup.1 9.02 1788 (CS0) pfka; induced manB CS0 Δmaa-Teth- PTS-with GalP; deletion of 1.75.sup.1 8.98 1788 pfka; induced manB. Deletion of Maa CS0 maa-Teth- PTS-with GalP; deletion of 0.58.sup.2 18.22 1788 pfka; induced manB. Deletion of maa; glycerol growth CS1 Δmaa PTS-with GalP; deletion of 1.21.sup.1 58-72 ΔmanA-Teth- pfka; induced manB. 1788 Deletion of maa, Deletion of manA; glycerol growth In the Table .sup.1means growth with 10 g/L of mannose as carbon and energy source, and .sup.2means growth with 3 g/L of mannose (conversion into β-1,2-mannobiose) and 20 g/L of glycerol (carbon and energy source).
[0336] As demonstrated above, the strain according to the invention advantageously and surprisingly allows to significantly increase the production of oligosaccharides. In addition, the results obtained clearly demonstrate that the strain according to the invention allows to significantly increase the production yields of oligosaccharides and thus to optimize/reduce the production costs.
[0337] This example therefore clearly demonstrates that the strain that a strain example according to the invention advantageously allows the production of oligosaccharides. In addition, the obtained results clearly demonstrate that a strain example according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0338] This example also demonstrates that a strain example according to the invention advantageously allows a production of oligosaccharides with high production yields.
[0339] In other words, the results clearly demonstrate that strain examples according to the invention advantageously allow the synthesis of oligosaccharides and advantageously their excretions in the culture medium.
Example 4: Manufacture and Characterization of the Strain Filed with the Cncm Under Number Cncm I-5682
[0340] From the strain described in Example 3, the following modifications were provided to obtain further improved yields for the conversion of mannose into mannobiose.
[0341] In the example below, the strain filed with the CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France), under number CNCM I-5682 is also designated CS1 IG or OLI-CS1 IG or CS1 IG-galP strain.
[0342] The GalP gene is weakly expressed due to two repressors gaIR and galS. The inventors have surprisingly highlighted that it is possible to avoid the use of plasmids for the expression of the GalP gene and to stabilize the bacterial frame by increasing the expression of the GalP gene via the modification of its promoter. The region upstream of the gene (400 base pairs), which is recognized by the repressors, is substituted with a DNA fragment carrying the IHF promoter of E. coli (Zhou, K., Zhou, L., Lim, Q. 'En, Zou, R., Stephanopoulos, G., and Too, H.-P. (2011) Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR. BMC Mol Biol 12: 18 [65]).
[0343] In the present, the substitution of a DNA sequence can be carried out by any suitable process known to the person skilled in the art. It may be, for example, the Datsenko and Wanner protocol (Kirill A. Datsenko, Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences June 2000, 97 (12) 6640-6645; DOI: 10.1073/pnas.120163297 [62]).
1. Construction of the Replacement Fragment Carrying the Ihf Promoter
[0344] The first step is the assembly of the fragment intended to be integrated to the genome. The sample comprises the kanamycin-resistance gene (1500 bp) and the IHF promoter. These two fragments were individually amplified and then combined together to form the replacement fragment of 2300 bp.
[0345] A DNA fragment containing the kanamycin-resistance gene and flanked by Flippase Recognition Target (FRT) sites was amplified with the following primers:
TABLE-US-00027 fw: (SEQ ID NO: 56) 5′-GCACAATAACATCATTCTTCCTGATCACGTTTCACCGCAGATTATCA TCAAGATTGCAGCATTACACGTCTT 3′ and rev: (SEQ ID NO: 57) 5′-TGTGGGTTTCCGCGAACTGCTGCCACGGGTTAGCTTTGCACTGTTTC AGATCCATATGAATATCCTCCTTAGTTCCT 3′
[0346] The fw primer has 50 bp homology with the region immediately upstream of the sequence to be deleted. The rev primer has 20 bp homology with the 5′ end of the IHF promoter. The Phusion DNA polymerase (NEB) was used to amplify the cassette using 1 ng of pKD4 plasmid as a template, according to the manufacturer's protocol. The PCR cycles are carried out as follows:
[0347] 1 cycle of 1 min at 98° C., 5 cycles of 30 seconds at 98° C., 30 seconds at 63° C. and 1 min at 72° C., 30 cycles of 30 seconds at 98° C., 1 min at 72° C., and 1 cycle of 5 min at 72° C.
[0348] The promoter fragment was amplified with the following primers:
TABLE-US-00028 fw: (SEQ ID NO 58) 5′-AGGAACTAAGGAGGATATTCATATGGATCTGAAACAGTGCAAAGCTA ACCCGTGGCAGCAGTTCGCGGAAACCCACA 3′ and rev: (SEQ ID NO 59) 5′-AAAAACGTCATTGCCTTGTTTGACCGCCCCTGTTTTTTAGCGTCAGG CATCTCTAGGATTCCTCCGGTTCCT 3′
[0349] The FW primer (SEQ ID NO 58) has a 20 bp homology with the 3′ end of the kan cassette sequence. The rev primer (SEQ ID NO 59) has 50 bp homology with the genome region immediately upstream of the sequence to be deleted.
[0350] The phusion DNA polymerase (NEB) is used to amplify the cassette using 1 ng of pKD4 plasmid as template, according to the manufacturer's protocol. The PCR cycles are carried out as follows:
[0351] 1 cycle of 1 min at 98° C., 5 cycles of 30 seconds at 98° C., 30 seconds at 64° C. and 30 at 72° C., 30 cycles of 30 seconds at 98° C., 30 seconds at 72° C., and 1 cycle of 5 min at 72° C.
[0352] To generate the final fragment a third PCR is carried out with the with the following primers:
TABLE-US-00029 fw: (SEQ ID NO 60) 5′ GCACAATAACATCATTCTTCCTGATCACG 3′ and rev: (SEQ ID NO 61) 5′ AAAAACGTCATTGCCTTGTTTGACCG 3′
[0353] As template 1 μL of PCR1 and 1 μL of PCR2 are used. The PCR cycles are carried out as follows: 1 cycle of 1 min at 98° C., 35 cycles of 30 seconds at 98° C., 30 seconds at 65° C. and 1 min 30 seconds at 72° C., and 1 cycle 5 min at 72° C.
[0354] The PCR amplicon is gel purified and quantified. This fragment is used for the substitution of the promoter of the GalP gene.
2. Homologous Recombination
[0355] The CS1 strain was transformed with the pKD46 plasmid at 30° C. on LB agar agar supplemented with ampicillin at 50 μg/mL. The strain transformed carrying the pKD46 plasmid was cultured in 50 ml of LB medium comprising ampicillin and L-arabinose (0.2% w/v) at a temperature of 30° C. for an OD600 of 0.6 then concentrated 100 times to make it electrocompetent, washed three times with cold water containing 10% glycerol. Electroporation was carried out using a Cell-Porator with a voltage amplifier and 0.1 cm chambers according to the manufacturer's instructions, using 50 μL of cells and 200 ng of the PCR fragments obtained above.
[0356] One milliliter of SOC medium (2% tryptone; 0.5% yeast extract; 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl.sub.2, 10 mM MgSO.sub.4, and 20 mM glucose) was added to the cells having undergone this treatment, incubated for 2 hours at 37° C., then spread on a LB agar comprising kanamycin to select the strains. The introduction of the IHF promoter upstream of the GalP gene was confirmed by PCR on a colony using the following primers:
TABLE-US-00030 fw: (SEQ ID NO: 62) 5′ CAGCCTGTCTGTTCGTGCGAAAGA 3′ and rev: (SEQ ID NO: 63) 5′ TCAGAGAGGTACAGCGGTG 3′
[0357] The NEB taq DNA polymerase was used to amplify an IHF promoter and galP gene fragment using 1 μL of a cell colony dissolved in 50 μL of sterile water according to the manufacturer's instructions. The PCR amplification was carried out as follows: 1 cycle of 5 min at 95° C., 35 cycles of 30 sec at 95° C., 30 sec at 55° C. and 1.5 min at 68° C., and 1 cycle of 5 min at 68° C. Once the colonies having lost the gene were identified, the elimination of the kanamycin resistance cassette was carried out by transforming, one of the positive colonies with the pCP20 plasmid. The pCP20 plasmid is an ampicillin-resistance plasmid with temperature sensitive replication and an induction of the FLP synthesis by heat shock. The Kanamycin-resistant (KmR) mutants were transformed with the pCP20 plasmid, and the ampicillin-resistant transformants were selected at 30° C. Transformed strains were isolated on LB agar non-selectively at 43° C. and then tested for the loss of all antibiotic resistances.
3. Cloning of the Gene Encoding a β-1,2-Mannobiose Phosphorylase Enzyme in the Pbad-Hisa Plasmid (Primers and Plasmid Sequence)
[0358] The gene encoding the Lin0857 protein of the Listeria innocua (Lin0857, Genbank accession number CAC96089) belonging to the GH130 family of the CAZy classification (http://www.cazy.org/) (Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., Henrissat, B., 2014. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 42, D490-D495 [30]) has been synthesized and cloned into the pET28a vector by the TWIST Bioscience company (San Francisco, Calif. 94080, USA) with an optimization of the use of codons for an expression of the gene in E. coli. The gene encoding Lin0857 and the pBAD-Hisa plasmid were gel purified after digestion with the NcoI-HF and XhoI restriction enzymes according to the protocol of the QIAEX II Gel Extraction Kit (Hilden, Germany). The ligation of the pBAD vector and the gene encoding Lin0857 (insert) was carried out in the presence of 10 μL of vector at 8 ng/μL, 7 μL of insert at 7 ng/μL, 2 μL of DNA ligase buffer 10× and 1.5 μL of 400,000 U/mL T4 DNA ligase (New England Biolabs, Ipswich, Mass., USA). The reaction is incubated for 1 hour at room temperature then 10 min at 65° C. and 10 min in ice and 6 μL of this reaction are deposited in 50 μL of competent commercial Stellar cells (Clontech Laboratories, Mountain View, USA) for transformation. following the classic protocol for transforming chemo-competent cells (https://www.addgene.org/protocols/bacterial-transformation/[50]). The construction was monitored by sequencing from the Eurofins genomics company (Luxembourg) using the following primers: pBAD-fw: 5′-ATGCCATAGCATTTTTATCC-3′ (SEQ ID NO: 64) and pBAD-rev: 5′-GATTTAATCTGTATCAGG-3′ (SEQ ID NO: 65).
[0359] The obtained plasmid sequence corresponds to sequence SED ID NO: 55 represented in
[0360] The CS0, CS1 and CS1 IG strains were transformed according to the classic protocol for transforming chemo-competent cells (https://www.addgene.org/protocols/bacterial-transformation/[50]) with the pWKS-galP, pBAD-Teth1788 and/or pBAD-Lin0857 plasmid as indicated in Table (14) below.
TABLE-US-00031 TABLE 14 STRAINS AND CHARACTERISTICS Identifier Strain Characteristics A CS0 MDO ptsG manXYZ pfkA B CS0-galβ-Teth1788 CS0 pWKS-galP; pBAD-Teth1788 C CS1-galβ-Teth1788 CS0 ΔmaaΔmanA; pWKS-galP; pBAD- Teth1788 D CS1 IG-Teth1788 CS1 galP: Pihf; pBAD-Teth1788 E CS1-galβ-Lin0857 CS0 ΔmaaΔmanA; pWKS-galP; pBAD- Lin0857 F CS1 IG-galβ-Lin0857 CS1 galP: Pihf pWKS-galP; pBAD- Lin0857 In the table above, “Pihf” means IHF promoter
[0361] These 6 strains were placed in precultures overnight (10 to 15 hours) in LB selective medium to inoculate a second preculture (15 to 20 hours) in selective M9 medium supplemented with glycerol (10 g/L) and d-Mannose (5 g/L) as carbon source. The 6 cultures of 50 mL were inoculated with the corresponding precultures to obtain an OD.sub.600=0.15 at t=0 h in selective M9 medium supplemented with glycerol (10 g/L) and d-Mannose at 5 g/L as carbon source in 500 mL baffled Erlenmeyer flasks. The Erlenmeyer flasks were incubated for 47 h at 37° C. with orbital stirring of 220 revolutions per minute (rpm). The addition of 1-arabinose at 0.1% in the culture medium when the OD.sub.600 is ≈0.4 allows the expression of the glycoside phosphorylase gene present in the pBAD (Teth1788 or Lin0857) plasmid and the final addition of IPTG at 60 μM allows the expression of the GalP gene in cultures containing the pWKS-galP plasmid.
[0362]
[0363] Supernatant samples were withdrawn after 31 hours of culture in the 6 cultures and diluted 10 times in ultra pure water to be analyzed by HPAEC-PAD according to the protocol previously described (see section 2.3 of example 2). The titers or concentration of β-1,2-mannobiose present in the supernatants and the conversion yields of the consumed mannose converted into mannobiose were calculated and presented in Table 15 below. The concentrations (titer) are expressed in mM and the yields in percentage of mannose converted into β-1,2-mannobiose.
TABLE-US-00032 TABLE 15 PERCENTAGE OF CONSUMED MANNOSE, YIELDS AND CONCENTRATION OF B-1,2-MANNOBIOSE (MANNOBIOSE) IN THE SUPERNATANTS AFTER 31 HOURS OF CULTURES OF THE 6 STRAINS. Mannose converted Mannobiose Consumed into mannobiose concentration Strain mannose (%) (%) (g Man2/g Man) (mM) A CS0 68.5 0 0 B CS0-galβ- 91.6 9 1.22 Teth1788 C CS1-galβ- 21.7 71 2.24 Teth1788 D CS1 IG- 14.1 49 1.01 Teth1788 E CS1-galβ- 19.6 51 1.47 Lin0857 F CS1 IG-galβ- 21.0 54 1.67 Lin0857
[0364] As demonstrated in Table 15 above, the results demonstrate that the conversion yield is markedly improved with the CS1 and CS1 IG strains (>49%). This therefore clearly demonstrates that mannose is used mainly as substrate for the synthesis of mannobiose and glycerol as carbon source for the growth. These results also demonstrate that the replacement of the native promoter of galP by a constitutive strong promoter on the genome allows to obtain a high conversion yield (49%), which presents a significant advantage for the production process because this can advantageously allow to not use the plasmid containing the GalP gene and therefore the antibiotic necessary for its retention in the strain. As demonstrated, the strain comprising a constitutive promoter upstream of the GalP gene, namely the CS1 IG strain (condition F) also allows to obtain a better conversion yield and a higher mannobiose titer in the presence of the pWKS-GalP vector compared to the CS1 strain (condition E) which does not contain this promoter modification.
[0365] As demonstrated above, the strains according to the invention advantageously and surprisingly allow to significantly increase the production of oligosaccharides. In addition, the results obtained clearly demonstrate that the strain according to the invention allows to significantly increase the production yields of oligosaccharides and thus to optimize/reduce the production costs.
[0366] This example therefore clearly demonstrates that the strain that a strain example according to the invention advantageously allows the production of oligosaccharides. In addition, the obtained results clearly demonstrate that a strain example according to the invention advantageously and surprisingly and unexpectedly allows the excretion of oligosaccharides produced in the culture medium.
[0367] This example also demonstrates that a strain example according to the invention advantageously allows a production of oligosaccharides with high production yields.
LISTS OF REFERENCES
[0368] [1] Faille, C., Michalski, J. C., Strecker, G., Mackenzie, D. W., Camus, D., Poulain, D., 1990. Immunoreactivity of neoglycolipids constructed from oligomannosidic residues of the Candida albicans cell wall. Infect. Immun. 58, 3537-3544. [0369] [2] Fierfort, N., Samain, E., 2008. Genetic engineering of Escherichia coli for the economicFaille, C., Michalski, J. C., Strecker, G., Mackenzie, D. W., Camus, D., Poulain, D., 1990. Immunoreactivity of neoglycolipids constructed from oligomannosidic residues of the Candida albicans cell wall. Infect. Immun. 58, 3537-3544. [0370] [3] Fierfort, N., Samain, E., 2008. Genetic engineering of Escherichia coli for the economical production of sialylated oligosaccharides. J. Biotechnol. 134, 261-265. [0371] [4] Ishii, N., Nakahigashi, K., Baba, T., Robert, M., Soga, T., Kanai, A., Hirasawa, T., Naba, M., Hirai, K., Hoque, A., Ho, P. Y., Kakazu, Y., Sugawara, K., Igarashi, S., Harada, S., Masuda, T., Sugiyama, N., Togashi, T., Hasegawa, M., Takai, Y., Yugi, K., Arakawa, K., Iwata, N., Toya, Y., Nakayama, Y., Nishioka, T., Shimizu, K., Mori, H., Tomita, M., 2007. Multiple High-Throughput Analyses Monitor the Response of E. coli to Perturbations. Science 316, 593-597. [0372] [5] Kiefer, P., Nicolas, C., Letisse, F., Portais, J.-C., 2007. Determination of carbon labeling distribution of intracellular metabolites from single fragment ions by ion chromatography tandem mass spectrometry. Anal. Biochem. 360, 182-188. [0373] [6] Liang, Q., Zhang, F., Li, Y., Zhang, X., Li, J., Yang, P., Qi, Q., 2015. Comparison of individual component deletions in a glucose-specific phosphotransferase system revealed their different applications. Sci. Rep. 5, 13200. [0374] [7] Link, A. J., Phillips, D., Church, G. M., 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179, 6228-6237. https://doi.org/10.1128/jb.179.20.6228-6237.1997. [0375] [8] Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., Henrissat, B., 2014. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 42, D490-D495. [0376] [9] Mashego, M. R., Wu, L., Van Dam, J. C., Ras, C., Vinke, J. L., Van Winden, W. A., Van Gulik, W. M., Heijnen, J. J., 2004. MIRACLE: mass isotopomer ratio analysis of U-13C-labeled extracts. A new method for accurate quantification of changes in concentrations of intracellular metabolites. Biotechnol. Bioeng. 85, 620-628. [0377] [10] Rong Fu Wang, Kushner, S. R., 1991. Construction of versatile low-copy-number vectors for cloning, sequencing and gene expression in Escherichia coli. Gene 100, 195-199. [0378] [11] Shibata, N., Hisamichi, K., Kikuchi, T., Kobayashi, H., Okawa, Y., Suzuki, S., 1992. Sequential nuclear magnetic resonance assignment of beta.-1,2-linked mannooligosaccharides isolated from the phosphomannan of the pathogenic yeast Candida albicans NIH B-792 strain. Biochemistry 31. [0379] [12] Wu, L., Mashego, M. R., van Dam, J. C., Proell, A. M., Vinke, J. L., Ras, C., van Winden, W. A., van Gulik, W. M., Heijnen, J. J., 2005. Quantitative analysis of the microbial metabolome by isotope dilution mass spectrometry using uniformly 13C-labeled cell extracts as internal standards. Anal. Biochem. 336, 164-171. [0380] [13] Combes, Monsan, 2009. Biocatalyse ou catalyse enzymatique. Procédés chimie-bio-agro I Chimie verte, Techniques de l'ingénieur 1-18. [0381] [14] Rudroff, F., Mihovilovic, M. D., Gröger, H., Snajdrova, R., Iding, H., Bornscheuer, U. T., 2018. Opportunities and challenges for combining chemo- and biocatalysis. Nature Catalysis 1, 12-22. https://doi.org/10.1038/s41929-017-0010-4. [0382] [15] Anastas et Warner, 2000 Anastas, P. T., Warner, J. C., 2000. Green chemistry: theory and practice, 1. paperback. ed. Oxford Univ. Press, Oxford. Imeson, 2009 Hydrocolloids as thickening and gelling agents in food: a critical review, J Food Sci Technol. 2010 December; 47(6): 587-597. [0383] [16] Tathiana Souza Martins Meyer, Angelo Samir Melim Miguel, Daniel Ernesto Rodríguez Fernández and Gisela Maria Dellamora Ortiz “Biotechnological Production of Oligosaccharides—Applications in the Food Industry” Oct. 22nd 2015. [0384] [17] Rudroff et al., Rudroff, F., Mihovilovic, M. D., Gröger, H., Snajdrova, R., Iding, H., Bornscheuer, U. T., 2018. Opportunities and challenges for combining chemo- and biocatalysis. Nature Catalysis 1, 12-22. 8 Jan. 2018. [0385] [18] Ager, D., 2012. Final Analysis: Biological or Chemical Catalysis? Platinum Metals Review. Volume 56, Number 2, April 2012, pp. 140-142(3). [0386] [19] Reetz, M. T., 2013. Biocatalysis in Organic Chemistry and Biotechnology: Past, Present, and Future. Journal of the American Chemical Society 135, 12480-12496. [0387] [20] https://doi.org/10.1021/ja405051f. [0388] [21] Puchart, V., 2015. Glycoside phosphorylases: Structure, catalytic properties and biotechnological potential. Biotechnology Advances 33, 261-276. [0389] [22] Cobucci-Ponzano, B., Moracci, M., 2012. Glycosynthases as tools for the production of glycan analogs of natural products. Natural Product Reports 29, 697. March 2012. [0390] [23] WO0104341, Samain & Priem (2001) Procédé production d'oligosaccharides. [0391] [24] WO2008040717, Samain (2008) High yield production of sialic acid (Neu5ac) by fermentation. [0392] [25] Murray E. J. (éd.), Methods in Molecular Biology, Vol. 7, Gene Transfer and Expression Protocols, Humana Press (1991). [0393] [26] Johnston, Biolistic transformation: microbes to mice. Nature, 346: 776-777 (1990). [0394] [27] Brash et al., Strontium phosphate transfection of human cells in primary culture: stable expression of the simian virus 40 large-T-antigen gene in primary human bronchial epithelial cells. Mol. Cell Biol. 7: 2031-2034 (1987). [0395] [28] Quanfeng Liang, 1 Fengyu Zhang, 1 Yikui Li, 1 Xu Zhang, 1 Jiaojiao Li, 1 Peng Yang, 1 and Qingsheng Qia, 1 Comparison of individual component deletions in a glucose-specific phosphotransferase system revealed their different applications Sci Rep. 2015; 5: 13200. Published online 2015 Aug. 19. [0396] [29] Sonja Steinsiek and Katja Bettenbrock Glucose Transport in Escherichia coli Mutant Strains with Defects in Sugar Transport Systems, J Bacteriol. 2012 November; 194(21): 5897-5908. [0397] [30] Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., Henrissat, B., 2014. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 42, D490-D495. [0398] [31] https://www.addgene.org/mol-bio-reference/cloning. [0399] [32] Erju Tang, Xialin Shen, Jia Wang, Xinxiao Sun, Qipeng Yuan, “Synergetic utilization of glucose and glycerol for efficient myo-inositol biosynthesis” Biotechnology and Bioengineering 2020. [0400] [33] Constantin Ruprecht, Friedericke Bönisch, Nele Ilmbergera, Tanja V. Heyera, Erhard T. K. Haupt, Wolfgang R. Streit, Ulrich Rabausch “High level production of flavonoid rhamnosides by metagenome-derived Glycosyltransferase C in Escherichia coli utilizing dextrins of starch as a single carbon source”, Metabolic Engineering Volume 55, September 2019, Pages 212-219. [0401] [34] Tatiana Antoine, Alain Heyraud Dr., Claude Bosso Dr., Eric Samain Dr “Highly Efficient Biosynthesis of the Oligosaccharide Moiety of the GD3 Ganglioside by Using Metabolically Engineered Escherichia coli”, Angewandte Chemie, Volume117, Issue9, Feb. 18, 2005 Pages 1374-1376. [0402] [35] https://france.promega.com/products/vectors/protein-expression-vectors. [0403] [36]https://www.thermofisher.com/search/browse/category/fr/fr/85801/Bacterial %20Expres sion %20Vectors [0404] [37] WO 83/004261. [0405] [38]https://www.embl.de/pepcore/pepcore_services/strains_vectors/vectors/bacterial_expressio n_vectors/popupbacterial_expression_vectors/index.html. [0406] [39] http://babel.ucmp.umu.se/cpep/web_content/Pages/CPEP_09_vectors.html. [0407] [40]https://www.embl.de/pepcore/pepcore_services/strains_vectors/vectors/gateway_vector s/index.htm. [0408] [41] http://parts.igem.org/Promoters/Catalog/Constitutive. [0409] [42] https://biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI. [0410] [43] http://parts.igem.org/Promoters/Catalog. [0411] [44] Israel Pedruzzi, Eduardo Borges da Silva, Alírio E Rodrigues “Selection of resins, equilibrium and sorption kinetics of lactobionic acid, fructose, lactose and sorbitol” Separation and Purification Technology 2008 Volume 63, Issue 3, 3 Nov. 2008, Pages 600-611. [0412] [45] Clarisse Nobre, José A. Teixeira & LígiaR. Rodrigues (2015) “New Trends and Technological Challenges in the Industrial Production and Purification of Fructo-oligosaccharides”, Critical Reviews in Food Science and Nutrition, 55:10, 1444-1455, October 2013. [0413] [46] https://www.novasep.com/technologies/industrial-technologies-for-evaporation-concentration-and-crystallization.html. [0414] [47] https://international.neb.com/protocols/2014/05/07/double-digest-protocol-with-standard-restriction-enzymes. [0415] [48] https://international.neb.com/protocols/0001/01/01/pcr-protocol-m0530. [0416] [49] https://international.neb.com/protocols/0001/01/01/dna-ligation-with-t4-dna-ligase-m0202. [0417] [50] https://www.addgene.org/protocols/bacterial-transformation/. [0418] [51] http://tools.thermofisher.com/content/sfs/manuals/pentr_dtopo_man.pdf. [0419] [52] Karen L. Elbing Roger Brent, Recipes and Tools for Culture of Escherichia coli, Current Tools, 9 Nov. 2018. [0420] [53] Quantification of Sugar Compounds and Uronic Acids in Enzymatic Hydrolysates of Lignocellulose Using High-Performance Anion Exchange Chromatography with Pulsed Amperometric Detection Energy Fuels 2012, 26, 5, 2942-2947. [0421] [54] WO2007101862, Samain (2007) Method of producing sialylated oligosaccharides. [0422] [55] WO2007023348, SAMAIN et al. (2007) Production of globoside oligosaccharides using metabolically engineered microorganisms. [0423] [56] Fort, S., Birikaki, L., Dubois, M. P., Antoine, T., Samain, E., & Driguez, H. (2005). Biosynthesis of conjugatable saccharidic moieties of GM 2 and GM 3 gangliosides by engineered E. coli. Chemical communications, (20), 2558-2560. [0424] [57] Fierfort, N., & Samain, E. (2008). Genetic engineering of Escherichia coli for the economical production of sialylated oligosaccharides. Journal of biotechnology, 134β-4), 261-265. [0425] [58] https://www.takarabio.com/learning-centers/cloning/in-fusion-cloning-overview. [0426] [59] Nord LI, Vaag P, Duus JØ Quantification of organic and amino acids in beer by .sup.1H NMR spectroscopy Anal Chem. 2004 Aug. 15; 76(16):4790-8. [0427] [60] Gloriadel CampoIñakiBerregiRaúlCaracenaJ. IgnacioSantos “Quantitative analysis of malic and citric acids in fruit juices using proton nuclear magnetic resonance spectroscopy. [0428] [61] Chiku K, Nihira T, Suzuki E, Nishimoto M, Kitaoka M, et al. (2014) Discovery of Two b-1,2Mannoside Phosphorylases Showing Different Chain-Length Specificities from Thermoanaerobacter sp. X-514. PLoS ONE 9(12): e114882. doi:10.1371/journal.pone.0114882. [0429] [62] Kirill A. Datsenko, Barry L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences June 2000, 97 (12) 6640-6645; DOI: 10.1073/pnas.120163297 [0430] [63] Leila Lo Leggio, Florence Dal Degan, Peter Poulsen, Søren Møller Andersen, and Sine Larsen. The Structure and Specificity of Escherichia coli Maltose Acetyltransferase Give New Insight into the LacA Family of Acyltransferases. Biochemistry 2003, 42, 18, 5225-5235; DOI: 10.1021/bi0271446 [0431] [64] M Freundlich, N Ramani, E Mathew, A Sirko, P Tsui, “The role of integration host factor in gene expression in Escherichia coli” Mol Microbiol. 1992 September; 6(18):2557-63 [0432] [65] Zhou, K., Zhou, L., Lim, Q. 'En, Zou, R., Stephanopoulos, G., and Too, H.-P. (2011) Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR. BMC Mol Biol 12: 18