Metabolically engineered cells for the production of resveratrol or an oligomeric or glycosidically-bound derivative thereof

09834793 · 2017-12-05

Assignee

Inventors

Cpc classification

International classification

Abstract

A recombinant micro-organism producing resveratrol by a pathway in which phenylalanine ammonia lyase (PAL) produces trans-cinnamic acid from phenylalanine, cinnamate 4-hydroxylase (C4H) produces 4-coumaric acid from said trans-cinnamic acid, 4-coumarate-CoA ligase (4CL) produces 4-coumaroyl CoA from said 4-coumaric acid, and resveratrol synthase (VST) produces said resveratrol from said 4-coumaroyl CoA, or in which L-phenylalanine- or tyrosine-ammonia lyase (PAL/TAL) produces 4-coumaric acid, 4-coumarate-CoA ligase (4CL) produces 4-coumaroyl CoA from said 4-coumaric acid, and resveratrol synthase (VST) produces said resveratrol from said 4-coumaroyl CoA. The micro-organism may be a yeast, fungus or bacterium including Saccharomyces cerevisiae, E. coli, Lactococcus lactis, Aspergillus niger, or Aspergillus oryzae.

Claims

1. A genetically engineered micro-organism comprising an engineered operative metabolic pathway producing at least 0.44 to 0.53 micrograms of resveratrol per gram on a dry weight basis of the genetically engineered micro-organism when cultured for a time and under conditions wherein the micro-organism produces resveratrol, wherein the engineered operative metabolic pathway produces: a) 4-coumaric acid from L-phenylalanine catalysed by a phenylalanine ammonia lyase and a cinnamate 4-hydroxylase expressed in the micro-organism or from tyrosine catalysed by a phenylalanine ammonia lyase or a tyrosine ammonia lyase expressed in said micro-organism; b) 4-coumaroyl-CoA from 4-coumaric acid catalysed by a 4-coumarate-CoA ligase expressed in the micro-organism; and c) resveratrol is produced from the 4-coumaroyl-CoA by a resveratrol synthase expressed in the micro-organism; wherein the micro-organism is Saccharomyces cerevisiae that is cultured in a media with a carbon substrate and does not require an external source of phenylalanine, tyrosine, cinnamic acid or coumaric acid, and further comprises a more than a native expression level of an acetyl coenzymeA carboxylase (ACC1) enzyme.

2. The micro-organism of claim 1, wherein the more than native expression level of the ACC1 enzyme has been provided by replacing a native promoter of a gene expressing the ACC1 enzyme with a promoter providing a higher level of expression.

3. The micro-organism of claim 2, wherein the native promoter is replaced with a strong constitutive yeast promoter.

4. The micro-organism of claim 3, wherein the strong constitutive promoter is a yeast promoter selected from the promoters for yeast genes: triosephoshosphate dehydrogenase 3 (TDH3), alcohol dehydrogenase 1 (ADH1), triose phosphate isomerase 1 (TPI1) 1 actin (ACTT), glyceraldehyde-3-phosphate dehydrogenase (GPD) and phosphoglucose isomerase (PGI).

5. The micro-organism of claim 1, wherein the more than native expression level of the ACC1 enzyme has been provided by recombinantly introducing into the micro-organism at least one copy of an exogenous genetic sequence encoding the ACC1 enzyme.

6. The micro-organism of claim 1, wherein the ACC1 enzyme is from Saccharomyces cerevisiae.

7. The micro-organism of claim 1, further comprising a more than a native expression level of a NADPH:cytochrome P450 reductase (CPR) enzyme.

8. The micro-organism of claim 7, wherein the more than native expression level of the CPR enzyme has been provided by replacing a native promoter of a gene expressing the CPR enzyme with a promoter providing a higher level of expression.

9. The micro-organism of claim 8, wherein the native promoter is replaced with a strong constitutive yeast promoter.

10. The micro-organism of claim 9, wherein the strong constitutive promoter is a yeast promoter selected from the promoters for yeast genes: triosephoshosphate dehydrogenase 3 (TDH3), alcohol dehydrogenase 1 (ADH1), triose phosphate isomerase 1 (TPI1) 1 actin (ACTT), glyceraldehyde-3-phosphate dehydrogenase (GPD) and phosphoglucose isomerase (PGI).

11. The micro-organism of claim 7, wherein the more than native expression level of the CPR enzyme has been provided by recombinantly introducing into the micro-organism at least one copy of an exogenous genetic sequence encoding the CPR enzyme.

12. The micro-organism of claim 7, wherein the CPR enzyme is from Saccharomyces cerevisiae.

13. The micro-organism of claim 1, wherein the micro-organism produces at least 1.83 milligrams of pinosylvin per gram on a dry weight basis.

14. A method for producing resveratrol or an oligomeric or glycosidically-bound derivative thereof, comprising: a) cultivating the genetically engineered micro-organism of claim 1; and b) recovering the resveratrol, or the oligomeric or glycosidically-bound derivative thereof, from the culture media.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) To assist in the ready understanding of the above description of the invention reference has been made to the accompanying drawings in which:

(2) FIG. 1 shows the chemical structure of trans-resveratrol;

(3) FIG. 2 shows the phenylpropanoid pathway utilising phenylalanine ammonia lyase acting on L-phenylalanine; and

(4) FIG. 3 shows the alternative pathway utilising phenylalanine ammonia lyase acting on L-tyrosine.

(5) FIG. 4 shows the HPLC-chromatograms of extracts of S. cerevisiae strains FSSC-PALC4H4CLVST, FSSC-TAL4CLVST, grown on 100 g/l galactose. A chromatogram of 60 nanogram of pure resveratrol is included.

(6) FIG. 5 shows the UV absorption spectrum for pure trans-resveratrol and trans-resveratrol produced by S. cerevisiae strain FSSC-PALC4H4CLVST, grown on 100 g/l galactose.

(7) FIG. 6 shows the HPLC-chromatograms of extracts from E. coli strains FSEC-TAL4CLVST and FSEC-control, grown on 50 g/l glucose.

(8) FIG. 7 shows the HPLC-chromatograms of extracts from E. coli strains FSEC-TAL4CLVST and FSEC-control, grown on 50 g/l glucose with addition of 20 mg/l coumaric acid. The UV absorption spectrum for trans-resveratrol produced in strain FSEC-TAL4CLVST is included.

(9) The invention will be further described and illustrated by the following non-limiting examples.

EXAMPLES

Example 1

Isolation of Genes Encoding PAL, TAL, C4H, CPR, 4CL, and VST

(10) Phenylalanine ammonia lyase (PAL2) (Cochrane et al., 2004; SEQ ID NO: 1, 2), cinnamate 4-hydroxylase (C4H) (Mizutani et al., 1997; SEQ ID NO: 3, 4) and 4-coumarate:CoenzymeA ligase (4CL1) (Hamberger and Hahlbrock 2004; Ehlting et al., 1999; SEQ ID NO: 5, 6) were isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the primers in table 1. PAL2 and 4CL1 were chosen amongst several A. thaliana homologues due to favourable kinetic parameters towards cinnamic acid and coumaroyl-CoA, respectively (Cochrane et al., 2004; Hamberger and Hahlbrock 2004; Ehlting et al., 1999).

(11) The coding sequence of resveratrol synthase (VST) from Rheum tataricum (Samappito et al., 2003; SEQ ID NO: 7, 8) and tyrosine ammonia lyase (TAL) from Rhodobacter capsulatus (Kyndt et al., 2002; SEQ ID NO: 11, 12) were codon optimized for expression in S. cerevisiae using the online service backtranslation tool at www.entelechon.com, yielding sequence SEQ ID NO: 9, 10 and SEQ ID NO: 13, 14 respectively. Oligos for the synthetic gene assembly were constructed at MWG Biotech and the synthetic gene was assembled by PCR using a slightly modified method protocol of from Martin et al. (2003) described below.

(12) TABLE-US-00001 TABLE 1 Primers and restriction sites for the amplification of genes Primer for amplification of gene* Restriction Restriction (Restriction sites are underlined) Gene site: primer site: vector 5′-CGGAATTCTCATGGATCAAATCGAAGCAATGTT PAL2 EcoRl EcoR1 5′-CGACTAGTTTAGCAAATCGGAATCGGAGC PAL2 Spe1 Spe1 5′-CGCTCGAGAT ATGGACCTCCTCTTGCTGGA C4H Xhol Xho1 5′-CGGGTACCTTAACAGTTCCTTGGTTTCATAAC C4H Kpn1 Kpn1 5′-GCTCTAGACCT ATGGCGCCACAAGAACAAGCAGTTT  4CL1 Xba1 Spe1 5′-GCGGATCCCCT TCACAATCCATTTGCTAGTTT TGCC 4CL1 BamH1 BglII 5′-CC GGATCCAAATGGCCCCAGAAGAGAGCAGG VST BamH1 BamH1 5′-CG CTCGAGTTAAGTGATCAATGGAACCGAAGACAG VST Xhol Xho1 5′-CCGAATTCCCATGACCCTGCAATCTCAAACAGCTAAAG TAL EcoR1 EcoRl 5′-CCACTAGTTTAAGCAGGTGGATCGGCAGCT TAL Spel Spe1 5′-CCCTCGAGATCATGCCGTTTGGAATAGACAACACCGA  CPR1 Xho1 Xho1 5′-CCAAGCTTATCGGGCTGATTACCAGACATCTTCTTG CPR1 HindIII HindIII 5′-CCGGATCCCCATGTCCTCTTCTTCTTCTTCGTCAAC AR2 Bamh1 Bamh1 5′-CCCTCGAGGTGAGTGTGTGGCTTCAATAGTTT CG AR2 Xho1 Xho1 *SEQ ID Nos 19-32

(13) Primers from MWG for the assembly of the synthetic gene were dissolved in milliQ-water to a concentration of 100 pmole/μl. An aliquot of 5 μl of each primer was combined in a totalmix and then diluted 10-fold with milliQ water. The gene was assembled via PCR using 5 μl diluted totalmix per 50 μl as template for fusion DNA polymerase (Finnzymes). The PCR programme was as follows: Initial 98° C. for 30 s., and then 30 cycles with 98° C. for 10 s., 40° C. for 1 min. and 72° C. at 1 min./1000 basepairs, and a final 72° C. for 5 min. From the resulting PCR reaction, 20 μl was purified on 1% agarose gel. The result was a PCR smear and the regions around the wanted size were cut out from agarose gel and purified using the QiaQuick Gel Extraction Kit (Qiagen). A final PCR with the outer primers (for TAL and VST) in table 1 rendered the required TAL and VST genes. Point mutations were corrected using either the Quickchange site directed mutagenesis II kit (Stratagene, La Jolla, Calif.), or using PCR from overlapping error free DNA stretches from several different E. coli subclones.

(14) NADPH:Cytochrome P450 reductase (CPR) from A. thaliana (AR2) (Mizutani and Ohta, 1998; SEQ ID NO: 17, 18) and from S. cerevisiae (CPR1) (Aoyama et al., 1978; SEQ ID NO: 15, 16), were isolated from A. thaliana cDNA (BioCat, Heidelberg, Germany) and S. cerevisae genomic DNA, respectively, using the primers in table 1.

Example 2

Construction of a Yeast Vector for Expression of PAL

(15) The gene encoding PAL, isolated as described in example 1, was reamplified by PCR using forward- and reverse primers, with 5′ overhangs containing EcoR1 and Spe1 restriction sites (table 1). The amplified PAL PCR product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-URA vector (Stratagene), resulting in vector pESC-URA-PAL. The sequence of the gene was verified by sequencing of two different clones.

Example 3

Construction of a Yeast Vector for Expression of PAL and C4H

(16) The gene encoding C4H, isolated as described in example 1, was amplified by PCR using the forward- and reverse primers, with 5′ overhangs containing Xho1 and Kpn1 restriction sites. The amplified C4H PCR-product was digested with Xho1/Kpn1 and ligated into similarly digested pESC-URA-PAL vector. The resulting plasmid, pESC-URA-PAL-C4H, contained the genes encoding PAL and C4H under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding C4H was verified by sequencing of two different clones.

Example 4

Construction of a Yeast Vector for Expression of 4CL

(17) The gene encoding 4CL was isolated as described in example 1. The amplified 4CL PCR-product was digested with Xba1/BamH1 and ligated into Spe1/BglII digested pESC-TRP vector (Stratagene), resulting in vector pESC-TRP-4CL. Two different clones of pESC-TRP-4CL were sequenced to verify the sequence of the cloned gene.

Example 5

Construction of a Yeast Vector for Expression of 4CL and VST

(18) The gene encoding VST was isolated as described in example 1. The amplified synthetic VST gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-TRP-4CL (example 4). The resulting plasmid, pESC-TRP-4CL-VST, contained the genes encoding 4CL and VST under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding VST was verified by sequencing of two different clones of pESC-TRP-4CL-VST.

Example 6

Construction of a Yeast Vector for Expression of TAL

(19) The gene encoding TAL was isolated as described in example 1. The amplified synthetic TAL gene was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1-digested pESC-URA vector. The resulting plasmid, pESC-URA-TAL, contained the gene encoding for TAL under the control of the divergent GAL1/GAL10 promoter. The sequence was verified by sequencing of two different clones of pESC-URA-TAL.

Example 7

Construction of a Yeast Vector for Overexpression of S. cerevisiae Endogenous CPR

(20) The gene encoding CPR from S. cerevisiae (CPR1) was isolated as described in example 1. The amplified CPR1 gene was digested with Xho1/HindIII and ligated into Xho1/HindIII-digested pESC-LEU vector (Stratagene), resulting in vector pESC-LEU-CPR1. The sequence was verified by sequencing of two different clones of pESC-LEU-CPR1.

Example 8

Construction of a Yeast Vector for Overexpression of A. thaliana CPR (AR2)

(21) The gene encoding CPR from A. thaliana (AR2) was isolated as described in example 1. The amplified AR2 gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-LEU vector (Stratagene), resulting in vector pESC-LEU-AR2.

(22) The sequence was verified by sequencing of two different clones of pESC-LEU-AR2.

Example 9

Expression of the Pathway to Resveratrol in the Yeast S. cerevisiae Using PAL, C4H, 4CL and VST

(23) Yeast strains containing the appropriate genetic markers were transformed with the vectors described in examples 2, 3, 4, 5, 6, 7 and 8, separately or in combination. The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). Transformants were selected on medium lacking uracil and/or tryptophan and streak purified on the same medium.

(24) S. cerevisiae strain CEN.PK 113-5D (MATa ura3) was transformed separately with the vector pESC-URA-PAL (example 2), yielding the strain FSSC-PAL, and with pESC-URA-PAL-C4H (example 3), resulting in the strain FSSC-PALC4H. S. cerevisiae strain FS01267 (MATa trp1 ura3) was co-transformed with pESC-URA-PAL-C4H and pESC-TRP-4CL (example 4), and the transformed strain was named FSSC-PALC4H4CL. The same strain was also co-transformed with pESC-URA-PAL-C4H and pESC-TRP-4CL-VST (example 5), resulting in the strain FSSC-PALC4H4CLVST.

Example 10

Expression of the Pathway to Resveratrol in S. cerevisiae Using TAL, 4CL and VST

(25) S. cerevisiae strain CEN.PK 113-5D (MATa ura3) was transformed separately with the vector pESC-URA-TAL (example 6), yielding the strain FSSC-TAL. S. cerevisiae strain FS01267 (MATa trp1 ura3) was co-transformed with pESC-URA-TAL (example 6) and pESC-TRP-4CL (example 4), and the transformed strain was named FSSC-TAL4CL. The same strain was also co-transformed with pESC-URA-TAL and pESC-TRP-4CL-VST (example 5), resulting in the strain FSSC-TAL4CLVST. Transformants were selected on medium lacking uracil and or tryptophan and streak purified on the same medium.

Example 11

Expression of the Pathway to Resveratrol in S. Cerevisiae with Overexpressed Endogenous CPR

(26) S. cerevisiae strain FS01277 (MATa ura3 leu2 trp1) was co-transformed with vectors pESC-URA-PAL-C4H (example 3), pESC-TRP-4CL (example 4), and pESC-LEU-CPR1 (example 7). The transformed strain was named FSSC-PALC4H4CLVSTCPR. Transformants were selected on medium lacking uracil and/or tryptophan and streak purified on the same medium.

Example 12

Expression of the Pathway to Resveratrol in S. cerevisiae with Overexpressed A. thaliana CPR (AR2)

(27) S. cerevisiae strain FS01277 (MATa ura3 leu2 trp1) was co-transformed with vectors pESC-URA-PAL-C4H (example 3), pESC-TRP-4CL (example 4), and pESC-LEU-AR2 (example 8). The transformed strain was named FSSC-PALC4H4CLVSTAR2. Transformants were selected on medium lacking uracil and or tryptophan and streak purified on the same medium.

Example 13

Fermentation with Recombinant Yeast Strains in Shake Flasks

(28) The recombinant yeast strains were inoculated from agar plates with a sterile inoculation loop and grown in 200 ml defined mineral medium (Verduyn et al, 1992) that contained vitamins, trace elements, 5 g/l glucose and 40 g/l or 100 g/l galactose. The 500 ml stoppered shake flasks were incubated for three days at 30° C. and 160 rpm.

Example 14

Extraction of Resveratrol

(29) Cells were harvested by centrifugation 5000 g for 5 minutes. An aliquot of 50 ml of supernatant was extracted once with 20 ml ethyl acetate. The ethyl acetate was freeze dried and the dry product redissolved in 0.7 ml methanol and filtered into HPLC vials.

(30) The cell pellet from 200 ml medium was dissolved in 1 to 2 ml water and divided into 3 fastprep tubes and broken with glass beads. The crude extracts from the three tubes were pooled into 10 ml 100% methanol in a 50 ml sartorius tube and extracted on a rotary chamber for 48 hours in a dark cold room at 4° C. After 48 hours the cell debris was removed via centrifugation for 5 min. at 5000 g and the methanol was removed by freeze-drying overnight. The dried residue was redissolved in 1 ml phosphate-citrate buffer pH 5.4 and 10 units beta-glucosidase from almonds was added (Sigma) to release resveratrol from putatively glucoside-bound forms. The mixture was incubated for three hours at 37° C. and then extracted twice with 1 ml ethyl acetate. The combined ethyl acetate was freeze dried and the dry residue was redissolved in 0.7 ml methanol and filtered into HPLC vials.

Example 15

Analysis of Resveratrol

(31) Thin Layer Chromatography

(32) A method based upon thin layer chromatography that enabled the quick separation of cinnamic, coumaric and resveratrol on the same TLC-plate was developed for quick screening analysis. An aliquot of 1 ml culture containing both cells and supernatant were extracted with 500 microliter ethyl acetate and centrifuged for 30 s. at 13000 rpm with a microcentrifuge. The ethyl acetate was dried and redissolved in methanol. The extracts were analyzed on Silica G plates (0.2 mm Alugram SIL G/UV.sub.254, Macherey-Nagel) containing a fluorescent indicator. The mobile phase was a mixture of chloroform, ethyl acetate and formic acid (25:10:1).

(33) HPLC

(34) For quantitative analysis of cinnamic acid, coumaric acid, and resveratrol, samples were subjected to separation by high-performance liquid chromatography (HPLC) Agilent Series 1100 system (Hewlett Packard) prior to uv-diode-array detection at λ=306 nm. A Phenomenex (Torrance, Calif., USA) Luna 3 micrometer C18 (100×2.00 mm) column was used at 40° C. As mobile phase a gradient of acetonitrile and milliq water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.4 ml/min. The gradient profile was linear from 15% acetonitrile to 100% acetonitrile over 20 min. The elution times were approximately 3.4 min. for coumaric acid, 5.5 min. for free trans-resveratrol and 6.8 min. for cinnamic acid.

(35) Pure resveratrol standard was purchased from Cayman chemical company, whereas pure coumaric acid and cinnamic acid standards were purchased from and Sigma.

(36) Results

(37) Strains FSSC-PALC4H4CLVST and FSSC-TAL4CLVST, were cultivated on 100 g/l galactose as described in example 13, and analyzed for their content of intracellular resveratrol according to example 14 and 15. Additionally, a control strain FSSC-control was included that contained the empty vectors pESC-URA and pESC-TRP only. The HPLC-analysis showed that strains FSSC-PALC4H4CLVST and FSSC-TAL4CLVST contained a component with a retention time of 5.5 min. that was identical to trans-resveratrol (FIG. 4). Said result was confirmed by the UV absorption spectra that were similar to the absorption spectrum of pure trans-resveratrol (FIG. 5) as well, with a λ.sub.max of approximately 306 nm.

(38) The results, therefore, demonstrated the presence of an active phenyl-propanoid pathway in S. cerevisiae that led to in vivo production of trans-resveratrol. The production of resveratrol can most likely be improved by cultivating the strains under well-defined growth conditions in batch- and continuous cultures, and/or optimizing the expression/activities of the individual enzymes.

Example 16

Construction of a Bacterial Vector for Expression of TAL in Escherichia coli

(39) The gene encoding TAL, isolated as described in Example 1, was reamplified by PCR from the plasmid pESC-URA-TAL (example 6) using the forward primer 5′-CCG CTCGAG CGG ATG ACC CTG CAA TCT CAA ACA GCT AAA G-3′ SEQ ID NO 33 and the reverse primer 5′-GC GGATCC TTA AGC AGG TGG ATC GGC AGC T-3′ SEQ ID NO 34 with 5′ overhangs containing the restriction sites XhoI and BamHI, respectively. The introduction of restriction sites at the 5′ and 3′ ends of the gene allowed ligation of the restricted PCR product into a pET16b vector (Novagen), digested with XhoI and BamHI to yield pET16b-TAL. The pET16b vector contained both the ampicillin resistance gene, and the T7 promoter. Hence, above procedure resulted in a vector with an antibiotic selection marker that contained the gene encoding for TAL under the control of the T7 promoter. The sequence of the gene encoding TAL was verified by sequencing of one clone of pET16b-TAL.

Example 17

Construction of a Bacterial Vector for Expression of 4CL and VST in Escherichia coli

(40) The gene encoding VST, isolated as described in example 1, was cut out with the restriction enzymes BamHI and XhoI from the digested plasmid pESC-TRP-4CL-VST (example 5), which contains the genes encoding 4CL and VST. The VST gene was ligated into a pET26b vector (Novagen), containing the kanamycin resistance gene, digested with BamHI and SalI to yield pET26b-VST. The restriction enzymes XhoI and SalI have compatible ends, which enabled proper ligation. The pET26b vector contained both the kanamycin resistance gene, and the T7 promoter. Hence, above procedure resulted in a vector with an antibiotic selection marker that contained the gene encoding for VST under the control of the T7 promoter. The gene encoding for 4CL, isolated as described in example 1, was reamplified by PCR from the plasmid pESC-URA-4CL-VST (example 5) using the forward primer 5′-TG CCATGG CA ATGGCGCCAC AAGAACAAGC AGTTT-3′ SEQ ID NO 35 and the reverse primer 5′-GC GGATCC CCT TCA CAA TCC ATT TGC TAG TTT TGCC-3′ SEQ ID NO 36 with 5′ overhangs containing the restriction sites NcoI and BamHI, respectively. The introduction of restriction sites at the 5′ and 3′ ends of the gene allowed ligation of the restricted PCR product into a pET16b vector (Novagen) digested with NcoI and BamHI. The resulting plasmid, pET16b-4CL, contained the gene encoding for 4CL under the control of the T7 promoter. Both the T7 promoter and the gene encoding for 4CL were reamplified as one fragment by PCR from the plasmid pET16b-4CL using the forward primer 5′-TT GCGGCCGC AAA TCT CGA TCC CGC GAA ATT AAT ACG-3′ SEQ ID NO 37 and the reverse primer 5′-CG CTCGAG CCT TCA CAA TCC ATT TGC TAG TTT TGCC-3′ SEQ ID NO 38 with 5′ overhangs, containing the restriction sites NotI and XhoI, respectively. The introduction of restriction sites at the 5′ and 3′ ends of the DNA fragment allowed ligation of the restricted PCR product into the plasmid pET26b-VST that was digested with NotI and XhoI before ligation. The resulting plasmid, pET26b-VST-4CL, contained the two genes 4CL and VST that each were under control of an individual T7 promoter.

Example 18

Expression of the Pathway to Resveratrol in Escherichia Coli, Using TAL, 4CL and VST

(41) The transformation of the bacterial cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). The E. coli strain BL21 (DE3) (Novagen) was co-transformed with the two vectors pET16b-TAL (example 16) and pET26b-VST-4CL (Example 17), resulting in strain FSEC-TAL4CLVST. In addition, E. coli strain BL21 (DE3) was co-transformed with the two empty vectors pET16b (Novagen) and pET26b (Novagen), resulting in strain FSEC-control, which was used as a control strain. Transformants were selected on Luria-Bertani (LB) medium with 100 μg/ml ampicillin and 60 μg/ml kanamycin.

Example 19

Fermentation with Recombinant Escherichia coli Strains in Shake Flasks

(42) Pre-cultures of Escherichia coli BL21 (DE3) were grown in glass tubes at 160 rpm and 37° C. in 7 ml of LB medium containing 100 μg/ml ampicillin and 60 μg/ml kanamycin. Exponentially growing precultures were used for inoculation of 500 ml baffled shake flasks that contained 200 ml LB medium supplemented with 50 g/l glucose, 5 g/l K.sub.2HPO.sub.4, 80 μg/ml ampicilin and 50 μg/ml kanamycin, which were incubated at 160 rpm and 37° C. After 5 hours, isopropyl β-thiogalactopyranoside (IPTG) was added at a final concentration of 1 mM, as an inducer of the T7 promoter that was in front of each of the three genes TAL, 4CL and VST. After an incubation period of 48 hours at 37° C., the cells were harvested and subjected to extraction procedures and analysed for the presence of produced resveratrol.

Example 20

Extraction and Analysis of Resveratrol in Escherichia coli

(43) Extraction and analysis was performed using the methods as described in example 14 and 15.

(44) Results

(45) Strain FSEC-TAL4CLVST and FSEC-control, were cultivated on 50 g/l glucose as described in example 19, and analyzed for their content of intracellular resveratrol according to example 14 and 15. The HPLC-analysis showed that strain FSEC-TAL4CLVST did contain considerable amounts of a component with a retention time of 3.4 min., which is identical to coumaric acid (FIG. 6). However, the extract did not contain a component that eluted at the same time as trans-resveratrol. Said result, therefore, indicated that the tyrosine ammonia lyase (TAL) was active indeed, but did not lead to production of detectable amounts of resveratrol. The lack of resveratrol formation, however, could be the result of; i) a non-functional coumarate-CoA ligase (4CL); ii) a non-functional resveratrol synthase (VST); iii) too low levels of coumaric acid, caused by either non-optimal cultivation conditions, or non-optimal expression/activity of TAL, or branching of coumaric acid into other products. To evaluate said hypotheses, the strains were grown on similar media as described in example 19 but now in the presence of 20 mg/l of coumaric acid. The subsequent HPLC-analysis of extracts of FSEC-TAL4CLVST indeed showed a cluster of peaks around the same retention time as trans-resveratrol, which was not observed in extracts of FS-control (FIG. 6). Indeed, the UV absorption spectrum of the peak with a retention time of 5.5 min. was similar to the spectrum of pure trans-resveratrol (FIG. 7), whereas no such spectrum could be obtained for peaks in the control strain. The results, therefore, strongly suggest the presence of an active phenylpropanoid pathway in Escherichia coli, which can lead to production of resveratrol. Most likely the production of resveratrol without addition of coumaric acid can be achieved by cultivating the strains under well-defined growth conditions in batch- and continuous cultures, and/or optimizing the expression/activities of the individual enzymes.

Example 21

Construction of a Bacterial Vector for Expression of PAL and C4H in Lactococcus lactis

(46) The plasmid pSH71 and derivatives thereof, which is used in the following examples, is a bifunctional shuttle vector with multiple origins of replication from Escherichia coli and Lactococcus lactis. With that, the host range specificity traverses Escherichia coli and other species of lactic acid bacteria. Though transformations in Lactococcus lactis usually proceed without problems, putative difficult transformations in other species of lactic acid bacteria can, therefore, be overcome by using Escherichia coli as an intermediate host for the construction of recombinant plasmids. The plasmid contains one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system that is used for Lactococcus lactis is based upon dominant markers, e.g. resistance against erythromycin and chloramphenicol, but systems based upon genes involved in carbohydrate metabolism, peptidases and food grade markers, have also been described. In addition, the plasmid contains promoter- and terminator sequences that allow the expression of the recombinant genes. Suitable promoters are taken from genes of Lactococcus lactis e.g. lacA. Furthermore, the plasmid contains suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants.

(47) In the examples below the plasmid contains either the erythromycine resistance gene, designated as pSH71-ERY.sup.r, or the chloramphenicol resistance gene, designated as pSH71-CM.sup.r

(48) The gene encoding PAL, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-PAL-C4H (example 3), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-ERY.sup.r vector that contains the lacA promoter from Lactococcus lactis. The resulting plasmid, pSH71-ERY.sup.r-PAL, contains the gene encoding PAL under the control of the lacA promoter from Lactococcus lactis. The gene encoding C4H, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-PAL-C4H (example 3) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-CM.sup.r vector to yield pSH71-CM.sup.r-C4H. The lacA promoter and the gene encoding C4H are reamplified as one fragment by PCR from the plasmid pSH71-CM.sup.r-C4H using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allows ligation of the restricted PCR product into the digested plasmid pSH71-ERY.sup.r-PAL. The resulting plasmid, pSH71-ERY.sup.r-PAL-C4H, contains the genes encoding PAL and C4H that are each under the control of an individual lacA promoter. The sequence of the genes encoding PAL and C4H is verified by sequencing of two different clones of pSH71-ERY.sup.r-PAL-C4H.

Example 22

Construction of a Bacterial Vector for Expression of TAL in Lactococcus lactis

(49) The gene encoding for TAL, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-TAL (example 6) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-ERY.sup.r vector. The resulting plasmid, pSH71-ERY.sup.r-TAL, contains the gene encoding for TAL under the control of the lacA promoter from Lactococcus lactis. The sequence of the gene encoding for TAL is verified by sequencing of two different clones of pSH71-ERY.sup.r-TAL.

Example 23

Construction of a Bacterial Vector for Expression of 4CL and VST in Lactococcus lactis

(50) The gene encoding 4CL, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL-VST (example 5), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-CM.sup.r vector. The resulting plasmid, pSH71-CM.sup.r-4CL, contains the gene encoding for 4CL under the control of the lacA promoter from Lactobacillus lactis. The gene encoding VST, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL-VST (example 5) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-ERY.sup.r vector. The resulting plasmid, pSH71-ERY.sup.r-VST, contains the gene encoding VST under the control of the lacA promoter from Lactococcus lactis. The lacA promoter and the gene encoding VST are reamplified as one fragment by PCR from the plasmid pSH71-ERY.sup.r-VST using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allows ligation of the restricted PCR product into the digested plasmid pSH71-CM.sup.r-4CL. The resulting plasmid, pSH71-CM.sup.r-4CL-VST, contains the genes encoding 4CL and VST that are each under the control of their individual lacA promoter.

(51) The sequence of the genes encoding 4CL and VST is verified by sequencing of two different clones of pSH71-CM.sup.r-4CL-VST.

Example 24

Expression of the Pathway to Resveratrol in Lactococcus lactis

(52) Lactococcus lactis strains are transformed with the vectors described in examples 21, 22 and 23, separately or in combination. The transformation of the bacterial cell is conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). Transformants are selected on medium containing the antibiotics erythromycin and chloramphenicol and streak purified on the same medium.

(53) Lactococcus lactis strain MG1363 is transformed separately with the vector pSH71-ERY.sup.r-TAL (example 22), yielding the strain FSLL-TAL; with pSH71-ERY.sup.r-PAL-C4H (example 21), yielding the strain FSLL-PALC4H and with pSH71-CM.sup.r-4CL-VST (example 23), yielding strain FSLL-4CLVST. In addition, Lactococcus lactis strain MG1363 is co-transformed with pSH71-ERY.sup.r-TAL (example 22) and pSH71-CM.sup.r-4CL-VST (example 23), and the transformed strain is named FSLL-TAL4CLVST. The same strain is also co-transformed with pSH71-ERY.sup.r-PAL-C4H (example 21), and pSH71-CM.sup.r-4CL-VST (example 23), resulting in the strain FSLL-PALC4H4CLVST.

Example 25

Fermentation with Recombinant Lactococcus lactis Strains in Fermentors

(54) The recombinant yeast strains can be grown in fermenters operated as batch, fed-batch or chemostat cultures.

(55) Batch and Fed-Batch Cultivations

(56) The microorganism is grown in a baffled bioreactor with a working volume of 1.5 liters under anaerobic, aerobic or microaerobic conditions. All cultures are incubated at 30° C., at 350 rpm. A constant pH of 6.6 is maintained by automatic addition of 10 M KOH. Cells are grown on lactose in defined MS10 medium supplemented with the following components to allow growth under aerobic conditions: MnSO.sub.4 (1.25×10.sup.−5 g/l), thiamine (1 mg/l), and DL-6,8-thioctic acid (2.5 mg/l). The lactose concentration is, for example 50 g/l. The bioreactors are inoculated with cells from precultures grown at 30° C. in shake flasks on the medium described above buffered with threefold-higher concentrations of K.sub.2HPO.sub.4 and KH.sub.2PO.sub.4. Anaerobic conditions are ensured by flushing the medium with N.sub.2 (99.998% pure) prior to inoculation and by maintaining a constant flow of 50 ml/min of N.sub.2 through the headspace of the bioreactor during cultivation. The bioreactors used for microaerobic and aerobic cultivation are equipped with polarographic oxygen sensors that are calibrated with air (DOT, 100%) and N.sub.2 (DOT, 0%). Aerobic conditions are obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the DOT is more than 80%. During microaerobic experiments the DOT is kept constant 5% by sparging the reactor with gas composed of a mixture of N.sub.2 and atmospheric air, at a rate of 0.25 vvm.

(57) Chemostat Cultures

(58) In chemostat cultures the cells can be grown in, for example, 1-L working-volume Applikon laboratory fermentors at 30° C. and 350 rpm. The dilution rate (D) can be set at different values, e.g. at 0.050 h.sup.−1, 0.10 h.sup.−1, 0.15 h.sup.−1, or 0.20 h.sup.−1. The pH is kept constant, e.g at 6.6, by automatic addition of 5 M KOH, using the growth medium described above, supplemented with antifoam (50 μl/l). The concentration of lactose can be set at different values, e.g. is 3.0 g/l 6.0 g/l, 12.0 g/l, 15.0 g/l or 18.0 g/l. The bioreactor is inoculated to an initial biomass concentration of 1 mg/l and the feed pump is turned on at the end of the exponential growth phase.

(59) An anaerobic steady state is obtained by introducing 50 ml/min of N.sub.2 (99.998% pure) into the headspace of the bioreactor. Different anoxic steady states can obtained by sparging the reactor with 250 ml/min of gas composed of N.sub.2 (99.998% pure) and atmospheric air at various ratios. The oxygen electrode is calibrated by sparging the bioreactor with air (100% DOT) and with N.sub.2 (0% DOT).

(60) For all conditions, the gas is sterile filtered before being introduced into the bioreactor. The off gas is led through a condenser cooled to lower than −8° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser.

(61) Cultivations are considered to be in steady state after at least 5 residence times, and if the concentrations of biomass and fermentation end products remain unchanged (less than 5% relative deviation) over the last two residence times.

Example 26

Extraction and Analysis of Resveratrol in Lactococcus lactis

(62) Extraction and analysis is performed using the methods as described in examples 14 and 15.

Example 27

Construction of a Fungal Vector for Expression of PAL and C4H in Species Belonging to the Genus Aspergillus

(63) The plasmid that is used in the following examples, is derived from pARp1 that contains the AMA1 initiating replication sequence from Aspergillus nidulans, which also sustains autonomous plasmid replication in A. niger and A. oryzae (Gems et al., 1991). Moreover, the plasmid is a shuttle vector, containing the replication sequence of Escherichia coli, and the inherent difficult transformations in Aspergillus niger and Aspergillus oryzae can therefore overcome by using Escherichia coli as an intermediate host for the construction of recombinant plasmids. The plasmid contains one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system can be either based upon dominant markers e.g. resistance against hygromycin B, phleomycin and bleomycin, or heterologous markers e.g amino acids and the pyrG gene. In addition the plasmid contains promoter- and terminator sequences that allow the expression of the recombinant genes. Suitable promoters are taken from genes of Aspergillus nidulans e.g. alcA, glaA, amy, niaD, and gpdA. Furthermore, the plasmid contains suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants.

(64) The plasmid used in the following examples contains the strong constitutive gpdA-promoter and auxotropic markers, all originating from Aspergillus nidulans; the plasmid containing the gene methG that is involved in methionine biosynthesis, is designated as pAMA1-MET; the plasmid containing the gene hisA that is involved in histidine biosynthesis, is designated as pAMA1-HIS.

(65) The gene encoding PAL, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-PAL-C4H (example 3), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-MET vector that contains the gpdA promoter from Aspergillus nidulans. The resulting plasmid, pAMA1-MET-PAL contains the gene encoding PAL under the control of the gpdA promoter from Aspergillus nidulans.

(66) The gene encoding C4H, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-PAL-C4H (example 3) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-HIS vector to yield pAMA1-HIS-C4H. The gpdA promoter and the gene encoding C4H are reamplified as one fragment by PCR from the plasmid pAMA1-HIS-C4H using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allows ligation of the restricted PCR product into the digested plasmid pAMA1-MET-PAL. The resulting plasmid, pAMA1-MET-PAL-C4H, contains the genes encoding PAL and C4H that are each under the control of an individual pgdA promoter from Aspergillus nidulans. The sequence of the genes encoding PAL and C4H is verified by sequencing of two different clones of pAMA1-MET-PAL-C4H.

Example 28

Construction of a Fungal Vector for Expression of TAL in Species Belonging to the Genus Aspergillus

(67) The gene encoding for TAL, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-TAL (example 6) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-MET vector. The resulting plasmid, pAMA1-MET-TAL, contains the gene encoding for TAL under the control of the gpdA promoter from Aspergillus nidulans. The sequence of the gene encoding for TAL is verified by sequencing of two different clones of pAMA1-MET-TAL.

Example 29

Construction of a Fungal Vector for Expression of 4CL and VST in Species Belonging to the Genus Aspergillus

(68) The gene encoding 4CL, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL-VST (example 5), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-HIS vector that contains the gpdA promoter from Aspergillus nidulans. The resulting plasmid, pAMA1-HIS-4CL contains the gene encoding 4CL under the control of the gpdA promoter from Aspergillus nidulans. The gene encoding VST, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL-VST (example 5) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-MET vector to yield pAMA1-MET-VST. The gpdA promoter and the gene encoding VST are reamplified as one fragment by PCR from the plasmid pAMA1-MET-VST using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allows ligation of the restricted PCR product into the digested plasmid pAMA1-HIS-4CL. The resulting plasmid, pAMA1-HIS-4CL-VST, contains the genes encoding 4CL and VST that are each under the control of an individual pgdA promoter from Aspergillus nidulans. The sequence of the genes encoding 4CL and VST is verified by sequencing of two different clones of pAMA1-HIS-4CL-VST.

Example 30

Expression of the Pathway to Resveratrol in Aspergillus niger

(69) Aspergillus niger strains are transformed with the vectors described in examples 27, 28 and 29, separately or in combination. The transformation of the fungal cell is conducted in accordance with methods known in the art, for instance, by electroporation or by conjugation (see, e.g., Sambrook et al., 1989). Transformants are selected on minimal medium lacking methionine and/or histidine.

(70) A strain of Aspergillus niger that is auxotrophic for histidine and methionine, for instance, strain FGSC A919 (see http://www.fgsc.net), is transformed separately with the vector pAMA1-MET-TAL (example 28), yielding the strain FSAN-TAL; with pAMA1-MET-PAL-C4H (example 27), yielding the strain FSAN-PALC4H and with pAMA1-HIS-4CL-VST (example 29), yielding strain FSAN-4CLVST. In addition, Aspergillus niger strain FGSC A919 is co-transformed with pAMA1-MET-TAL (example 28) and pAMA1-HIS-4CL-VST (example 29), and the transformed strain is named FSAN-TAL4CLVST. The same strain is also co-transformed with pAMA1-MET-PAL-C4H (example 27), and pAMA1-HIS-4CL-VST (example 29), resulting in the strain FSAN-PALC4H4CLVST.

Example 31

Expression of the Pathway to Resveratrol in Aspergillus oryzae

(71) A strain of Aspergillus oryzae that contains a native set of genes encoding for PAL, C4H and 4CL (Seshime et al., 2005) and that is auxotrophic for methionine, is transformed with the vector pAMA1-MET-VST (example 29), yielding the strain FSAO-VST. The transformation of the fungal cell is conducted in accordance with methods known in the art, for instance, by electroporation or by conjugation (see, e.g., Sambrook et al., 1989). Transformants are selected on minimal medium lacking methionine.

Example 32

Fermentation with Recombinant Strains of Aspergillus niger and Aspergillus oryzae in Fermentors

(72) The recombinant yeast strains can be grown in fermenters operated as batch, fed-batch or chemostat cultures.

(73) Batch and Fed-Batch Cultivations

(74) The microorganism is grown in a baffled bioreactor with a working volume of 1.5 liters under aerobic conditions. All cultures are incubated at 30° C., at 500 rpm. A constant pH of 6.0 is maintained by automatic addition of 10 M KOH, and aerobic conditions are obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the DOT is more than 80%. Cells are grown on glucose in defined medium consisting of the following components to allow growth in batch cultivations: 7.3 g/l (NH.sub.4).sub.2SO.sub.4, 1.5 g/l KH.sub.2PO.sub.4, 1.0 g/l MgSO.sub.4.7H.sub.2O, 1.0 g/l NaCl, 0.1 g/l CaCl.sub.2.2H.sub.2O, 0.1 ml/l Sigma antifoam, 7.2 mg/l ZnSO.sub.4.7H.sub.2O, 1.3 mg/l CuSO.sub.4.5H.sub.2O, 0.3 mg/l NiCl.sub.2.6H.sub.2O, 3.5 mg/l MnCl.sub.2.4H.sub.2O and 6.9 mg/l FeSO.sub.4.7H.sub.2O. The glucose concentration is, for example, 10- 20-, 30-, 40- or 50 g/l. To allow growth in fed-batch cultivations the medium is composed of: 7.3 g/l (NH.sub.4).sub.2SO.sub.4, 4.0 g/l KH.sub.2PO.sub.4, 1.9 g/l MgSO.sub.4.7H.sub.2O, 1.3 g/l NaCl, 0.10 g/l CaCl.sub.2.2H.sub.2O, 0.1 ml/l Sigma antifoam, 7.2 mg/l ZnSO.sub.4.7H.sub.2O, 1.3 mg/l CuSO.sub.4.5H.sub.2O, 0.3 mg/l NiCl.sub.2.6H.sub.2O, 3.5 mg/l MnCl.sub.2.4H.sub.2O and 6.9 mg/l FeSO.sub.4.H.sub.2O in the batch phase. The reactor is then fed with, for example, 285 g/kg glucose and 42 g/kg (NH.sub.4).sub.2SO.sub.4.

(75) Free mycelium from a pre-batch is used for inoculating the batch- and fed-batch cultures. A spore concentration of 2.10.sup.9 spores/l is used for inoculation of the pre-batch culture at pH 2.5. Spores are obtained by propagation of freeze-dried spores onto 29 g rice to which the following components are added: 6 ml 15 g/l sucrose, 2.3 g/l (NH.sub.4).sub.2SO.sub.4, 1.0 g/l KH.sub.2PO.sub.4, 0.5 g/l MgSO.sub.4.7H.sub.2O, 0.50 g/l NaCl, 14.3 mg/l ZnSO.sub.4.7H.sub.2O, 2.5 mg/CuSO.sub.4.5H.sub.2O, 0.50 mg/l NiCl.sub.2.6H.sub.2O, and 13.8 mg/l FeSO.sub.4.7H.sub.2O. The spores are propagated at 30° C. for 7-14 days to yield a black layer of spores on the rice grains and are harvested by adding 100 ml of 0.1% Tween 20 in sterile water. For all conditions, the gas is sterile filtered before being introduced into the bioreactor. The off gas is led through a condenser cooled to lower than −8° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser.

(76) Chemostat Cultures

(77) In chemostat cultures the cells can be grown in, for example, 1.5-L working-volume Biostat B laboratory fermentors at 30° C. and 500 rpm. A constant pH of 6.0 is maintained by automatic addition of 10 M KOH, and aerobic conditions are obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the DOT is more than 80%. The dilution rate (D) can be set at different values, e.g. at 0.050 h.sup.−1, 0.10 h.sup.−1, 0.15 h.sup.−1, or 0.20 h.sup.−1. The pH is kept constant, e.g at 6.6, by automatic addition of 10 M KOH, using a minimal growth medium with the following components: 2.5 g/l (NH.sub.4).sub.2SO.sub.4, 0.75 g/l KH.sub.2PO.sub.4, 1.0 g/l MgSO.sub.4.7H.sub.2O, 1.0 g/l NaCl, 0.1 g/l CaCl.sub.2.2H.sub.2O, 0.1 ml/l Sigma antifoam, 7.2 mg/l ZnSO.sub.4.7H.sub.2O, 1.3 mg/l CuSO.sub.4.5H.sub.2O, 0.3 mg/l NiCl.sub.2.6H.sub.2O, 3.5 mg/l MnCl.sub.2.4H.sub.2O and 6.9 mg/l FeSO.sub.4.7H.sub.2O. The concentration of glucose can be set at different values, e.g. is 3.0 g/l 6.0 g/l, 12.0 g/l, 15.0 g/l or 18.0 g/l. The bioreactor is inoculated with free mycelium from a pre-batch culture as described above, and the feed pump is turned on at the end of the exponential growth phase.

(78) For all conditions, the gas is sterile filtered before being introduced into the bioreactor. The off gas is led through a condenser cooled to lower than −8° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser.

(79) Cultivations are considered to be in steady state after at least 5 residence times, and if the concentrations of biomass glucose and composition of the off-gas remain unchanged (less than 5% relative deviation) over the last two residence times.

Example 33

Extraction and Analysis of Resveratrol in Aspergillus niger and Aspergillus oryzae

(80) Extraction and analysis is performed using the methods as described in examples 14 and 15.

Example 34

Over-Expression of Native Yeast Genes by Gene Targeting Method

(81) Over-expression of native yeasts genes with constitutive yeast promoters is carried out by means of a promoter-replacement method based on a linear, PCR-generated gene-targeting substrate and using K. lactis URA3 as a recyclable marker described previously (Erdeniz et al, 1997). This method includes the generation of an intermediate yeast strain, where the Kluyveromyces lactis URA3 marker gene is integrated in combination with two copies of the strong constitutive promoter sequence as a direct repeat on each side of the marker gene. The marker gene is then looped out through recombination mediated by the direct repeat, an event which is selected for by plating the intermediate strain on medium containing 5-fluoroorotic acid (5-FOA), which is toxic to cells expressing the URA3 gene. The result is a yeast strain, in which the native promoter has been replaced with the strong constitutive promoter. Integration of the above described promoter sequence and marker gene is directed to the correct location in the genome by means of PCR-generated target sequences.

(82) The above described gene-targeting substrate can be constructed by means of multiple rounds of fusion-PCR. However, to avoid introduction of PCR-generated mutations, it is beneficial to use a bi-partite or even a quadruple gene-targeting substrate (Erdeniz et al, 1997).

Example 35

Over-Expression of Native Yeast Genes by Bi-Partite Gene Targeting Substrate Method

(83) For example to overexpress a gene with the strong ADH1 promoter, this promoter has been introduced into intermediate working vectors on either side of K. lactis URA3, resulting in the vectors pWAD1, pWAD2, (WO/2005/118814). With these vectors as templates, fragments can be amplified that contain (in the 5′ to 3′ direction) 1) the ADH1 coupled to two thirds of K. lactis URA3 towards the 5′ end, using the primers AD-fw and Int3′, and 2) two thirds of K. lactis URA3 towards the 3′ end coupled to the ADH1, using the primers Int5′ and AD-rv. Target sequences corresponding to a 300-500 bp sequence upstream of the gene to be overexpressed and a 300-500 bp starting with ATG of the gene to be overexpressed, are amplified from genomic yeast DNA using suitable primers. The reverse primer used for amplification of the upstream target sequence contains a 5′ overhang that allows fusion to fragment 1 described above. The forward primer used for amplification of the target sequence starting with ATG contains a 5′ overhang that allows fusion with fragment 2 described above. Following fusion by PCR of the upstream target sequence with fragment 1, and fusion by PCR of fragment 2 with the target sequence starting with ATG, the two linear substrates as shown in FIG. 6 are ready for transformation.

Example 36

Construction of a Strain Overexpressing Native S. cerevisiae NADP-Cytochrome P450 Reductase

(84) The native promoter of S. cerevisae NADP-cytochrome P450 reductase CPR1 gene (encoded by YHR042W) was replaced with the constitutive S. cerevisiae alcohol dehydrogenase ADH1 promoter via chromosomal promoter exchange using the “bi-partite” PCR-based allele replacement method as described in example 34 and 35. Primers A and B were used to generate fragment CPR1-UP (Table 1) via PCR at a melting temperature of 56° C. using S. cerevisiae genomic DNA as template. Primers C and D were then used to generate fragment CPR1-S via PCR at a melting temperature of 56° C. using S. cerevisiae genomic DNA as template. Fragments AD1 (k1URA 3′ end fused to promoter ADH1) and AD2 (promoter ADH1 fused to K1URA 5′-end) were generated via PCR using primers AD-fw and Int3′ and Int5′ and AD-ry at a melting temperature of 56° C. and 56° C., respectively. Plasmid pWAD1 was used as template for generation of fragment AD1 and plasmid pWAD2 was used for generating fragment AD2. Fragments CPR_UP were then fused to fragment AD2 using fusion PCR with primers A and Int3′ at a melting temperature of 56° C. resulting in fusion fragment 1 (bi-partite substrate 1). A second fusion PCR was used to fuse fragments AD1 and CPR-S with Int5′ and primer D at a melting temperature of 56° C. resulting in fusion fragment 2 (bi-partite substrate 2).

(85) Fusion fragments 1 and 2 (bi-partite substrates 1 and 2) were purified on agarose gel and used for co-transformation of S. cerevisiae strain FS01528 (Mata, ura3 his3) and the transformants were plated on SC-URA plates and incubated for 2-4 days at 30° C. Transformants were streak purified on SC-ura plates and incubated another 2 days at 30° C. and then plated onto 5-FOA (5-fluoroorotic acid) plates. After incubation for 2 days at 30° C. “pop-out” colonies appeared, which were streak purified on a new 5-FOA-plate and incubated another 2 days at 30° C. and then finally transferred to a rich medium plate YPD. The resulting colonies were analyzed for the presence of fragment of size 1700-1800 base pairs using yeast colony PCR with primers A and AD-rev and a melting temperature at 55° C. and an elongation time of 1 minute and 45 seconds. One of the positive colonies from the colony PCR containing the new replaced ADH1 promoter in front of the CPR1 gene was named FSpADH1-CPR (Mata ura3 his3 pADH1-CPR1) strain.

(86) Table 1 Primers and fragments used in the “bi-partite” PCR-based allele replacement method to exchange native S. cerevisiae CPR1 promoter with S. cerevisiae ADH1 promoter

(87) TABLE-US-00002 Primers A 5′-GTATTCTATATCCACGCCTGCAAAC B 5′- AGTACATACAGGGAACGTCCCTACAGGAACGCAAACTTAAGCTAC C 5′- GCATACAATCAACTATCTCATATACAATGCCGTTTGGAATAGACAACACC D 5′-GCTTCCGCATTACAAATAAAGTCTTCAA AD-fw  5′-GGACGTTCCCTGTATGTACTAGGGGGATCGAAGAAATGATGG Int3′ 5′-GAGCAATGAACCCAATAACGAAATC 3′ Int5′ 5′-CTTGACGTTCGTTCGACTGATGAGC 3′ AD-rv 5′-TGTATATGAGATAGTTGATTGTATGC Fragments CPR-UP generated from primers A and B (CPR1 gene fragment upstream of start codon (ATG)) CPR-S generated from primers C and D (CPR1 gene fragment containing start codon (ATG)) AD1 (ADH1 promoter coupled to two thirds of K.lactis URA3 towards the 5′ end generated from primers AD-fw and Int3′) AD2 (Two thirds of K.lactis URA3 towards the 3′ end coupled to the ADH1 promoter. Generated from primers Int5′ and AD-rv) Fusion fragment 1 (CPR-UP fragment fused to AD2 fragment) Fusion fragment 2 (AD1 fragment fused to CPR-S fragment)

Example 37

Construction of a Strain Overexpressing Native S. cerevisiae ACC1 Gene

(88) The yeast gene ACC1, encoding acetyl-CoA carboxylase, was overexpressed with the strong constitutive yeast TPI1 promoter as described previously (WO 2005/118814). This was done by replacing the native ACC1 promoter with the TPI1 promoter, using a slightly modified promoter-replacement method based on the bipartite gene-targeting method (Example 1 and 2). One part of the bipartite substrate consisted of two thirds (towards the 3′ end) of K. lactis URA3, fused to the TPI1 promoter sequence and a target sequence corresponding to the beginning of ACC1. The second part of the bipartite substrate consisted of a target sequence upstream of ACC1, fused to the TPI1 promoter sequence and two thirds (towards the 5′ end) of K. lactis URA3. Following transformation with the bipartite substrate and selection on medium lacking uracil, transformants were obtained in which the native promoter had been knocked out and replaced with two copies of the TPI1 promoter sequence as a direct repeat on either side of the K. lactis URA3 marker gene. A second recombination event, resulting in looping out of the selection marker, was selected for by replating transformants on medium containing 5′-fluoroorotic acid (5-FOA), which is toxic to cells expressing the URA3 gene. This resulted in a strain, in which the native ACC1 promoter had been replaced with the TPI1 promoter.

(89) In order to construct part 1 of the bipartite substrate, two thirds (towards the 3′ end) of K. lactis ura3 was amplified from the plasmid pWJ716 using the primers 5′ CTTGACGTTCGTTCGACTGATGAGC 3′ and 5′ CTGGAATTCGATGATGTAGTTTCTGG 3′ (Table 2). Moreover, the TPI1 promoter sequence was amplified from genomic yeast DNA using the primers 5′ CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC 3′ and 5′ TTTTTGATTAAAATTAAAAAAACTTTTTAGTTTATGTATGTGTTTTTTG 3′ and a downstream targeting sequence, consisting of the beginning of the ACC1 gene (i.e., the first 553 bp of the gene) was amplified from genomic yeast DNA using the primers 5′ AGTTTTTTTAATTTTAATCAAAAAATGAGCGAAGAAAGCTTATTCGAGTC 3′ and 5′ CACCTAAAGACCTCATGGCGTTACC 3′. These three fragments were fused to each other in two rounds of PCR. First, the TPI1 promoter sequence was fused to the downstream targeting sequence, using the primers 5′ CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC 3′ and 5′ CACCTAAAGACCTCATGGCGTTACC 3′. The resulting product was then fused to the fragment containing two thirds (towards the 3′ end) of K. lactis URA3. The resulting fragment, 3′ 2/3 K. lactis URA3-pTPI1-DOWN (ACC1) was part 1 of the bipartite gene targeting substrate.

(90) In order to construct part 2 of the bipartite substrate, two thirds (towards the 5′-end) of K. lactis URA3 was amplified from the plasmid pWJ716 using the primers 5′ CGGTCTGCATTGGATGGTGGTAAC 3′ and 5′ GAGCAATGAACCCAATAACGAAATC 3′ (Table 2). The TPI1 promoter sequence was amplified from genomic yeast DNA using the primers 5′ CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC 3′ and 5′ CACCATCCAATGCAGACCGTTTTAGTTTATGTATGTGTTTTTTG 3′, and a target sequence upstream of ACC1 was amplified from genomic DNA using primers 5′ TGTTCTGCTCTCTTCAATTTTCCTTTC 3′ and 5′ CTGGAATTCGATGATGTAGTTTCTAATTTTCTGCGCTGTTTCG 3′. These three fragments were fused in two rounds of PCR. First, the upstream targeting sequence was fused to the TPI1 promoter sequence, using the primers 5′ TGTTCTGCTCTCTTCAATTTTCCTTTC 3′ and 5′ CACCATCCAATGCAGACCGTTTTAGTTTATGTATGTGTTTTTTG 3′. The resulting fragment was then fused to the fragment containing two thirds (towards the 5′ end) of K. lactis URA3, resulting in the fragment UP (ACC1)-pTPI1-5′ 2/3 K. lactis URA3, which constituted part 2 of the bipartite gene targeting substrate.

(91) Yeast strain FS01372 (MATa ura3 trp1 PADH1-FAS1 pADH1-FAS2) was transformed with the linear substrates UP (ACC1)-pTPI1-5′ 2/3 K. lactis URA3 and 3′ 2/3 K. lactis URA3-pTPI1-DOWN (ACC1). Transformants were selected and streak-purified on medium lacking uracil and were then transferred to plates containing 5-FOA. Pop-out recombinants were streak-purified on 5-FOA-containing medium. The resulting strain was named FS01392 and had the genotype MATa ura3 trp1 pTPI1-ACC1 PADH1-FAS1 pADH1-FAS2). The correct integration of the TPI1 promoter was checked by colony PCR.

(92) Table 2 Primers and fragments used in the “bi-partite” PCR-based allele replacement method to exchange native S. cerevisiae ACC1 promoter with the strong constitutive S. cerevisiae TPI1 promoter

(93) TABLE-US-00003 Primers A 5′-CTTGACGTTCGTTCGACTGATGAGC B 5′-CTGGAATTCGATGATGTAGTTTCTGG C 5′-CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC D 5′- TTTTTGATTAAAATTAAAAAAACTTTTTAGTTTATGTATGTGTTTTTTG E 5′- AGTTTTTTTAATTTTAATCAAAAAATGAGCGAAGAAAGCTTATTCGAGTC F 5′-CACCTAAAGACCTCATGGCGTTACC G 5′-CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC (G = C) H 5′-CACCTAAAGACCTCATGGCGTTACC (H = F) I 5′-CGGTCTGCATTGGATGGTGGTAAC J 5′-GAGCAATGAACCCAATAACGAAATC K 5′-CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC L 5′-CACCATCCAATGCAGACCGTTTTAGTTTATGTATGTGTTTTTTG M 5′-TGTTCTGCTCTCTTCAATTTTCCTTTC N 5′-CTGGAATTCGATGATGTAGTTTCTAATTTTCTGCGCTGTTTCG O 5′-TGTTCTGCTCTCTTCAATTTTCCTTTC (O = M) P 5′-CACCATCCAATGCAGACCGTTTTAGTTTATGTATGTGTTTTTTG (P = L) Fragments KlactisURA3 sequence generated with primers A and B TPI1 promoter sequence generated with primers C and D ACC1 downstream sequence generated with primers E and F pTPI1-Down(ACC1) fusion generated from primers G and H KlactisURA3-pTPI1-DOWN(ACC1) = part 1 of the bipartite substrate generated from primers A and H KlactisURA3 sequence generated with primers I and J TPI1 promoter sequence generated with primers K and L ACC1 upstream sequence generated with primers M and N UP(ACC1)-pTPI1 fusion generated from primers O and P UP(ACC1)-pTPI1-5′KlactisURA3 = part 2 of the bipartite substrate generated with primers M and J

Example 38

Deletion of Native Yeast Genes by Gene Targeting Method

(94) Gene deletions were performed by a similar method as for gene overexpressions (Example 1) by means of homologous recombination using PCR-generated targeting substrates and the K. lactis URA3 gene as a selectable marker, essentially as described in Erdeniz, N., Mortensen, U. H., Rothstein, R. (1997) Genome Res. 7:1174-83. Information on primer design for fusion PCR can be found in the same publication. Generally, fusion of DNA fragments was made possible by using primers with appropriately designed 5′ overhangs for amplification of the original DNA fragments. In all cases, PCR-generated fragments were excised from a 1% agarose gel and purified before proceeding with fusion PCR.

(95) Transformants were generally selected on -URA plates, and pop-out of the K. lactis URA3 marker gene was selected for by plating on 5-FOA medium (5-fluoroorotic acid, 750 mg/l). Correct gene deletions were verified by PCR, using primers on both sides of the deleted gene. Generally, PCR-verification of gene deletions was performed by means of colony-PCR. For colony-PCR, a small amount of cells was dispersed in 10 μl H.sub.2O and was placed at −80° C. for approximately 30 min, followed by 15 min. incubation at 37° C. The cell suspension was then used as template for PCR.

Example 39

Generation of Strain with Deleted Isocitrate Dehydrogenase, IDH1

(96) The Native Yeast Gene IDH1

(97) TABLE-US-00004 SEQ ID NO: 59 ATGCTTAACAGAACAATTGCTAAGAGAACTTTAGCCACTGCCGCTCAGGC GGAACGCACCCTACCCAAGAAGTATGGCGGTCGTTTCACCGTCACTTTGA TACCTGGTGACGGTGTTGGGAAAGAAATCACTGATTCAGTGAGAACCATT TTTGAGGCTGAAAATATCCCGATCGACTGGGAAACTATAAACATTAAGCA AACAGATCATAAGGAAGGCGTCTATGAAGCTGTTGAGTCTCTAAAGAGAA ATAAGATTGGTCTTAAGGGGCTATGGCACACTCCTGCTGACCAAACAGGT CACGGTTCACTAAACGTTGCTTTGCGTAAACAACTAGATATCTACGCCAA TGTGGCCCTTTTCAAATCCTTGAAGGGTGTCAAGACTAGAATTCCAGACA TAGATTTGATTGTCATTAGAGAAAACACGGAGGGTGAGTTCTCAGGCCTG GAACATGAATCCGTCCCTGGTGTAGTGGAATCTTTGAAAGTTATGACTAG ACCTAAGACAGAAAGGATCGCCAGATTTGCCTTTGACTTCGCCAAGAAAT ACAACAGAAAGTCTGTCACAGCTGTGCATAAGGCAAATATCATGAAGTTA GGTGACGGTCTGTTCAGAAATATAATAACTGAAATTGGCCAAAAAGAATA TCCTGATATTGACGTATCGTCCATCATTGTCGACAATGCCTCCATGCAGG CGGTGGCCAAACCTCATCAATTTGATGTCCTAGTTACCCCTTCAATGTAC GGTACCATCTTAGGCAACATTGGCGCTGCTTTGATCGGTGGTCCAGGATT GGTGGCAGGTGCCAACTTTGGCAGGGACTATGCTGTCTTCGAACCAGGTT CCAGACATGTTGGTTTAGATATTAAAGGCCAAAATGTGGCTAACCCAACT GCCATGATCCTTTCCTCCACGTTAATGTTGAACCATTTGGGTTTGAATGA ATATGCTACTAGAATCTCAAAGGCAGTTCATGAAACGATCGCAGAAGGTA AGCATACCACTAGAGATATTGGTGGTTCCTCTTCTACTACTGACTTCACG AATGAAATCATCAACAAATTATCTACCATGTAA
encoded by YNL037c is deleted using a quadruple gene targeting substrate according to the following procedure:

(98) A target sequence upstream of IDH1 gene is amplified from genomic DNA by PCR using the primers IDH1-up-fw and IDH1-up-ry and is fused to the two thirds of the K. lactis URA3 gene to the 5′ end by PCR. Furthermore a target sequence corresponding to the downstream region of IDH1 is amplified from genomic DNA using the primers IDH1-D-fw and IDH1-d-rv. The downstream target sequence is fused to the two thirds of the K. lactis URA3 gene to the 3′ end by PCR.

(99) The yeast strain FS01528 (MATa ura3 his3) is transformed with the two linear fusion substrates described above containing the upstream target region and the downstream target region of the gene to be deleted fused to either two thirds of the K. lactis URA3 gene. Transformants are selected on medium lacking uracil and are streak-purified on the same medium. Transformants are transferred to plates containing 5-FOA. Pop-out recombinants are streak-purified on 5-FOA-containing medium. The resulting strain has the genotype (MATa ura3 his3 IDH1Δ). Correct deletion of the IDH1 gene is verified by PCR using the primers IDH1-up-fw and IDH1-D-rv.

Example 40

Mating of Cells, Sporulation, Tetrad Dissection and Tetrad Scoring (Analysis)

(100) Methods for combining genetic features by crossing of strains used in the examples are well known and are, e.g., described in: Adams, A., Gottschling, D. E., Kaiser, C. A., and Stearns, T. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1997). Typically, strains of opposite mating types were allowed to mate, diploids were selected and transferred to sporulation medium (20 g/l potassium acetate, 1 g/l glucose, 2.5 g/l yeast extract, pH 7.0) and were allowed to sporulate at 30° C. for approximately 3 days. The asci were dissected on a YPD plate using a Singer MSM microscope and micromanipulator dissection microscope. The mating types of the resulting tetrads were scored by replica-plating to a lawn of cells with either a or alpha mating type, incubating at 30° C. to allow mating, replica-plating to sporulation medium, and visualizing sporulation by illuminating plates under a 302 nm UV-light source. Auxotrophic markers were scored by replica plating to drop-out plates. Genetic modifications that could not be scored by phenotype were scored by colony-PCR. In general, the same primer sets that were used for verification of genomic integrations or knockouts were also used for colony-PCR scoring of tetrads.

Example 41

Isolation of Genes Encoding TAL, PAL, C4H, 4CL, and VST1

(101) Tyrosine ammonia lyase (TAL) was isolated from Rhodobacter capsulatus by codon optimization for expression in S. cerevisiae and was further assembled as a synthetic gene as described above.

(102) The isolation of phenylalanine ammonia lyase (PAL2), cinnamate 4-hydroxylase (C4H), 4-coumarate:CoenzymeA ligase (4CL1) described above.

(103) 4-Coumarate:CoenzymeA Ligase (4CL2)

(104) TABLE-US-00005 (SEQ ID NO: 60) ATGACGACACAAGATGTGATAGTCAATGATCAGAATGATCAGAAACAGTG TAGTAATGACGTCATTTTCCGATCGAGATTGCCTGATATATACATCCCTA ACCACCTCCCACTCCACGACTACATCTTCGAAAATATCTCAGAGTTCGCC GCTAAGCCATGCTTGATCAACGGTCCCACCGGCGAAGTATACACCTACGC CGATGTCCACGTAACATCTCGGAAACTCGCCGCCGGTCTTCATAACCTCG GCGTGAAGCAACACGACGTTGTAATGATCCTCCTCCCGAACTCTCCTGAA GTAGTCCTCACTTTCCTTGCCGCCTCCTTCATCGGCGCAATCACCACCTC CGCGAACCCGTTCTTCACTCCGGCGGAGATTTCTAAACAAGCCAAAGCCT CCGCGGCGAAACTCATCGTCACTCAATCCCGTTACGTCGATAAAATCAAG AACCTCCAAAACGACGGCGTTTTGATCGTCACCACCGACTCCGACGCCAT CCCCGAAAACTGCCTCCGTTTCTCCGAGTTAACTCAGTCCGAAGAACCAC GAGTGGACTCAATACCGGAGAAGATTTCGCCAGAAGACGTCGTGGCGCTT CCTTTCTCATCCGGCACGACGGGTCTCCCCAAAGGAGTGATGCTAACACA CAAAGGTCTAGTCACGAGCGTGGCGCAGCAAGTCGACGGCGAGAATCCGA ATCTTTACTTCAACAGAGACGACGTGATCCTCTGTGTCTTGCCTATGTTC CATATATACGCTCTCAACTCCATCATGCTCTGTAGTCTCAGAGTTGGTGC CACGATCTTGATAATGCCTAAGTTCGAAATCACTCTCTTGTTAGAGCAGA TACAAAGGTGTAAAGTCACGGTGGCTATGGTCGTGCCACCGATCGTTTTA GCTATCGCGAAGTCGCCGGAGACGGAGAAGTATGATCTGAGCTCGGTTAG GATGGTTAAGTCTGGAGCAGCTCCTCTTGGTAAGGAGCTTGAAGATGCTA TTAGTGCTAAGTTTCCTAACGCCAAGCTTGGTCAGGGCTATGGGATGACA GAAGCAGGTCCGGTGCTAGCAATGTCGTTAGGGTTTGCTAAAGAGCCGTT TCCAGTGAAGTCAGGAGCATGTGGTACGGTGGTGAGGAACGCCGAGATGA AGATACTTGATCCAGACACAGGAGATTCTTTGCCTAGGAACAAACCCGGC GAAATATGCATCCGTGGCAACCAAATCATGAAAGGCTATCTCAATGACCC CTTGGCCACGGCATCGACGATCGATAAAGATGGTTGGCTTCACACTGGAG ACGTCGGATTTATCGATGATGACGACGAGCTTTTCATTGTGGATAGATTG AAAGAACTCATCAAGTACAAAGGATTTCAAGTGGCTCCAGCTGAGCTAGA GTCTCTCCTCATAGGTCATCCAGAAATCAATGATGTTGCTGTCGTCGCCA TGAAGGAAGAAGATGCTGGTGAGGTTCCTGTTGCGTTTGTGGTGAGATCG AAAGATTCAAATATATCCGAAGATGAAATCAAGCAATTCGTGTCAAAACA GGTTGTGTTTTATAAGAGAATCAACAAAGTGTTCTTCACTGACTCTATTC CTAAAGCTCCATCAGGGAAGATATTGAGGAAGGATCTAAGAGCAAGACTA GCAAATGGATTAATGAACTAG
was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the forward primer 5′-GCGAATTCTTATGACGACA CAAGATGTGATAGTCAATGAT-3′ containing an EcoR1 restriction site and reverse primer 5′-GCACTAGTATCCTAGTTCATTAATCCATTT GCTAGTCTTGCT-3′ containing a Spe1 restriction site.

(105) The VST1 gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al, 1993) was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence:

(106) TABLE-US-00006 (SEQ ID NO: 63)   1 MASVEEFRNA QRAKGPATIL AIGTATPDHC VYQSDYADYY FRVTKSEHMT  51 ELKKKFNRIC DKSMIKKRYI HLTEEMLEEH PNIGAYMAPS LNIRQEIITA 101 EVPRLGRDAA LKALKEWGQP KSKITHLVFC TTSGVEMPGA DYKLANLLGL 151 ETSVRRVMLY HQGCYAGGTV LRTAKDLAEN NAGARVLVVC SEITVVTFRG 201 PSEDALDSLV GQALFGDGSS AVIVGSDPDV SIERPLFQLV SAAQTFIPNS 251 AGAIAGNLRE VGLTFHLWPN VPTLISENIE KCLTQAFDPL GISDWNSLFW 301 IAHPGGPAIL DAVEAKLNLE KKKLEATRHV LSEYGNMSSA CVLFILDEMR 351 KKSLKGEKAT TGEGLDWGVL FGFGPGLTIE TVVLHSVPTV TN**
was used as template to generate a synthetic gene optimized for expression in S. cerevisiae:

(107) TABLE-US-00007 ATGGCATCCGTAGAGGAGTTCAGAAATGCACAGAGGGCAAAAGG TCCAGCAACCATATTGGCTATTGGAACAGCCACCCCTGATCACTGTGTTT ATCAATCTGATTACGCTGATTACTATTTCAGAGTAACTAAAAGTGAACAT ATGACAGAACTTAAGAAAAAGTTTAATAGAATTTGTGATAAATCTATGAT AAAGAAAAGATACATACATCTAACTGAAGAAATGTTAGAGGAACATCCAA ATATAGGTGCATATATGGCACCATCTTTGAATATTAGACAAGAAATCATA ACAGCCGAGGTACCTAGACTAGGTAGAGACGCAGCCTTGAAAGCTTTAAA GGAATGGGGACAACCAAAATCTAAGATTACACATTTGGTTTTCTGTACAA CTTCCGGTGTCGAAATGCCAGGTGCTGATTATAAACTAGCAAACCTATTG GGATTAGAGACCTCTGTTAGAAGAGTTATGTTGTATCATCAAGGTTGTTA CGCCGGAGGTACAGTGCTTAGAACTGCTAAGGATTTGGCAGAAAATAACG CCGGTGCTAGGGTTTTAGTCGTCTGCAGTGAAATCACTGTCGTAACTTTC AGAGGTCCATCAGAAGATGCTCTAGACAGTTTGGTCGGACAAGCATTGTT TGGCGATGGATCTTCCGCCGTAATTGTAGGCAGCGATCCTGATGTGTCCA TTGAAAGACCACTATTTCAATTAGTTTCTGCTGCTCAAACTTTTATTCCA AATTCCGCCGGTGCCATAGCAGGAAACTTGAGAGAAGTTGGTTTGACTTT TCATTTGTGGCCTAATGTCCCAACCTTAATTTCAGAAAACATCGAAAAAT GCTTAACTCAAGCCTTTGACCCATTGGGCATAAGCGACTGGAACTCATTG TTTTGGATTGCTCATCCAGGTGGTCCAGCAATTTTAGACGCAGTGGAGGC AAAACTAAACTTAGAGAAGAAAAAGTTGGAAGCTACAAGACACGTTCTAT CAGAGTATGGCAACATGAGCTCTGCCTGCGTTTTATTCATTCTAGATGAG ATGAGGAAGAAGTCTTTAAAGGGTGAAAAAGCCACAACCGGAGAAGGTTT AGATTGGGGTGTTCTATTTGGTTTCGGTCCTGGCTTAACAATTGAGACAG TGGTGTTACACTCTGTTCCAACTGTCACTAACTAATGA

(108) (SEQ ID NO: 64). The synthetic VST1 gene was delivered inserted in E. coli pUC57 vector flanked by BamH1 and Xho1 restriction sites. The synthetic gene was purified from the pUC57 vector by BamH1/Xho1 restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

Example 42

Construction of a Yeast Vector for Expression of TAL

(109) Plasmid, pESC-URA-TAL, containing the gene encoding tyrosine ammonia lyase, TAL, under the control of the divergent GAL1/GAL10 promoter was constructed as described above for PAL.

Example 43

Construction of a Yeast Vector for Expression of 4CL

(110) The gene encoding 4CL1 and 4CL2 were isolated as described above. The amplified 4CL1 PCR-product was digested with Xba1/BamH1 and ligated into Spe1/BglII digested pESC-TRP vector (Stratagene), resulting in vector pESC-TRP-4CL. The amplified 4CL2 PCR-product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL2.

(111) Two different clones of pESC-TRP-4CL1 and pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.

Example 44

Construction of a Yeast Vectors for Expression of 4CL and VST

(112) The gene encoding VST from Vitis vinifera (grape) was isolated as described above. The purified BamH1/Xho1 digested VST gene fragment was ligated into BamH1/Xho1 digested pESC-HIS-4CL2 plasmid or pESC-trp-4CL1 plasmid (example 15). The resulting plasmids, pESC-HIS-4CL2-VST and pESC-TRP-4CL1-VST contained the genes encoding 4CL1, 4CL2 and VST under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding VST was verified by sequencing of two different clones of pESC-HIS-4CL2-VST and pESC-TRP-4CL1-VST.

Example 45

Expression of the PAL-Pathway to Resveratrol in the Yeast S. cerevisiae Using PAL, C4H, 4CL and VST

(113) Yeast strains containing the appropriate genetic markers were transformed with the vectors described in examples 36 and 38. The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989).

(114) S. cerevisiae strain FS01267 (MATa ura3 trp1) was co-transformed with the vectors pESC-URA-PAL-C4H and pESC-TRP-4CL1-VST, resulting in the strain FSSC-PALC4H4CL1VST.

(115) S. cerevisiae strain FS01528 (MATa ura3 his3) was co-transformed with the vectors pESC-URA-PAL-C4H and pESC-HIS-4CL2-VST, resulting in the strain FSSC-PALC4H4CL2VST.

(116) Transformants were selected on medium lacking uracil and tryptophan or uracil and histidine and streak purified on the same medium.

Example 46

Expression of the TAL-Pathway to Resveratrol in S. cerevisiae Using TAL, 4CL and VST

(117) S. cerevisiae strain FS01528 (MATa ura3 his3) was co-transformed with pESC-URA-TAL (example 42) and pESC-HIS-4CL2-VST (example 44), and the transformed strain was named FSSC-TAL4CL2VST. Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.

Example 47

Expression of the PAL-Pathway to Resveratrol in S. cerevisiae Strain Overexpressing Native S. cerevisiae NADP-Cytochrome P450 Reductase

(118) FSpADH1-CPR (Mata ura3 his3 pADH1-CPR1) (Example 36) was co-transformed with the vectors pESC-URA-PAL-C4H and pESC-HIS-4CL2-VST, resulting in the strain FSSC-PALC4H4CL2VST-pADH1CPR1 (Mata ura3 his3 pADH1-CPR1, pESC-URA-PAL-C4H, pESC-HIS-4CL2-VST).

Example 48

Expression of the PAL-Pathway to Resveratrol in S. cerevisiae Strain Overexpressing Native S. cerevisiae ACC1 Gene

(119) FS01392 (MATa ura3 trp1 pTPII-ACC1 PADH1-FAS1 pADH1-FAS2) (example 37) was co-transformed with the vectors pESC-URA-PAL-C4H and pESC-TRP-4CL1-VST, resulting in the strain FS01392-PAL.

(120) As a control the strain FS01372 (MATa ura3 trp1 pTPII-ACC1 PADH1-FAS1 pADH1-FAS2)(Example 37) was also co-transformed with the vectors pESC-URA-PAL-C4H and pESC-TRP-4CL1-VST, resulting in the strain FS01372-PALcon.

Example 49

Expression of the TAL-Pathway to Resveratrol in S. cerevisiae Strain Overexpressing Native S. cerevisiae ACC1 Gene

(121) FS01392 (MATa ura3 trp1 pTPII-ACC1 PADH1-FAS1 pADH1-FAS2) (example 37) was co-transformed with the vectors pESC-URA-TAL and pESC-TRP-4CL1-VST, resulting in the strain FS01392-TAL.

(122) As a control the strain FS01372 (MATa ura3 trp1 pTPI1-ACC1 PADH1-FAS1 pADH1-FAS2)(Example 37) was also co-transformed with the vectors pESC-TAL and pESC-TRP-4CL1-VST, resulting in the strain FS01372-TALcon.

Example 50

HPLC Analysis of Hydroxyl Stilbenes

(123) For quantitative analysis of cinnamic acid, coumaric acid, pinosylvin and resveratrol, cell free supernatant samples were subjected to separation by high-performance liquid chromatography (HPLC) Agilent Series 1100 system (Hewlett Packard) prior to uv-diode-array detection at λ=306 nm. A Phenomenex (Torrance, Calif., USA) Luna 3 micrometer C18 (100×2.00 mm) column was used at 40° C. As mobile phase a gradient of acetonitrile and milliq water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.4 ml/min. The gradient profile was linear from 15% acetonitrile to 100% acetonitrile over 20 min. The elution times were approximately 3.4 min. for coumaric acid, 5.5 min. for free trans-resveratrol and 6.8 min. for cinnamic acid. The elution time was approximately 8.8-8.9 minutes for trans-pinosylvin.

(124) Pure pinosylvin standard (>95% pure) was purchased from ArboNova (Turku, Finland). Pure resveratrol standard was purchased from Cayman chemical company, whereas pure coumaric acid and cinnamic acid standards were purchased from Sigma.

Example 51

Shake Flask Cultivations of Strain Overexpressing CPR

(125) The metabolically engineered recombinant yeast strain with overexpressed CPR, FSSC-PALC4H4CL2VST-pADH1CPR1 (example 19), was inoculated to an initial optical density of 0.1 and grown in 100 ml defined mineral medium (Verduyn et al, 1992) that contained vitamins, trace elements, 3 g/l glucose and 40 g/l galactose for induction of the PAL-pathway genes. The control strain FSSC-PALC4H4CL2VST (example 17) was inoculated in the same way in a second shake flask for control comparison.

(126) The 500 ml stoppered shake flasks were incubated for three days at 30° C. and 110 rpm. At 72 hours 1 ml samples were taken out from the cultivations, cells were removed by 1 minute centrifugation (13000 rpm, micro centrifuge), and the cell free supernatant was analyzed with HPLC.

(127) The engineered strain overexpressing CPR produced 12.0 mg/l resveratrol compared to the control strain that produced 1.0 mg/l resveratrol after 72 hours cultivation.

(128) TABLE-US-00008 Resveratrol Strain (mg/l) Control 1.0 FSSC-PALC4H4CL2VST Overexpressed CPR 12.0 FSSC-PALC4H4CL2VST-pADH1CPR1

Example 52

Shake Flask Cultivations of Strains Overexpressing ACC1

(129) The metabolically engineered recombinant yeast strains with overexpressed ACC1, FS01392-PAL (example 20a) and FS01392-TAL (example 20b), were inoculated to an initial optical density of 0.1 and grown in 100 ml defined mineral medium (Verduyn et al, 1992) that contained, vitamins, trace elements, 3 g/l glucose and 40 g/l galactose for induction of the PAL-pathway genes. After 24 hours 50 mg coumaric acid (Sigma) precursor dissolved in 1 ml 70% ethanol was added corresponding to a concentration of 500 mg/l coumaric acid in the shake flasks.

(130) The control strains, FS01372-PALcon (example 20a) and FS01372-TAlcon (example 20b), were inoculated and grown in the same way in a second shake flask for control comparison.

(131) The 500 ml stoppered shake flasks were incubated for three days at 30° C. and 110 rpm. At 68 hours 1 ml samples were taken out from the cultivations, cells were removed by 1 minute centrifugation (13000 rpm, micro centrifuge), and the cell free supernatant was analyzed with HPLC.

(132) The engineered strain FS01392-PAL (overexpressing ACC1 and the PAL-pathway genes produced) 119 mg/l resveratrol and its control strain FS01372-PALcon produced 104 mg/l resveratrol, corresponding to a 14% increase in the engineered strain.

(133) The engineered strain FS01392-TAL (overexpressing ACC1 and the TAL-pathway genes produced) 99.5 mg/l resveratrol and its control strain FS01372-TALcon produced 69 mg/l resveratrol, corresponding to a 44% increase in the engineered strain.

(134) TABLE-US-00009 Resveratrol Strain (mg/l)* FS01392-PAL 119.0 Overexpressed ACC1 Control-PAL 104.0 FS01372-PALcon FS01392-TAL 99.5 Overexpressed ACC1 Control-TAL 69.0 FS01372-TALcon *In these experiments 500 mg/l coumaric acid was added to the shake flasks.

Example 53

Resveratrol Content of Genetically Engineered Yeast Cells

(135) The resveratrol content of yeast cells genetically engineered to produce resveratrol as described in Example 9 was determined. Levels of from 0.44 to 0.53 μg/g were found.

Example 53

Determination of Intracellular and Extracellular Levels of Stilbenoids in a Continuous Culture of PALCPR

(136) The yeast strain with overexpressed CPR, FSSC-PALC4H4CL2VST-pADH1CPR1 (see Example 47) was grown in a carbon-limited continuous culture with a working volume of 1 liter. The culture was fed with a defined medium according to Verduyn et al. (1992), containing: 5.0 g/L (NH.sub.4).sub.2SO.sub.4; 3.0 g/L KH.sub.2PO.sub.4; 0.5 g/L MgSO.sub.4.7H2O; trace metals and vitamins and 5 g/l glucose and 35 g/l galactose as the growth-limiting nutrients. Antifoam (300 μl/L, Sigma A-8436) was added to avoid foaming. The carbon source was autoclaved separately from the mineral medium and afterwards added to the fermentor. In addition, the vitamin and trace metal solutions were added to the fermentor by sterile filtration following autoclavation and cooling of the medium. The fermentor system was from Sartorius BBI systems and consisted of a baffled 3-liter reactor vessel with 1 liter working volume equipped with Biostat B Plus controller. The reactor vessel was equipped with two Rushton turbines which were rotating at either 1000 rpm, the temperature was kept at 30±1° C., and the pH was kept at 5.5±0.2 by automatic addition of 2M KOH. The gasflow was controlled by a mass flow controller and was set to 1.5 vvm (1.5 l/min). The off-gas was led through a cooled condenser, and was analyzed for O.sub.2 and CO.sub.2 (Model 1308, Innova, Denmark). An initial batch culture with 35 g/l galactose was started by inoculation of the culture with 10 ml of an exponential growing shakeflask culture containing 5 g/l glucose and 35 g/l galactose. The batch cultivation was switched to a continuous mode by feeding the same medium continuously to the reactor. The dilution rate was controlled on a constant level basis, aiming at D=0.050 h.sup.−1. The continuous culture was regarded to be in steady state when both the dilution rate and off-gas signal had not changed for at least five residence times, and when the metabolite concentrations in two successive samples taken at intervals of 1 residence time, deviated by less than 3%. The dissolved-oxygen concentration, which was continuously monitored, was kept above 60% of air saturation. Under said conditions the strain consumed all the galactose, and mainly produced biomass and CO.sub.2, and only minor amounts of ethanol. Moreover, the RQ was close to unity, indicating that metabolism was predominantly in respirative mode.

(137) For the determination of stilbenoids, samples were taken at approximately 300 hrs into fermentation corresponding to 15 residence times. Cells were harvested by centrifugation 5000 g for 5 minutes. For the determination of extracellular levels of stilbenoids, an aliquot of 25 ml of supernatant was extracted once with 10 ml ethyl acetate. The ethyl acetate was freeze dried and the dry product redissolved in 0.6 ml methanol. The samples were than 50-fold diluted in water transferred into HPLC vials, and analyzed by HPLC. Furthermore, to evaluate whether the level of stilbenoids that was produced exceeded the solubility of the medium, or were either bound to the cell-membranes 1 ml aliquots of cell culture, thus including both cells and medium, were mixed with 1 ml of 100% ethanol, and mixed vigorously prior to centrifugation. The supernatant was then transferred into HPLC vials and directly analyzed for the content of stilbenoids. For the determination of intracellular levels of stilbenoids, an aliquot of 50 ml culture was sampled, and cells and medium were separated by centrifugation. The pellet was washed with 50 ml of water to remove any stilbenoids that were cell-bound or trapped into the pellet; after re-centrifugation the pellet was then dissolved in 1 ml water. The resulting cell suspension was distributed into extraction tubes and broken with glass beads using a fast-prep machine. The crude extracts were pooled into 10 ml of 100% methanol, and extracted in a rotary chamber for 24 hours in a dark cold room at 4° C. Thereafter, the cell debris was removed via centrifugation for 5 min. at 5000 g and the remaining methanol was removed by freeze-drying overnight. The dry residue was redissolved in 0.4 ml methanol and 0.1 ml water. The samples were than 50-fold diluted in water and then transferred into HPLC vials, and analyzed by HPLC.

(138) The following table summarizes the results:

(139) TABLE-US-00010 Intracellular and extracellular levels of stilbenoids of PALCPR continuous culture at 300 hrs. 5 g/l glucose, 35 g/l galactose, D = 0.05, pH = 5.5., 1000 rpm Resveratrol Pinosylvin Resveratrol Pinosylvin Resveratrol Pinosylvin Resveratrol Pinosylvin Intracelullar Intracelullar Extracelullar Extracelullar Extracellular Extracellular Total Total (a) (b) (c) (d) In EtOH (e) In EtOH (f) (a + e) (b + f) 2.27 16.45 23.69 12.55 23.65 113.57  25.92 130.02 8.74 12.65 91.43  9.65 91.26  87.35 100.00 100.00 0.25  1.83 — — — — — —

(140) Intracellular levels of stilbenoids were expressed in mg per gram biomass (dry weight), according to the calculation explained in the following section. The concentration of resveratrol and pinosylvin in the extract was determined as 227 mg/l and 1646 mg/l respectively; the volume of the extract was 0.5 ml, hence the absolute amount of resveratrol and pinosylvin extracted was 0.5*227/1000=0.1135 mg and 0.5*1646/1000=0.8230 mg respectively. The stilbenoids were extracted from a 50 ml culture-aliquot and hence the intracellular concentrations of resveratrol and pinosylvin expressed per liter culture were 0.1135*(1000/50)=2.27 mg/l and 0.8230*(1000/50)=16.46 mg/l. The biomass concentration of said culture was 9 g/l. The intracellular resveratrol- and pinosylvin levels expressed per gram dry weight therefore were 2.27/9=0.25 mg/g dry weight and 16.46/9=1.83 mg/g dry weight respectively.

REFERENCES

(141) U.S. Pat. No. 6,521,748 US-A-2001053847 US-A-2004059103 US-A-2004023357 WO2006089898 WO2008/009728 Allina, S. M., Pri-Hadash, A., Theilmann, D. A., Ellis, B. E. and Douglas, C. J. (1998) 4-coumarate: Coenzyme A ligase in hybrid poplar. Properties of enzymes, cDNA cloning, and analysis of recombinant clones. Plant Physiol. 116, 743-754. Aoyama, Y., Yoshida, Y., Kubota, S., Kumaoka, H. and Furumichi, A. (1978). NADPH-cytochrome P-450 reductase of yeast microsomes. Arch. Biochem. Biophys. 185, 362-369. Becker J V, Armstrong G O, van der Merwe M J, Lambrechts M G, Vivier M A, Pretorius I S. (2003). Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine-related antioxidant resveratrol. FEMS Yeast Res. 4, 79-85. Blanquet, S., Meunier, J. P., Minekus, M., Marol-Bonnin, S., and Alric, M. (2003). Recombinant Saccharomyces cerevisiae Expressing P450 in Artificial Digestive Systems: a Model for Biodetoxication in the Human Digestive Environment. Appl. Environ. Microbiol. 69, 2884-2892. Celotti E and others. (1996). Resveratrol content of some wines obtained from dried Valpolicella grapes: Recioto and Amarone. Journal of Chromatography A 730, 47-52. Cochrane, F. C., Davin, L. B. and Lewis N. G. (2004). The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry 65, 1557-1564. Couzin, J. (2004) Aging Research's Family Feud. Science 303, 1276-1279. Ehlting, J., Büttner, D., Wang, Q., Douglas, C. J., Somssich, I. E. and Kombrink, E. (1999). Three 4-coumarate:coenzyme A ligases in Arabidopsis thaliana represents two evolutionary divergent classes in angiosperms. The plant journal. 19, 9-20. Erdeniz N, Mortensen U H, Rothstein R. Cloning-free PCR-based allele replacement methods. Genome Res. 1997:7:1174-83. Filpula, D., Vaslet, C. A., Levy, A., Sykes, A. and Strausberg, R. L. Nucleotide sequence of gene for phenylalanine ammonia-lyase from Rhodotorula rubra. (1988). Nucleic Acids Res. 16, 11381. Gehm, B. D., McAndrews, J. M., Chien, P. Y. and Jameson, J. L. (1997). Resveratrol, a polyphenolic compound found in grapes and wine, is an agonist for the estrogen receptor. Proc. Natl. Acad. Sci. USA 94, 14138-14143. Gems, D., Johnstone, I. L. and Clutterbuck, A. J. (1991). An autonomously replicating plasmid transforms Aspergillus nidulans at high frequency. Gene 98, 61-67. Hain, R., Reif, H. J., Krause, E., Langebartels, R., Kindl, H., Vornam, B., Wiese, W., Schmelzer, E., Schreier, P. H., Stocker, R. H. and Stenzel, K. (1993). Disease resistance results from foreign phytoalexin expression in a novel plant. Nature 361, 153-156. Hwang E I, Kaneko M, Ohnishi Y, Horinouchi S. (2003). Production of plant-specific flavanones by Escherichia coli containing an artificial gene cluster. Appl. Environ. Microbiol. 69, 2699-706. Huang, M-T. (1997). Diet for cancer prevention. Food Sci. 24, 713-727 Hart, J. H. (1981) Annu. Rev. Phytopathology 19, 437-458. Hart, J. H., Shrimpton, D. M. (1979) Phytopathology 69, 1138-1143. Hall, S. S. (2003) In Vino Vitalis? Compounds Activate Life-Extending Genes. Science 301, 1165. Hamberger, B. and Hahlbrock, K. (2004). The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proc. Natl. Acad. Sci. USA. 101, 2209-2214. Jang, M., Cai, L., Udeani, G O., Slowing, K V., Thomas, C F., Beecher, C W W., Fong, H H S., Farnsworth, N R., Kinghorn, A D., Mehta, R G., Moon, R C., Pezzuto, J M. (1997). Cancer Chemopreventive Activity of Resveratrol, a Natural Product Derived from Grapes. Science 275, 218-220. Jeandet, P. Bessis, R., Maume, B. F., Meunier, P., Peyron, D. and Trollat, P. (1995). Effect of Enological Practices on the Resveratrol Isomer Content of Wine J. Agric. Food Chem. 43, 316-319. Jeandet, P. Bessis, R., Sbaghi, M. and Meunier, P. (1994). Occurrence of a resveratrol β-D-glucoside in wine: Preliminary studies. Vitis 33, 183-184. Koopmann, E., Logemann, E. and Hahlbrock, K. (1999). Regulation and Functional Expression of Cinnamate 4-Hydroxylase from Parsley. Plant Physiol. 119, 49-55. Kopp, P. (1998). Resveratrol, a phytooestrogen found in red wine. A possible explanation for the conundrum of the “French Paradox”? Eur. J. Endocrinol. 138, 619-620. Kyndt J A, Meyer T E, Cusanovich M A, Van Beeumen J J. (2002). Characterization of a bacterial tyrosine ammonia lyase, a biosynthetic enzyme for the photoactive yellow protein. FEES Lett. 512, 240-244. LaGrange, D. C., Pretorius, I. S. and Van Zyl, W. H. (1997). Cloning of the Bacillus pumilus beta-xylosidase gene (xynB) and its expression in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 47, 262-266. Lin X., Kaul S., Rounsley S. D., Shea T. P., Benito M.-I., Town C. D., Fujii C. Y., Mason T. M., Bowman C. L., Barnstead M. E., Feldblyum T. V., Buell C. R., Ketchum K. A., Lee J. J., Ronning C. M., Koo H. L., Moffat K. S., Cronin L. A., Shen M., Pai G., Van Aken S., Umayam L., Tallon L. J., Gill J. E., Adams M. D., Carrera A. J., Creasy T. H., Goodman H. M., Somerville C. R., Copenhaver G. P., Preuss D., Nierman W. C., White O., Eisen J. A., Salzberg S. L., Fraser C. M., Venter J. C. (1999). Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature 402, 761-768. Lobo, R. A. (1995). Benefits and risks of estrogen replacement therapy. Am. J. Obstet. Gynecol. 173, 982-989. Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D. and Keasling, J. D. (2003). Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature biotechnology 21, 796-802. Mizutani, M., Ohta, D. and Sato, R. (1997). Isolation of a cDNA and a genomic clone encoding cinnamate 4-hydroxylase from Arabidopsis and its expression manner in planta. Plant Physiol. 113, 755-763. Ro, D. K., Mah, N., Ellis, B. E. and Douglas, C. J. (2001). Functional Characterization and Subcellular Localization of Poplar (Populus trichocarpa×Populus deltoides) Cinnamate 4-Hydroxylase. Plant Physiol. 126, 317-329. Ro D. K., Douglas C. J. (2004). Reconstitution of the entry point of plant phenylpropanoid metabolism in yeast (Saccharomyces cerevisiae): implications for control of metabolic flux into the phenylpropanoid pathway. J. Biol. Chem. 279, 2600-2607. Rosler J, Krekel F, Amrhein N, Schmid J. (1997). Maize phenylalanine ammonia-lyase has tyrosine ammonia-lyase activity. Plant Physiol. 113, 175-179. activity. Plant physiol. 113, 175-179. Samappito, S., Page, J. E., Schmidt, J., De-Eknamkul, W. and Kutchan, T. M. (2003). Aromatic and pyrone polyketides synthesized by a stilbene synthase from Rheum tataricum. Phytochemistry 62, 313-323. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y. Schoppner, A.; Kindl, H. (1984) Purification and properties of a stilbene synthase from induced cell suspension cultures of peanut. J. Biol. Chem. 259, 6806-6811. Seshime, Y., Juvvadi, P. R., Fujii, I. and Kitamoto, K. (2005). Genomic evidences for the existence of a phenylpropanoid metabolic pathway in Aspergillus oryzae. Biochem Biophys Res Commun. 337, 747-51. Urban P., Mignotte, C., Kazmaier M., Delorme F. And Pompon D. (1997). Cloning, Yeast Expression, and Characterization of the Coupling of Two Distantly Related Arabidopsis thaliana NADPH-Cytochrome 450 Reductases with P450 CYP73A5. J. Biol. Chem. 272, 19176-19186. Verduyn C, Postma E, Scheffers W A, Van Dijken J P. Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast. 1992:8:501-17. Watts, K. T., Lee, P. C. and Schmidt-Dannert, C. (2004). Exploring recombinant flavonoid biosynthesis in metabolically engineered Escherichia coli. Chembiochem 5, 500-507.

(142) The following is a summary of the nucleotide and amino acid sequences appearing herein:

(143) SEQ ID NO: 1 is a nucleotide sequence from Arabidopsis thaliana encoding a phenylalanine ammonia lyase (PAL2).

(144) SEQ ID NO: 2 is the amino acid sequence encoded by SEQ ID NO: 1.

(145) SEQ ID NO: 3 is a nucleotide sequence from Arabidopsis thaliana encoding a cinnamate 4-hydroxylase (C4H).

(146) SEQ ID NO: 4 is the amino acid sequence encoded by SEQ ID NO: 3.

(147) SEQ ID NO: 5 is a nucleotide sequence from Arabidopsis thaliana encoding a 4-coumarate:CoenzymeA ligase (4CL1).

(148) SEQ ID NO: 6 is the amino acid sequence encoded by SEQ ID NO: 5.

(149) SEQ ID NO: 7 is a nucleotide sequence from Rheum tataricum encoding a resveratrol synthase (VST).

(150) SEQ ID NO: 8 is the amino acid sequence encoded by SEQ ID NO: 7.

(151) SEQ ID NO: 9 is a nucleotide sequence from Rheum tataricum encoding a resveratrol synthase (VST), which is codon-optimized for expression in S. cerevisiae.

(152) SEQ ID NO: 10 is the amino acid sequence encoded by SEQ ID NO: 9.

(153) SEQ ID NO: 11 is a nucleotide sequence from Rhodobacter capsulatus encoding a tyrosine ammonia lyase (TAL).

(154) SEQ ID NO: 12 is the amino acid sequence encoded by SEQ ID NO: 11.

(155) SEQ ID NO: 13 is a nucleotide sequence from Rhodobacter capsulatus encoding a tyrosine ammonia lyase (TAL), which is codon-optimized for expression in S. cerevisiae.

(156) SEQ ID NO: 14 is the amino acid sequence encoded by SEQ ID NO: 13.

(157) SEQ ID NO: 15 is a nucleotide sequence from S. cerevisiae encoding a NADPH:cytochrome P450 reductase (CPR1).

(158) SEQ ID NO: 16 is the amino acid sequence encoded by SEQ ID NO: 15.

(159) SEQ ID NO: 17 is a nucleotide sequence from Arabidopsis thalianus encoding a NADPH:cytochrome P450 reductase (AR2).

(160) SEQ ID NO: 18 is the amino acid sequence encoded by SEQ ID NO: 17.

(161) SEQ ID NOs 19-32 are primer sequences appearing in Table 1, Example 1.

(162) SEQ ID NOs 33-34 are primer sequences appearing in Example 16.

(163) SEQ ID NOs 35-38 are primer sequences appearing in Example 17.

(164) SEQ ID NOs 39-46 are primer sequences appearing in Example 36, Table 1.

(165) SEQ ID NOs 47-58 are primer sequences appearing in Example 37, Table 2.

(166) SEQ ID NO: 59 is the gene sequence appearing in Example 39.

(167) SEQ ID NO: 60 is the first gene sequence appearing in Example 41.

(168) SEQ ID NOs 61-62 are primer sequences appearing in Example 41.

(169) SEQ ID NO: 63 is the VST1 amino acid sequence in Example 41.

(170) SEQ ID NO. 64 is the second gene sequence appearing in Example 41.