Aptamers against glioma cells

09834771 · 2017-12-05

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are aptamers able to bind to ligands associated with cancer cells. The ligands may particularly be associated with brain cancers, such as gliomas. The aptamers may be used therapeutically for the prevention and/or treatment of such cancers. Aptamers may be associated with anti-cancer agents, or with detection moieties. Also provided are pharmaceutical compositions and methods of treatment employing such aptamers.

Claims

1. An aptamer, comprising a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; and SEQ ID NO: 11 or a ligand-binding fragment of the aptamer.

2. An aptamer according to claim 1, or a ligand-binding fragment thereof, in association with an anti-cancer agent.

3. An aptamer according to claim 2, or a ligand-binding fragment thereof, wherein the aptamer, or ligand-binding fragment, and the anti-cancer agent are conjugated with one another.

4. An aptamer according to claim 2, wherein the aptamer and anti-cancer agent are indirectly associated with one another.

5. An aptamer according to claim 4, wherein the anti-cancer agent is associated with a carrier selected from the group consisting of a nanoparticle, and a dendrimer.

6. An aptamer according to claim 2, or a ligand-binding fragment thereof, wherein the anti-cancer agent is selected from the group consisting of a radionuclide, a nanoparticle, a nanocage, a gene silencing agent, and a cytotoxic chemical.

7. An aptamer according to claim 6, wherein the gene silencing agent is selected from the group consisting of an siRNA molecule, a ribozyme, and an antisense oligonucleotide.

8. An aptamer according to claim 7, wherein the gene silencing agent prevents or inhibits expression of Ky70, Ku80, or both Ky70 and Ku80.

9. An aptamer according to claim 1, or ligand-binding fragment thereof, in association with a detection moiety.

10. An aptamer according to claim 9, or a ligand-binding fragment thereof, wherein the detection moiety is selected from the group consisting of a radionuclide, a dye, a fluorophore, a nanoparticle, a nanocage and a chromogenic agent.

11. An aptamer according to claim 1, consisting of a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 6; SEQ ID NO: 7; SEQ ID NO: 8; SEQ ID NO: 9; SEQ ID NO: 10; and SEQ ID NO: 11.

12. A ligand-binding fragment of an aptamer according to claim 1, wherein the fragment retains the capacity to bind to a ligand associated with cancer cells.

13. A pharmaceutical composition comprising an aptamer according to claim 1, or a ligand-binding fragment thereof, and a pharmaceutically acceptable excipient.

14. A pharmaceutical composition according to claim 13, formulated to provide a therapeutically effective amount of the aptamer in a dosage unit of the pharmaceutical composition.

15. A pharmaceutical composition according to claim 13, wherein the aptamer is in association with an anti-cancer agent and wherein the composition is formulated to provide a therapeutically effective amount of the anti-cancer agent associated with the aptamer.

16. A method of treating cancer in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition according to claim 13.

17. A method of treating cancer in a subject, the method comprising administering to a subject in need thereof a therapeutically effective amount of an aptamer according to claim 1, or a ligand-binding fragment thereof.

18. An oligonucleotide sharing at least 75% sequence identity with any one of SEQ ID NOS: 6 to 11.

19. An oligonucleotide according to claim 18 sharing at least 95% sequence identity with any one of SEQ ID NOS: 6 to 11, wherein the oligonucleotide retains the same binding profile as the aptamer of SEQ ID NOS: 6 to 11.

20. An aptamer according to claim 6, or a ligand-binding fragment thereof, wherein the nanoparticle comprises a nanoshell.

21. An aptamer according to claim 10, or a ligand-binding fragment thereof, wherein the nanoparticle comprises a nanoshell.

22. A method according to claim 16, wherein the cancer is brain cancer.

23. A method according to claim 22, wherein the brain cancer is selected from the group consisting of gliomas, meningiomas, pituitary adenomas, and nerve sheath tumors.

24. A method according to claim 22, wherein the brain cancer is a glioma.

25. A method according to claim 16, wherein the aptamer is in association with the anti-cancer agent and wherein the composition is formulated to provide a therapeutically amount of the anti-cancer agent associated with the aptamer.

26. A method according to claim 25, wherein the aptamer and the anti-cancer agent are directly associated with each other.

27. A method according to claim 25, wherein the aptamer and the anti-cancer agent are indirectly associated with each other.

28. A method according to claim 16, wherein the composition is administered orally.

29. A method according to claim 16, wherein the composition is administered via injection.

Description

(1) The invention will now be further described with reference to the following Experimental Results, and accompanying Figures, in which:

(2) FIG. 1 sets out representative photomicrographs illustrating the results of confocal imaging, with Cy3 labelled aptamers and DAPI nuclear counterstain, in a range of cell types.

(3) FIG. 2 sets out representative plots achieved in a flow cytometry study using Cy3 labelled aptamers with a range of cell types.

(4) FIG. 3 illustrates active uptake of aptamers of the invention by glioma cells.

(5) FIG. 4 summarises the data shown in FIG. 3.

(6) FIG. 5 sets out representative photomicrographs showing the results of labelling in non-cancerous brain or samples from Grade I-IV gliomas with aptamers of the invention or with a negative control aptamer.

(7) FIG. 6 illustrates that cellular binding of the aptamer of SEQ ID NO: 2 (GL43) is specific for gial and neuronal cells.

(8) FIG. 7 shows an image of a stained SDS-PAGE gel on which proteins from U87 cells have been separated. Lanes labelled SA44IP and SA43IP contain proteins isolated by immunoprecipitation (IP—more properly referred to as aptamerprecipitation, AP, since antibodies are not used) using aptamers of the invention.

(9) FIG. 8 shows an image of a stained SDS-PAGE gel on which proteins from 1321N1 cells have been separated. Lanes labelled SA44IP and SA43IP contain proteins isolated by immunoprecipitation (IP—more properly referred to as aptamerprecipitation, AP, since antibodies are not used) using aptamers of the invention.

(10) FIG. 9 shows an image of a stained SDS-PAGE gel on which proteins from cells of the Grade IV glioblastoma multiforme primary cell line 9114 have been separated. Lanes labelled SA44AP and SA43AP contain proteins isolated by aptamerprecipitation (AP) using aptamers of the invention.

(11) FIG. 10 shows an image of a stained SDS-PAGE gel on which proteins from cells of the Grade IV glioblastoma multiforme primary cell line 9111 have been separated. Lanes labelled SA44AP and SA43AP contain proteins isolated by aptamerprecipitation (AP) using aptamers of the invention.

(12) FIG. 11 illustrates the top five significant protein hits from areas of the gel shown in FIG. 7 that have been analysed by mass spectroscopy.

(13) FIG. 12 illustrates the top five significant protein hits from areas of the gel shown in FIG. 8 that have been analysed by mass spectroscopy.

(14) FIG. 13 illustrates the results of Western blotting on lysates of U87 cells. This figure illustrates the ability of the aptamers of the invention SA43 to aptamerprecipitate and thus “pull down” Ku 70 from cell lysates, thus demonstrating the specificity of SA43 for the Ku complex. The lane labelled “input” is a whole cell lysate. Lanes labelled “SA43”, “SA44”, and “Control” respectively illustrate the products bound within U87 cell lysates by the aptamers of the invention SA43, the control aptamers “SA44”, and a whole cell lysate without aptamer. Proteins from the gel were transferred to a nitrocellulose membrane, and the membrane probed with an antibody specific to Ku 70. As can be seen, only the “Input” and “SA43” lanes contained Ku protein, indicating the specificity of SA43.

EXPERIMENTAL RESULTS 1

(15) Binding of the aptamers of the invention to ligands associated with cancer cells, and the specificity of this binding was investigated and demonstrated in the following studies.

(16) Aptamers of the invention (as set out below) were used to label cultured cancer and non-cancer cells and to perform flow cytometry cn such cells, and also to label histological sections of non-cancerous brain tissue, and also sections of tissue taken from gliomas of Grades I to IV.

(17) The aptamers used were as follows: SEQ ID NO: 1 (also referred to as SA44 or GL44) SEQ ID NO: 2 (also referred to as SA43 or GL43) SEQ ID NO: 3 (also referred to as SA56 or GL56)

(18) As a control, the same labelling protocols were also followed using SEQ ID NO:4 (also referred to as CL44) or a randomly generated sequence (designated “neg aptamer”) as follows: CCG UUA AUU AGG CCC UUA AAU GGC AUA AAA UUU GAA AGG GAA U

(19) More details of the studies undertaken are provided below.

(20) Materials and Methods

(21) Cell Lines and Cell Culture:

(22) The experiments were carried out using different grades of human glioma cell lines including 1321N1 (grade II astrocytoma), U87MG (grade IV glioblastoma), T98G (grade IV glioblastoma) and non-cancerous foetal astrocytes SVGp12 (Table 2.1). The cell lines were obtained from the European Collection of Cell Cultures (ECACC), UK and American Type Culture Collection (ATCC). Two other non-glioma cell lines were also utilised including MCF-7 (breast cancer) and T24 (bladder cancer). Media and supplements for each cell line used were in accordance with recommendation of ECACC and ATCC. All cell lines were maintained in a 37° C. humidified incubator with 5% CO.sub.2 and 75 cm.sup.2 tissue culture flasks (Thermo Scientific Nune, UK). The cell lines were harvested when they reached 70-80% confluence and were used between passages 5-25.

(23) Cellular Uptake and Localisation:

(24) Confocal Microscopy:

(25) Glial cell lines (1321N1, U87MG, T98G and SVGp12), breast cancer cell line (MCF-7) and bladder cancer cell line (T24) were cultured and seeded on coverslips of 24 well plates at a seeding density of 1×10.sup.4 cells/ml in their individual media supplemented with FBS and penicillin/streptomycin mixture. Confluent cell lines were then incubated with a particular concentration aptamer at 37° C. for 90 minutes. The cells were then washed 3× with PBS to remove the unbound aptamer. The cells were then fixed with 4% Paraformaldehyde (PFA) for 15 minutes at room temperature. After fixing, the cells were counter-stained with VECTASHIELD mounting medium with DAPI (Vector laboratories, UK) to stain the nucleus. Images of aptamer binding to cells were acquired using a Zeiss LSM 510 META confocal microscope applying the same instrument settings (Amplifier gain: 1, Detector gain: 1092, Amplifier offset: −0.06).

(26) Flow Cytometric Assay:

(27) Glial cell lines (1321N1, U87MG, T98G and SVGp12), breast cancer cell line (MCF-7) and bladder cancer cell line (T24) were allowed to grow on 24 well plates until they reached 80% confluency. The cells were washed with 1×PBS and incubated with suitable concentration of the aptamers at 37° C. (5% CO.sub.2) for 90 minutes. The cells were subsequently washed 3 times with 1×PBS followed by the treatment of 1× trypsin into each well and incubated at 37° C. for 2 minutes to detach the adherent cells. 2 minutes after the trypsin treatment, the well plates was tapped gently and viewed under the inverted light microscope to ensure for the detachment of cells. A volume of 0.3 ml of media was then added and the cell suspension was then transferred to an eppendorf tube. The cells were then centrifuged at 224 g for 5 minutes. After centrifugation, the supernatant was aspirated and the pellet was then flicked and resuspended with 300 μl of 1×PBS and mixed well and ready for flow cytometry analysis. Analysis was performed on flow cytometer using PE (phycoerythrin) laser at an excitation at 488 nm and emission at 578 nm where 10,000 events were collected for each sample.

(28) Immunohistochemistry Using Biotin Labelled Aptamers:

(29) The study also involved screening of the aptamers on a serial tissue sections from BTNW bank with different grades of glioma including grade I, grade II, grade III, grade IV glioblastoma and non-cancerous brain from 45 different patients.

(30) For aptamer staining, each excised tumour tissue sample and non-tumour portion were fixed and serially sectioned (4 mm), as formalin-fixed, paraffin-embedded slides by pathologists from the hospital. These paraffin-embedded tissue slides were deparaffinised with 2 changes of Histoclear, 15 minutes each and rehydrated through graded ethanol, 5 minutes each. The tissue slides were rinsed with distilled water and then underwent antigen retrieval step with 0.01 M citrate buffer at 97° C. for 20 minutes before the experiment. The sections were rinsed in PBS twice for 2 minutes each. To mask endogenous biotin binding, sections were treated with biotin-blocking solution (Vector laboratories) for 30 minutes and then washed 3 times with PBS, following manufacturer's instructions. The tissue slides where then incubated with 100 nM biotin labelled aptamers for 60 minutes at room temperature. The slides were then washed 3 times with PBS, 5 minutes each wash. The slides were then incubated with VECTASTAIN® ABC reagent for 30 minutes at room temperature. After three washes with PBS solution, the tissues sections were subsequently treated with 200 μl of DAB peroxidase substrate solution (Dako) for colour development at room temperature for 10 min. Counterstaining of the cell nuclei in tissue sections was performed with the haematoxylin solution for 5 minutes following routine laboratory protocol to dehydrate and mount the sections. The treated tissues were then examined under a light microscope.

(31) Screening of Cy3 Labelled Aptamers on Cell Lines

(32) Aptamers SA44 (GL44), SA43 (GL43), SA56 (GL56), control aptamer CL44, and “neg” were tagged with Cy3 fluorescent dye. Binding of the tagged aptamers was screened on cell lines and their binding specificity was analysed using Z stacks and 3D confocal imaging. Representative photomicrographs illustrating the results of the confocal imaging are set out in FIG. 1.

(33) Binding of aptamers was investigated in connection with the following cell lines: U87MG—cells derived from a Grade IV glioma 1321n1—cells derived from a Grade II glioma SVGp12—non-cancerous foetal astrocyte cells T98G—cells from a Grade IV glioma, though less tumourigenic than U87MG T24—cells of a bladder cancer cell line MCF7—cells of a breast cancer cell line

(34) Aptamers SA44 (GL44) and SA43 (GL43) showed higher binding capacity on U87MG glioma cell line compared to non-cancerous SVGp12 cells. As can be seen in FIG. 1, the aptamers were selective for cancerous, rather than non-cancerous, cells.

(35) Binding of Cy3 tagged aptamers SA44 (GL44), SA43 (GL43) and SA56 (GL56) to the cell lines was also quantified using flow cytometry. Representative plots of the results achieved are shown in FIG. 2. The same pattern of aptamer binding, with specificity for U87MG as opposed to SVGp12 cells, was observed

(36) Active Uptake of the Aptamers of the Invention into Glioma Cells

(37) Results of the study investigating active uptake of the aptamers of the invention by glioma cells is shown in FIG. 3, and the results shown in this Figure summarised in FIG. 4.

(38) Briefly, FIG. 4 illustrates that when aptamers of the invention are incubated with cells of glioma cell lines at 4° C. there is substantially no uptake of the aptamers into cells. However, when the aptamers are incubated with examples of the same cell lines at 37° C., a temperature at which metabolic processes of the cells are active, the aptamers (here illustrated with reference to SA44 or SA43) are taken into the cells. This active uptake, results of which are summarised in FIG. 4, represents a useful process by which the aptamers of the invention are able to enter into glioma cells, consistent with the uses of these aptamers in therapeutic or diagnostic (such as labelling) applications.

(39) Labelling of Tissues

(40) Aptamers of the invention (as set out above), control aptamer CL44, or the “neg” negative control aptamer, were used to label histological sections of non-cancerous brain tissue, and also sections of tissue taken from gliomas of Grades I to IV.

(41) In total the binding of each of these aptamers (the aptamers of the invention, control and the “neg” aptamer) was investigated in: 9 samples of non-cancerous brain, 7 samples of Grade I gliomas, 9 samples of Grade II gliomas, 10 samples of Grade III gliomas, and 10 samples of Grade IV gliomas.

(42) Representative photomicrographs showing the results of this labelling are set out in FIG. 5. Each panel of this Figure illustrates labelling of a different aptamer (either an aptamer of the invention, control or the neg aptamer) in non-cancerous brain or samples from Grade I-IV gliomas.

(43) Specific binding of the aptamer is illustrated by the generation of a dark stain at the site of the labelling. Cell nuclei within the samples are visualised by haematoxylin counter-stain.

(44) From reviewing the Figures, it can be seen that cellular labelling with the aptamers of the invention (but not the control or neg aptamer) was increased in gliomas as compared to non-cancerous tissue, and the extent of labelling rose as the Grade of glioma increased.

(45) 45 different primary tissues from grade I (n=7), grade II (n=9), grade III (n=10), grade IV (n=10) and non-cancerous brain (n=9) were screened with biotin labelled aptamers and quantified using an established IHC scoring system, details of which are shown in Table 1. A total score of ≦3 was considered as negligible binding.

(46) TABLE-US-00001 TABLE 1 Score for staining intensity Score for proportion staining 0 = no staining 0 = no staining 1 = weak staining 1 = <1% staining 2 = moderate staining 2 = 1-10% staining 3 = strong staining 3 = 11-33% staining 4 = 34-66% staining 5 = 67-100% staining

(47) In order to determine statistical differences a K-S and Shapiro-Wilk normality test was performed on flow cytometry data and results were analysed using Mann-Witney test. For tissue sections, the Fisher's exact test was performed whereby tissue sections with a total score above 3 were considered positive.

(48) The results of these statistical analyses, in which P<0.05 was considered to be statistically significant, are shown in Table 2.

(49) TABLE-US-00002 TABLE 2 SA44 (GL44) No. of total SA43 (GL44) No. of total Grade (total patients with score more patients with score more patients) than 2/total no. of patients than 2/total no. of patients I (7) 7/7 (p = 0.0885) 6/7 (p = 0.0406) II (9) 3/9 (p = 0.6372) 3/9 (p = 1.000) III (10) 8/10 (p = 0.3498) 9/10 (p = 0.0055) IV (10) 8/10 (p = 0.3498) 8/10 (p = 0.0230) Non-cancerous 5/9 2/9 brain

EXPERIMENTAL RESULTS 2

(50) The study described above was expanded by the addition of 3 further non-cancerous and 5 further grade II glioma patient tissue samples, to give a cohort as follows: 12 samples of non-cancerous brain, 7 samples of Grade I gliomas, 14 samples of Grade II gliomas, 10 samples of Grade III gliomas, and 10 samples of Grade IV gliomas.

(51) Statistical analysis of this expanded cohort provided further clarification of the ability of the aptamers of the invention to distinguish between non-cancerous brain or samples from Grade I-IV gliomas as set out in Table 3.

(52) TABLE-US-00003 TABLE 3 SA44 (GL44) No. of total SA43 (GL43) No. of total Grade (total patients with score more patients with score more patients) than 2/total no. of patients than 2/total no. of patients I (7) 7/7 (p = 0.2451) 6/7 (p = 0.0063) II (14) 8/14 (p = 0.7015) 8/14 (p = 0.0511) III (10) 8/10 (p = 0.6462) 9/10 (p = 0.0019) IV (10) 8/10 (p = 0.6462) 8/10 (p = 0.0083) Non-cancerous 5/12 2/12 brain

(53) FIG. 6 illustrates that cellular binding of the aptamer of SEQ ID NO: 2 (GL43) is specific for gial and neuronal cells. As shown, this aptamers does not label Purkinje cells (unlabelled in Panel A), endothelial cells (Panel B), or meningioma cells (Panel C) in tissue samples.

EXPERIMENTAL RESULTS 3

(54) The ligands bound by the aptamers of the invention were investigated as follows.

(55) Cells of two human glioma cell lines (1321N1: grade II astrocytoma; and U87MG: grade IV glioblastoma), as referred to before, were cultured, and then lysed to obtain extracts of the proteins they expressed.

(56) Samples of these extracts were then incubated with either the aptamer of SEQ ID NO: 2 or the aptamer of SEQ ID NO: 1, in conditions allowing the aptamers to bind their corresponding ligands. Labelled beads capable of binding to the aptamers were then added to this incubation mixture.

(57) The beads, aptamers, and ligands bound to the aptamers were then allowed to precipitate and collected (referred to as the “immunoprecipitate” “IP”). The supernatant, containing non-bound proteins of the extracts was also retained (referred to as the “input”).

(58) Immunoprecipitates and inputs were then individually processed and the proteins separated by SDS polyacrylamide gel electrophoresis (SDS-PAGE). Gels were stained using Coomassie blue to allow visualisation of the protein bands. Images of exemplary stained gels are shown in FIGS. 7 and 8.

(59) Portions of the gels containing bands comprising proteins that had been isolated from the extracts by immunoprecipitation were then excised and processed to allow further analysis of the proteins present by mass spectroscopy. Illustrative examples of the areas removed for further investigation are shown in FIGS. 7 and 8.

(60) In these FIG. 7, “SA44IP” and “SA43IP” respectively denote the lanes containing immunoprecipitates produce on incubation with the aptamers of SEQ ID NO: 1 and SEQ ID NO: 2. Lanes labelled “Input 1” and “Input 2” contained proteins from the corresponding supernatants remaining after immunoprecipitation.

(61) Results produce by the mass spectroscopy analysis are illustrated in FIGS. 11 and 12. Here, details are provided of the top five significant proteins identified in each of the areas of the gel analysed further by mass spectroscopy. The proteins identified are known to form or be associated with the Ku heterodimer, thus identifying the members of this heterodimer (Ku70 and/or Ku80) as the ligand for aptamer SA43 (SEQ ID NO: 2).

(62) Data for the corresponding analysis of the ligands bound by aptamer SA44 (SEQ ID NO: 1) are not shown.

CONCLUSIONS AND FURTHER RESEARCH

(63) Aptamers of the invention, particularly SA44 and SA43 (also designated GL44 and GL43) aptamers, showed significant difference (p<0.05) in binding selectivity towards U87Mg cells compared to SVGp12 cells.

(64) SA43 (GL43) aptamer showed significant difference (p<0.05) in binding selectivity towards grade I, III and IV glioma tissues compared to the non-cancerous brain tissues.

(65) Future studies will include co-localisation of SA43 (GL43) aptamer with different biomarkers such as GFAP and CD31 to confirm their localisation in the tissue sections.

(66) Future studies will also include generating an aptamer against grade II gliomas.

(67) Drug conjugated with an aptamer will be studied to explore the possible applications in targeted delivery of drug to cancer cells.

Sequence Information

(68) TABLE-US-00004 SEQ Also ID NO. designated Sequence  1 SA44 or ACG UUA CUC UUG CAA CAC CCA AAC GL44 UUU AAU AGC CUC UUA UAG UUC  2 SA43 or ACG UUA CUC UUG CAA CAC AAA CUU GL43 UAA UAG CCU CUU AUA GUU C  3 SA56 or UGA UUU UGC AGC ACU UCU UGU UAU GL56 CUU AAC GAA CUG UUG AUG A  4 CL44 GGAAAAUUAUACCCUCCAUUAAAUCCACCAU UACCACACCCUUUA  5 U87TDM1 GTAGGGACTTAGCTCTCACCGTATGGCATGC GTAGTACTGAGAGTGTGGG  6 U87TDM2 CACTCCAAAACTCACCTGAACTGTAATAGGG GATGTGTGCTACACTATCG  7 U87TDM3 GGCACATTCCGACACGGGTTGGCGGTTTGGG ATTGATGAACTGGCAGTTG  8 U87TDM6 GCGTATCGACCACAAACAATAAGGTTACCTG ATCTAGTACGGGTTGTTT  9 U87TDM7 GCGGCAGCTGTGCCCGTGCTGCGTCTAGACT CGTGATGAGAAGGAGGGCT 10 U87TDM9 CGCTCATTCGTGGATGATTAATGCGGAGCGT GGTGGGAAGCGGGCAGCGG 11 U87TDM10 CCGCTAGTGGGCGGACGATGCGTGGGATAGG GGGGCGAATTGGGGGATTT 12 Neg CCG UUA AUU AGG CCC UUA AAU GGC aptamer AUA AAA UUU GAA AGG GAA U

(69) A note on nomenclature used: the aptamers of the invention of SEQ ID NOS: 1, 2, and 3 were originally referred to as GL44, GL43, and GL56 respectively. The inventors then determined that these same designations had previously been applied by others to different aptamers (i.e. aptamers that did not share the sequences set out above), and so the aptamers of SEQ ID NOS: 1, 2, and 3 have subsequently (and preferably) been referred to as SA44, SA43, and SA56 respectively, in order to avoid confusion.