Thermostable trichoderma cellulase
09828591 · 2017-11-28
Assignee
Inventors
- ANDREI MIASNIKOV (UNION CITY, CA, US)
- Michael Schelle (San Francisco, CA, US)
- Michael Ward (San Francisco, CA)
Cpc classification
C12Y302/01004
CHEMISTRY; METALLURGY
C12N9/2437
CHEMISTRY; METALLURGY
International classification
Abstract
Described are compositions and methods relating to the thermostable fungal cellulase enzyme, EGV, and Trichoderma host cells having a modification comprising or consisting essentially of disruption or deletion of nucleotide(s) for expression of this cellulose, whereby EGV expression is prevented.
Claims
1. A method for making a thermostable polypeptide of interest in a Trichoderma host cell modified by substantially reducing or preventing production of a thermostable endoglucananse V (EGV) by the Trichoderma host cell, and further modified to express a thermostable polypeptide of interest wherein at least one non-thermostable non-mutated endogenous polypeptide and the exogenous thermostable polypeptide of interest is each expressed in vivo by the Trichoderma host cell, and said method comprising: incubating the modified host cell in a medium suitable for the modified host cell to produce the thermostable polypeptide of interest and the non-thermostable non-mutated endogenous polypeptide, whereby each of the endogenous polypeptide and the thermostable polypeptide of interest each is expressed by the modified host cell; and subjecting the thermostable polypeptide of interest and the non-thermostable non-mutated endogenous polypeptide to an elevated temperature, wherein the elevated temperature is sufficient to substantially inactivate the non-thermostable non-mutated endogenous polypeptide, but insufficient to inactivate the thermostable polypeptide of interest and EGV if it were present; whereby the thermostable polypeptide of interest is produced in active or functional form substantially in the absence of activity from the non-thermostable non-mutated endogenous polypeptide.
2. The method of claim 1 further comprising isolating a protein mixture from the modified Trichoderma host cell prior to the step of subjecting the polypeptide of interest and the endogenous polypeptide to the elevated temperature.
3. The method claim 1 wherein the modified host cell expresses an exo-cellobiohydrolase, an endoglucanase, a β-glucosidase, or combinations thereof.
4. The method of claim 1, wherein the thermostable polypeptide of interest is reversibly heat-denaturable.
5. The method of claim 1, wherein the elevated temperature is a temperature of about 90° C. or more.
6. The method of claim 1, wherein exposure to the elevated temperature is for a time of about 5 minutes or more.
7. The method of claim 1, wherein exposure to the elevated temperature is for a time of about 60 minutes or more.
8. The method of claim 1, wherein the modification comprises one or more deletion or disruption in nucleotides involved in expression of EGV.
9. The method of claim 8, wherein the disruption or deletion comprises deletion or disruption of the gene encoding or the coding region for or the promoter or regulatory elements for expression of EGV.
10. The method of claim 9, wherein the deletion or disruption comprises deletion or disruption of egl5.
11. The method of claim 1, wherein the endogenous polypeptide comprises a cellulase, a hemi-cellulase, a protease, or combinations thereof.
12. The method of claim 1, wherein the Trichoderma is T. reesei.
13. The method of claim 1, wherein the polypeptide of interest is hydrophobia II.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following Detailed Description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
DETAILED DESCRIPTION
(16) Prior to describing the present compositions and methods in detail, the following terms are defined for clarity. Terms not defined should be accorded their ordinary meanings as used in the relevant art.
(17) As used herein, a “cellulase” is an enzymes that hydrolyzes β-1,4-glucan or β-D-glucosidic linkages, resulting in, e.g., the formation of glucose, cellobiose, cellooligosaccharides, and the like from cellulose. Cellulases include, e.g., endoglucanases, exoglucanases, β-glucosidases, and the like.
(18) As used herein, an “endoglucanases (EG)” is a cellulase that acts mainly on the amorphous parts of the cellulose fibre to hydrolyze internal β-1,4-glucosidic bonds in regions of low crystallinity.
(19) As used herein, the terms “hemicellulase” and “xylanase” are used interchangeably to refer generally to enzymes capable of hydrolyzing glycosidic bonds in polysaccharides comprising 5-carbon sugars. Such enzymes include, e.g., mannanases, arabinanases, glucuronidases, acetylxylan esterases, arabinofuranosidases, xylosidases, and the like.
(20) As used herein, “Trichoderma reesei” (or T. reesei) refers to a filamentous fungus of the phylum Ascomycota. This organism was previously known as Hypocrea jecorina.
(21) As used herein, the phrase “T. reesei EGV cellulase” refers to a polypeptide having the amino acid sequence of SEQ ID NO: 33 or a related polypeptide. A related polypeptide has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with SEQ ID NO: 33, has endoglucanase activity on a cellulose substrate, and is thermostable using the assays described, herein. “EGV” may be referred to, herein, as “EG5.”
(22) As used herein, the phrase “T. reesei egl5 gene” or “egl5” refers to a nucleic acid that encodes EGV cellulase, or a related polypeptide, as described herein. The nucleotide sequence of an exemplary egl5 is shown as SEQ ID NO: 32. An amino acid sequence for EGV is shown in SEQ ID NO: 33.
(23) As used herein, the term “thermostable,” with respect to a polypeptide, refers to the ability of a polypeptide to retain biological activity after being subjected to a preselected elevated temperature for a preselected period of time. The biological activity may be an enymatic activity, a binding activity, a surface active property, or any other activity or property characteristic of the polypeptide. A polypeptide is considered thermostable if is maintains at least one-half of its original activity following exposure to the preselected elevated temperature for the preselected period of time. In broad terms, the preselected temperature and time are those required to substantially inactivate T. reesei cellulases other than EGV. These conditions can readily be established by assaying for cellulase activity in a T. reesei host cell comprising or consisting essentially of an egl5 deletion.
(24) In some case, a protein is considered to be thermostable if it retains at least one-half (i.e., at least 50%) of its biological activity following exposure to a temperature of at least about 70° C., at least about 75° C., at least about 80° C., at least about 85° C., at least about 90° C., or even at least about 95° C., for a time of at least about 3 minutes, at least about 5 minutes, at least about 10 minutes, at least about 15 minutes, at least about 20 minutes, at least about 30 minutes, at least about 45 minutes, or even at least about 60 minutes. In one example, the preselected temperature is about 90° C. or greater and the preselected time is about 5 minutes or greater. In another example, the preselected temperature is about 90° C. or greater and the preselected time is about 60 minutes or greater. Thermostable polypeptides include polypeptides that are reversibly denatured at an elevated temperatures, such that at least one-half (i.e., at least 50%) of their biological activity is restored following exposure as described.
(25) As used herein, the terms “heat-labile,” “non-thermostable,” and “thermolabile,” with respect to a polypeptide, are used interchangeably to refer to the inability of a polypeptide to retain biological activity after being subjected to a preselected elevated temperature for a preselected period of time. The biological activity may be an enymatic activity, a binding activity, a surface-active property, or any other activity or property characteristic of the polypeptide. A polypeptide is considered heat-labile if is loses at least 90%, at least 95%, at least 97%, at least 99%, or even essentially 100% of its original activity following exposure to the preselected elevated temperature for the preselected period of time. Such temperatures and times are described immediately above, and elsewhere in the present description. No restrictions are placed on the number or types of heat-labile polypeptides. Examples include but are not limited to cellulases, hemicellulases, proteases, lipases, amylases, esterases, perhydrolases, phytases, laccases, and other commercially-relevant enzymes, binding proteins, and structural proteins.
(26) As used herein, the phrase “protein of interest” refers to a polypeptide, other than EGV, that is desired to be expressed in “T. reesei. Such a protein may be an enzyme, a binding protein, a surface-active protein, a structural protein, or the like. A protein of interest may be thermostable or thermolabile. Where specified, it is thermostable.
(27) As used herein, the phrase “substantially free of an activity” (or similar phrases) means that a specified activity is either undetectable in an admixture of polypeptides, or present in an amount that would not interfere with the intended purpose of the admixture.
(28) As used herein, the terms “polypeptide” and “protein” are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. The conventional one-letter or three-letter code for amino acid residues is used herein. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
(29) As used herein, functionally and/or structurally similar proteins are considered to be “related proteins.” Such proteins may be derived from organisms of different genera and/or species, or even different classes of organisms (e.g., bacteria and fungus). Related proteins also encompass homologs determined by primary sequence analysis, determined by secondary or tertiary structure analysis, or determined by immunological cross-reactivity.
(30) As used herein, the term “derivative polypeptide/protein” refers to a protein which is derived from a protein by addition of one or more amino acids to either or both the N- and C-terminal end(s), substitution of one or more amino acids at one or a number of different sites in the amino acid sequence, deletion of one or more amino acids at either or both ends of the protein or at one or more sites in the amino acid sequence, and/or insertion of one or more amino acids at one or more sites in the amino acid sequence. The preparation of a protein derivative may be achieved by modifying a DNA sequence which encodes for the native protein, transformation of that DNA sequence into a suitable host, and expression of the modified DNA sequence to form the derivative protein.
(31) Related (and derivative) proteins include “variant proteins.” Variant proteins differ from a reference/parent protein, e.g., a wild-type protein, by substitutions, deletions, and/or insertions at small number of amino acid residues. The number of differing amino acid residues may be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. Variant proteins share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with a reference protein. A variant protein may also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, and the like.
(32) As used herein, the term “analogous sequence” refers to a sequence within a protein that provides similar function, tertiary structure, and/or conserved residues as the protein of interest (i.e., typically the original protein of interest). For example, in epitope regions that contain an alpha-helix or a beta-sheet structure, the replacement amino acids in the analogous sequence preferably maintain the same specific structure. The term also refers to nucleotide sequences, as well as amino acid sequences. In some embodiments, analogous sequences are developed such that the replacement amino acids result in a variant enzyme showing a similar or improved function. In some embodiments, the tertiary structure and/or conserved residues of the amino acids in the protein of interest are located at or near the segment or fragment of interest. Thus, where the segment or fragment of interest contains, for example, an alpha-helix or a beta-sheet structure, the replacement amino acids preferably maintain that specific structure.
(33) As used herein, the term “homologous protein” refers to a protein that has similar activity and/or structure to a reference protein. It is not intended that homologs necessarily be evolutionarily related. Thus, it is intended that the term encompass the same, similar, or corresponding enzyme(s) (i.e., in terms of structure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homolog that has a quaternary, tertiary and/or primary structure similar to the reference protein. In some embodiments, homologous proteins induce similar immunological response(s) as a reference protein. In some embodiments, homologous proteins are engineered to produce enzymes with desired activity(ies).
(34) The degree of homology between sequences may be determined using any suitable method known in the art (see, e.g., Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol., 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. USA 85:2444; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, Wis.); and Devereux et al. (1984) Nucleic Acids Res. 12:387-395).
(35) For example, PILEUP is a useful program to determine sequence homology levels. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pair-wise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Dooittle, (Feng and Doolittle (1987) J. Mol. Evol. 35:351-360). The method is similar to that described by Higgins and Sharp (Higgins and Sharp (1989) CABIOS 5:151-153). Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps. Another example of a useful algorithm is the BLAST algorithm, described by Altschul et al. (Altschul et al. (1990) J. Mol. Biol. 215:403-410; and Karlin et al. (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787). One particularly useful BLAST program is the WU-BLAST-2 program (See, Altschul et al. (1996) Meth. Enzymol. 266:460-480). Parameters “W,” “T,” and “X” determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word-length (W) of 11, the BLOSUM62 scoring matrix (See, Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M′5, N′-4, and a comparison of both strands.
(36) As used herein, the phrases “substantially similar” and “substantially identical,” in the context of at least two nucleic acids or polypeptides, typically means that a polynucleotide or polypeptide comprises a sequence that has at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or even at least about 99% identity, or more, compared to the reference (i.e., wild-type) sequence. Sequence identity may be determined using known programs such as BLAST, ALIGN, and CLUSTAL using standard parameters. (See, e.g., Altschul, et al. (1990) J. Mol. Biol. 215:403-410; Henikoff et al. (1989) Proc. Natl. Acad. Sci. USA 89:10915; Karin et al. (1993) Proc. Natl. Acad. Sci USA 90:5873; and Higgins et al. (1988) Gene 73:237-244). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. Also, databases may be searched using FASTA (Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444-2448). One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by a conservative substitution. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of medium to high stringency).
(37) As used herein, “wild-type” and “native” genes or proteins are those found in nature. The terms “wild-type sequence,” and “wild-type gene/protein” are used interchangeably herein, to refer to a sequence that is native or naturally occurring in a host cell.
(38) As used herein, “deletion of a gene,” refers to its removal from the genome of a host cell.
(39) As used herein, “disruption of a gene” refers broadly to any genetic or chemical manipulation that substantially prevents expression of a function gene product, e.g., a protein, in a host cell. Exemplary methods of disruption include complete or partial deletion of any portion of a gene (including a polypeptide-coding sequence, a promoter, an enhancer, or another regulatory element, or mutagenesis of the same (including substitutions, insertions, deletions, and combinations, thereof), to substantially prevent expression of a function gene product.
(40) As used herein, “a functional gene” is a gene capable of being used by cellular components to produce an active gene product, typically a protein. “Functional” genes are the antithesis of “disrupted” genes, which are modified such that they cannot be used by cellular components to produce an active gene product. Exemplary functional genes include but are not limited to cellulases other than EGV, hemi-cellulases, proteases, amylases, lipases, perhydrolases, esterases, pectate lyases, pectinases, laccases, oxidases, reductases, amidases, and other enzymes, structural proteins, surface active proteins, binding proteins, and the like.
(41) As used herein, T. reesei host cells have been “modified to prevent the production of a thermostable EGV cellulase” if they have been genetically or chemically altered to prevent the production of an EGV polypeptide that exibits thermostable cellulase activity, e.g., as determined using the assays described, herein. Such modifications include, but are not limited to, deletion of the egl5, disruption of the egl5, modification of the egl5 such that the encoded EGV polypeptide is no longer thermostable, modification to the egl5 such that the encoded EGV polypeptide no longer exibits cellulase activity, modification of the egl5 such that the encoded EGV polypeptide is no longer secreted, modifications of promoter or regulatory elements such that EGV is not expressed, and combinations, thereof.
(42) As used herein, a “functional polypeptide/protein” is a protein that posses an activity, such as an enzymatic activity, a binding activity, a surface-active property, or the like, and which has not been mutagenized, truncated, or otherwise modified to abolish (or essentially eliminate) the activity. Functional polypeptides may be themostable or thermolabile, as specified.
(43) As used, herein, an “unwanted activity” is an activity (e.g., an enzymatic activity, a binding activity, a surface-active property, or the like), which is not desired in a protein preparation produced from T. reesei host cells. Unwanted activities typically occur in protein preparations that further comprise a protein of interest having a desired or desirable activity.
(44) As used herein, a “fermentation broth composition” refers to cell growth medium that contains a protein of interest, such as hydrophobin. The cell growth medium may include cells and/or cell debris, and may be concentrated. An exemplary fermentation broth composition is hydrophobin-containing, ultrafiltration-concentrated fermentation broth.
(45) As used herein, a “mannanase mannose unit (MMU)” is the amount of mannanase per mg of hydrophobin required to produce 1 μmol of reducing end equivalents (including but not limited to D-Mannose) per minute at pH 7.0 and at 50° C. in the presence of 0.24% locust bean gum (LBG).
(46) As used herein, an “endoglucanase unit (EGU)” is the amount of endogluconase per mg of hydrophobin required to produce 1 μmol of reducing sugars per minute.
(47) As used herein, a “protease unit (PU)” corresponds to the amount of cysteine protease per mg of hydrophobin required to hydrolyse 1 μmol N-benzoyl-L-arginine ethyl ester (BAEE) per minute at pH 6.2 and 25° C.
(48) As used herein, “treating” a food or other material to affect a change in the material means contacting the food or other material with a protein preparation produced from T. reesei host cells, wherein one or more proteins present in the protein preparation acts on a component of the food or other material to bring about a chemical change as the result of, e.g., an enzymatic activity, a binding activity, a surface-active property, or the like. Examples of treatment include contacting a baked food product with an amylase to hydrolyze amylopectin, contacting a food product with a lipase to generate emulsifiers, and contacting a food product with hydrophobin to alter the texture.
(49) As used herein, the singular articles “a,” “an,” and “the” encompass the plural referents unless the context clearly dictates otherwise. All references cited herein are hereby incorporated by reference in their entirety.
(50) The following abbreviations/acronyms have the following meanings unless otherwise specified: EC enzyme commission kDa kiloDalton kb kilobase MW molecular weight w/v weight/volume w/w weight/weight v/v volume/volume wt % weight percent ° C. degrees Centigrade H.sub.2O water H.sub.2O.sub.2 hydrogen peroxide dH.sub.2O or DI deionized water dIH.sub.2O deionized water, Milli-Q filtration g or gm gram μg microgram mg milligram kg kilogram lb pound μL and μl microliter mL and ml milliliter mm millimeter nm nanometer μm micrometer M molar mM millimolar μM micromolar μmol micromole U unit ppm parts per million sec and ″ second min and ′ minute hr hour EtOH ethanol eq. equivalent N normal PCR polymerase chain reaction DNA deoxyribonucleic acid FOA fluoroorotic acid UV ultraviolet A.sub.540 absorbance measured at a wavelength of 540 nm CMC carboxymethyl cellulose rpm revolutions per minute Δ relating to a deletion MMU mannanase mannose unit EGU endoglucanase unit PU protease unit 4MUC 4-methylumbelliferyl β-D-cellobioside 4MUM 4-methylumbelliferyl β-D-mannopyranoside NPC/mL μmole o-nitrophenol liberated/min/mL MU/L μmole o-nitrophenol liberated/min/mL
(51) The present compositions and methods are based, in part, on the discovery that the Trichoderma reesei egl5 gene encodes a thermostable cellulase enzyme, i.e., EGV. In contrast, other known cellulases expressed by T. reesei are heat labile. The discovery that the product of egl5 is thermostable has far-reaching implication for the production of both endogenous and exogenous polypeptides in by T. reesei, in the absence of unwanted enzymatic activities, including cellulase activity.
(52) Mention is made of PCT WO 2005/093073 (“the 073 PCT”). The 073 PCT pertains to T. reesei that express exogenous fusion proteins. Mention is also made WO 2005/001036 (“the 036 PCT). The 036 PCT relates to the identification and isolation of certain genes in T. reesei. Mention is further made of WO 98/15619 (“the 619 PCT”). The 619 PCT concerns the expression of EGVI by Trichoderma longibrachiatum. None of the 073 PCT, the 036 PCT and the 619 PCT, either individually or in any combination, teaches or suggests preventing or reducing the expression in Trichoderma, such as T. reesei, of endogenous thermostable cellulases such as EGV, and especially does not teach or suggest preventing or reducing the expression in Trichoderma, such as T. reesei, of endogenous thermostable cellulases such as EGV and the expression by the Trichoderma, e.g., T. reesei of an exogenous thermostable polypeptide, such as a hydrophobin, e.g., hydrophobin II.
(53) In one aspect, a method for expressing a thermostable polypeptide in Trichoderma, e.g., T. reesei, is provided, comprising or consisting essentially of the steps of disrupting egl5 in T. reesei host cells, expressing a thermostable polypeptide in the Trichoderma host cells, and exposing the resulting whole-cell lysate, cell broth, or partially-purified protein preparation to an elevated temperature, thereby eliminating substantially all heat-labile enzymatic activities from the protein preparation. In some embodiments, the heat-labile enzymatic activities are cellulase activities. One significant advantage of this method is that egl5 can be disrupted in the Trichoderma host cells used to express the thermostable protein of interest, while other genes encoding heat-labile enzymes can be left intact, avoiding the need to make multiple deletions in Trichoderma host cells. Exemplary heat-labile enzymes are proteases, cellulases, and xylanases.
(54) In a related aspect, a Trichoderma, e.g., T. reesei, host cell having or consisting essentially of a disrupted egl5 is provided, the host cell being suitable for expressing heat stable polypeptides free of unwanted enzymatic activity. As above, Trichoderma genes that encode heat-labile enzymes can be left intact in the host cell, since the expression product of these genes can be inactivated by heat. In this manner, the Trichoderma host cell may include any number of intact genes encoding heat labile cellulases, so long as egl5 is disrupted.
(55) In a further related aspect, a Trichoderma, e.g., T. reesei, host cell having or consisting essentially of a disrupted egl5 is provided, the host cell being suitable for expressing heat-labile polypeptides, wherein essentially all enzymatic activity can be inactivated by heat at a preselected time following expression. As before, the Trichoderma host cell may include any number of intact genes encoding heat labile enzymes, so long as the egl5 is disrupted.
(56) In another aspect, the Trichoderma host cell modified to substantially reduce or prevent the production of a thermostable endoglucananse V (EGV) polypeptide wherein the modification comprises or consists essentially of disrupting or deleting a gene encoding EGV from the Trichoderma host cell wherein the gene encoding EGV is egl5 is provided.
(57) In a related aspect, a composition comprising a hydrophobin polypeptide in the presence of reduced amounts, or substantially in the absence of, cellulase and/or mannanase activity is provided.
(58) In some embodiments, the hydrophobin polypeptide is obtained from filamentous fungus host cells. Such hydrophobin compositions are well suited for use in applications where cellulose and mannose are present, and the enzymatic hydrolysis of these complex sugars is undesirable. In some cases, the hydrophobin polypeptide is produced in the presence of thermolabile cellulase and/or mannanase polypeptides, and subjected to an elevated temperature to inactivate the cellulase and/or mannanase polypeptides.
(59) In some cases, the hydrophobin polypeptide is produced in host cells having or consisting essentially of disrupted genes encoding cellulase and/or mannanase polypeptides, such that active cellulase and/or mannanase polypeptides are not produced in the host cells.
(60) In yet other cases, the hydrophobin polypeptide is produced in host cells lacking gene(s) or nucleic acid molecule(s) encoding cellulase and/or mannanase polypeptides.
(61) The egl5 gene referred to herein corresponds to Genbank Accession No. Z33381 (Saloheimo, A. et al. (1994) Mol. Microbiol. 13:219-28). The nucleotide sequence of egl5 is set forth in
(62) The corresponding amino acid sequence of the EGV polypeptide is set forth in
(63) EGV is an endo-1,4-beta-glucanase that belongs to the Carbohydrate Active Enzymes (CAZy) Family 45 glycosyl hydrolases and has the Enzyme Classification (EC) number (EC 3.2.1.4). These enzymes were formerly known as Family K cellulases/xylanases. An important feature of EGV, which distinguishes the enzyme from other known T. reesei cellulases, is that EGV is thermostable.
(64) EGV polypeptides according to the present compositions and methods are cellulases that have a similar structure and function compared to the EGV cellulase having the amino acid sequence of SEQ ID NO: 33. Similar structure means at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, primary amino acid sequence identity with SEQ ID NO: 33. Similar function means thermostable endo-1,4-beta-glucanase activity. In this context, themostability refers to the ability of the cellulase to retain at least one-half (i.e., at least 50%) of its original activity following exposure to a temperature of about 90° C. or greater for a time of about 5 minutes or longer.
(65) One aspect of the compositions and methods is a host cell comprising a deletion or disruption of egl5, which precludes the expression of a functional enzyme.
(66) Another aspect of the compositions and methods is a host cell comprising or consisting essentially of a deletion or disruption of egl5, which precludes the expression of a functional enzyme. Deletion refers to the removal of egl5 from the genome of the host cell, which can be accomplished by, e.g., homologous recombination or chemical mutagenesis. Homologous recombination is generally preferred since it is a targeted method. Disruption of egl5 refers broadly to any genetic or chemical manipulation of T. reesei host cells that substantially prevents expression of enzymatically active EGV cellulase. Exemplary methods of disruption include complete deletion of egl5, deletion of a portion of the genome that includes egl5, partial deletion (including truncation) of egl5, complete or partial deletion of the egl5 promoter, enhancer, or other genetic control elements, mutagenesis of the egl5 coding sequence, promoter, enhancer, or other genetic control elements, or any other genetic modification that precludes the expression of a functional egl5 gene product (i.e., EGV). Such disruptions may also be accomplished by, e.g., homologous recombination or chemical mutagenesis. For the purposes of the present compositions and methods, disruption of the egl5 gene also includes genetic modifications that abolish or reduce the thermostability of the EGV polypeptide.
(67) In the process of deleting or disrupting egl5, any number of selectable markers may be introduced into a host cells to enable the selection of mutated host cells on solid or liquid media, to allow selection by cells sorting (e.g., FACS analyis), or to facilitate screening by PCR or Southern blot analysis. Additional host cell genes may also be deleted or disrupted. In some cases, it may be desirable to introduce a gene of interest at the site of deletion or disruption of egl5. In this manner, the present compositions and methods contemplate using the egl as a site for homologous recombination for introducing a nucleic acid sequence encoding a thermostable polypeptide into T. reesei host cells.
(68) Genes of interest encode proteins of interest, which are desirable to express in Trichoderma in the absence of cellulase activity. In some cases, genes of interest encode thermostable polypeptides. Such thermostable polypeptides may be expressed in the absence of cellyulase activity by expressing them in a host cell in which egl5 has been deleted or disrupted, subjecting a host cell lysate or medium from these host cells to thermal stress to heat-inactivate cellulases expressed by the host cell, and recovering the thermostable polypeptide substantially free of cellulase activity.
(69) Thermostable polypeptides include enzymes, structural proteins, nucleic acid binding proteins, receptors, and the like. Such proteins may be from thermophilic organisms, including but not limited to, Pyrococcus furiosus, Thermus aquaticus, Thermus thermophilus, Thermus thermophilus, Thermus flavus, Thermoanaerobacterium thermosulfurigenes, Bacillus thermoproteolyticus, Thermotoga maritime, Thermomyces lanuginosus, Bacillus thermoproteolyticus, and Bacillus stearothermophilus. Exemplary thermophilic proteins include citrate synthase, rubredoxin, glutamate dehydrogenase, and methionine aminopeptidase from Pyrococcus furiosus, EF-TU and EF-TU-TS from Thermus aquaticus and Themius thermophilus, inorganic pyrophosphatase and manganese superoxide dismutase from Thermus thermophilus, lactate dehydrogenase, 3-phosphoglycerate kinase, adenylate kinase, and phosphofructokinase from Bacillus stearothermophilus, malate dehydrogenase from Thermus flavus, cyclodextrin from Thermoanaerobacterium thermosulfurigenes, thermolysin, neutral protease, and ferredoxin from Bacillus thermoproteolyticus, cheY from Thermotoga maritime, and endo-1,4-beta xylanase from Thermomyces lanuginosus.
(70) Further thermostable polypeptides include amylases, pullulanases, xylanases, chitinases, proteases, lipases, polymerases, and even cellulases. Note that while thermophilic cellulases were known in the art, it was heretofore unknown that EGV was the only thermostable cellulase expressed in T. reesei, at least in such quantities as to produce a significant amount of cellulase activity in whole cell lysates, broths, or partially purified cell protein preparations from T. reesei. Thus, the present compositions and methods can be used to produce exogenous thermostable cellulases in T. reesei host cells, which exogenous thermostable cellulases are substantially free of unwanted T. reesei cellulase activity.
(71) Yet further thermostable polypeptides include structural polypeptides, transcription factors, chaperonins, and polypeptide inhibitors, to name only a few. An exemplary group of proteins that may be produced using the present compositions and methods are the hydrophobins, a class of cysteine-rich polypeptides expressed by filamentous fungi. Hydrophobins are small (˜100 amino acids) polypeptides known for their ability to self-assemble and form amphipathic proteins. They may form a hydrophobic coating on the surface of objects, including cells and man-made materials. First discovered in Schizophyllum commune in 1991, hydrophobins have now been recognized in a number of filamentous fungi. Based on differences in hydropathy and other biophysical properties, hydrophobins are categorized as being class I or class II.
(72) Suitable hydrophobins are any class I or class II hydrophobin known in the art, for example, hydrophobin from an Agaricus spp. (e.g., Agaricus bisporus), an Agrocybe spp. (e.g., Agrocybe aegerita), an Ajellomyces spp., (e.g., Ajellomyces capsulatus, Ajellomyces dermatitidis), an Aspergillus spp. (e.g., Aspergillus arvii, Aspergillus brevipes, Aspergillus clavatus, Aspergillus duricaulis, Aspergillus ellipticus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus fumisynnematus, Aspergillus lentulus, Aspergillus niger, Aspergillus unilateralis, Aspergillus viridinutans), a Beauveria spp. (e.g., Beauveria bassiana), a Claviceps spp. (e.g., Claviceps fusiformis), a Coccidioides spp., (e.g., Coccidioides posadasii), a Cochliobolus spp. (e.g., Cochliobolus heterostrophus), a Crinipellis spp. (e.g., Crinipellis perniciosa), a Cryphonectria spp. (e.g., Cryphonectria parasitica), a Davidiella spp. (e.g., Davidiella tassiana), a Dicxyonema spp. (e.g., Dictyonema glabratum), an Emericella spp. (e.g., Emericella nidulans), a Flammulina spp. (e.g., Flammulina velutipes), a Fusarium spp. (e.g., Fusarium culmorum), a Gibberella spp. (e.g., Gibberella moniliformis), a Glomerella spp. (e.g., Glomerella graminicola), a Grifola spp. (e.g., Grifola frondosa), a Heterobasidion spp. (e.g., Heterobasidion annosum), a Hypocrea spp. (e.g., Hypocrea jecorina, Hypocrea lixii, Hypocrea virens), a Laccaria spp. (e.g., Laccaria bicolor), a Lentinula spp. (e.g., Lentinula edodes), a Magnaporthe spp. (e.g., Magnaporthe oryzae), a Marasmius spp. (e.g., Marasmius cladophyllus), a Moniliophthora spp. (e.g., Moniliophthora perniciosa), a Neosartorya spp. (e.g., Neosartorya aureola, Neosartorya fennelliae, Neosartorya fischeri, Neosartorya glabra, Neosartorya hiratsukae, Neosartorya nishimurae, Neosartorya otanii, Neosartorya pseudofischeri, Neosartorya quadricincta, Neosartorya spathulata, Neosartotya spinosa, Neosartorya stramenia, Neosartorya udagawae), a Neurospora spp. (e.g., Neurospora crassa, Neurospora discreta, Neurospora intermedia, Neurospora sitophila, Neurospora tetrasperma), a Ophiostoma spp. (e.g., Ophiostoma novo-ulmi, Ophiostoma quercus), a Paracoccidioides spp. (e.g., Paracoccidioides brasiliensis), a Passalora spp. (e.g., Passalora fulva), Paxillus filamentosus Paxillus involutus), a Penicillium spp. (e.g., Penicillium camemberti, Penicillium chrysogenum, Penicillium marneffei), a Phlebiopsis spp. (e.g., Phlebiopsis gigantea), a Pisolithus (e.g., Pisolithus tinctorius), a Pleurotus spp., (e.g., Pleurotus ostreatus), a Podospora spp. (e.g., Podospora anserina), a Postia spp. (e.g., Postia placenta), a Pyrenophora spp. (e.g., Pyrenophora tritici-repentis), a Schizophyllum spp. (e.g., Schizophyllum commune), a Talaromyces spp. (e.g., Talaromyces stipitatus), a Trichoderma spp. (e.g., Trichoderma asperellum, Trichoderma atroviride, Trichoderma viride, Trichodenna reesii [formerly Hypocrea jecorina]), a Tricholoma spp. (e.g., Tricholoma terreum), a Uncinocarpus spp. (e.g., Uncinocarpus reesii), a Verticillium spp. (e.g., Verticillium dahliae), a Xanthodactylon spp. (e.g., Xanthodactylon flammeum), a Xanthoria spp. (e.g., Xanthoria calcicola, Xanthoria capensis, Xanthoria ectaneoides, Xanthoria flammea, Xanthoria karrooensis, Xanthoria ligulata, Xanthoria parietina, Xanthoria turbinata), and the like. Hydrophobins are reviewed in, e.g., Sunde, M. et al. (2008) Micron 39:773-84; Linder, M. et al. (2005) FEMS Microbiol Rev. 29:877-96; and Wösten, H. et al. (2001) Ann. Rev. Microbiol. 55:625-46.
(73) Alternatively or additionally, proteins of interest may be mesophilic proteins that are minimally denatured at temperatures required to inactivate cellulases other than EGV. Proteins of interest may also be engineered proteins selected for their thermostability. Proteins of interest may also be those that are reversibly denatured at temperatures required to inactivate cellulases other than EGV, such that active or structurally intact proteins are recovered following exposure to elevated temperatures
(74) The polypeptide of interest, especially a thermostable polypeptide of interest may be recovered as discussed in WO/2011/019686, advantageously in accordance with the invention thereof, such as the techniques of Example 1 thereof.
(75) In some embodiments, the present compositions and methods allow proteins of interest to be produced substantially in the absence of detectable enzymatic activities, including cellulase, mannanase, and/or protease activity. In other embodiments, proteins of interest are produced in the presence of small but detectable amounts of detectable cellulase, mannanase, and/or protease activity. For example, in particular embodiments, proteins of interest are produced in the presence of an endoglucanase activity of less than about 0.1 EGU, or even less than about 0.05 EGU, less than about 0.10 MMU, less than about 0.05 MMU, less than about 0.025 MMU, less than about 0.02 MMU, less than about 0.015 MMU, or even less than about 0.01 MMU, and/or a detectable cysteine protease activity of less than about 1.3 PU, or even less than about 0.5 PU. Where the protein of interest is, for example, hydrophobin intended for a food application, such amounts of contaminating activities are generally not detrimental.
(76) Generally, proteins of interest may include any number of amino acid substitutions, insertions, and/or deletions, or chemical modifications, so long as the proteins retain thermostability or retain the ability to reversibly denature in response to thermal stress. Preferred proteins of interest retain at least about one-half (i.e., 50%) of their activity, binding ability, or native structure (depending on the type of protein) following exposure to a temperature of at least about 70° C., at least about 75° C., at least about 80° C., at least about 85° C., at least about 90° C., or even at least about 95° C., for a time of at least about 3 minutes, at least about 5 minutes, at least about 10 minutes, at least about 15 minutes, at least about 20 minutes, or even at least about 30 minutes. In a particular case, the proteins of interest retain at least about 50% of their activity, binding ability, or native structure following exposure to a temperature of at least about 90° C. for a time of at least about 5 minutes.
(77) Genes of interest or nucleic acid molecules of interest may be introduced into Trichoderma cell using any known methods, including homologous recombination, transfection using transient expression vectors, stable integrating expression vectors, or artificial chromosomes, infection/transduction with viruses, and the like. In some cases, it may be desirable to introduce a gene of interest at the site of egl5, which is to be disrupted. In some cases, there may be more than one gene or nucleic acid molecule of interest.
(78) In one aspect, the present compositions and methods allow the expression of thermostable proteins, such as hydrophobin, using a Trichoderma, e.g., T. reesei, host cell deleted or disrupted with respect to egl5 but optionally encoding other cellulase-genes. Following expression of the thermostable protein, a whole cell lysate, broth, or partially purified cell protein preparation from Trichoderma is incubated at a temperature sufficient to inactivate heat labile enzymes, producing the protein of interest in the absence of unwanted enzymatic activity, including but not limited to unwanted cellulase [including endoglucanase (other than EGV), exoglucanase, cellobiohydrolase, β-glucosidase, carboxymethyl cellulase, and the like], hemicellulase (including xylanase, mannanase, arabinanase, glucuronidase, acetylxylan esterase, arabinofuranosidase, xylosidases, and the like), protease, lipase, amylase, esterase, perhydrolase, phytase, laccase, and other commercially-relevant enzyme activities, all while avoiding the need to disrupt a number of different heat-labile enzyme-encoding genes in the host cell. This greatly simplifies the expression of genes or nucleic acid molecules of interest in Trichoderma.
(79) In another aspect, the present compositions and methods allow the expression of thermostable proteins, such as hydrophobin, e.g., hydrophobin II, using a Trichoderma host cell deleted or disrupted essentially with respect to egl5 but optionally expressing other cellulases or encoding other cellulase-genes. Following expression of the thermostable protein, a whole cell lysate, broth, or partially purified cell protein preparation from Trichoderma is incubated at a temperature sufficient to inactivate heat labile enzymes, producing the protein of interest in the absence of unwanted enzymatic activity, including but not limited to unwanted cellulase [including endoglucanase (other than EGV), exoglucanase, cellobiohydrolase, β-glucosidase, carboxymethyl cellulase, and the like], hemicellulase (including xylanase, mannanase, arabinanase, glucuronidase, acetylxylan esterase, arabinofuranosidase, xylosidases, and the like), protease, lipase, amylase, esterase, perhydrolase, phytase, laccase, and other commercially-relevant enzyme activities, all while avoiding the need to disrupt a number of different heat-labile enzyme-encoding genes in the host cell.
(80) In another aspect, the present compositions and methods allow the expression of thermostable proteins, such as hydrophobin, using a Trichoderma host cell modified to substantially reduce or prevent the production of a thermostable endoglucananse V (EGV) polypeptide wherein the modification comprises or consists essentially of deleting a nucleic acid molecule encoding or providing expression of EGV from the Trichoderma host cell, wherein the nucleic acid molecule encoding EGV is egl5, is provided.
(81) In another aspect, the present compositions and methods provide a composition obtained from a host cell, in which hydrophobin, e.g., hydrophobin II is present, with an absence of cellulase and/or mannanase activity. Such a composition may be obtained by producing hydrophobin, e.g., hydrophobin II in a host cell, such as filamentous fungus cells, such as, Trichoderma, e.g., T. reesei, that also produces thermolabile cellulase and/or mannanase polypeptides, and then subjecting the proteins produced by the host cell to an elevated temperature to inactivate the cellulase and/or mannanase polypeptides. Alternatively, hydrophobin may be produced in a host cell such as, Trichoderma, e.g., T. reesei, having deleted and/or disrupted nucleic acid molecule(s) encoding or responsible for expression of cellulase and/or mannanase polypeptides, or lacking nucleic acid molecule(s) encoding cellulase and/or mannanase polypeptides. Such compositions are useful in applications requiring hydrophobin, e.g., hydrophobin II, where the presence of cellulase and/or mannanase activity is undesirable.
(82) These and other aspects and embodiments of the present compositions and method will be apparent to the skilled person in view of the present description.
(83) Indeed, mention is made that the skilled person can practice the instant invention in combination with the inventions of each or both of U.S. application Ser. No. 61/469,067 filed 29 Mar. 2011 and Ser. No. 61/475,933 filed 15 Apr. 2011, both of which are incorporated herein by reference. Specifically, the skilled person can, in conjunction with the instant invention, use the method for purifying hydrophobin II of U.S. application Ser. No. 61/475,933 filed 15 Apr. 2011 at any point after hydrophobin II is expressed in the practice of the present invention, including before or after a heat treatment; and, that method for purifying may comprise adding a C1-C3 alcohol, e.g., isopropanol, to a hydrophobin solution to generate a first precipitate, decanting a supernatant from the C1-C3 alcohol/hydrophobin solution and adding the C1-C3 alcohol to the supernatant, to generate a second precipitate, wherein the second precipitate may be purified hydrophobin II. And, one may use the precipitation agent techniques of U.S. application Ser. No. 61/469,067 filed 29 Mar. 2011 during the expression of hydrophobin II when the instant invention is practiced.
(84) The present invention method also relates to controlling activity of the polypeptide of interest expressed by the modified Trichoderma host cells of the present invention, wherein the polypeptide of interest is heat sensitive or thermolabile, wherein said method may comprise subjecting the heat sensitive or thermolabile polypeptide of interest and the endogenous polypeptide to an elevated temperature, wherein the elevated temperature may be sufficient to inactivate the endogenous polypeptide and the heat sensitive or thermolabile polypeptide. In an advantageous embodiment, the endogenous polypeptide may be a cellulose. The method may further comprise, prior to subjecting the heat sensitive or thermolabile polypeptide of interest to the elevated temperature, contacting the polypeptide of interest with a compound upon which the polypeptide of interest acts. The method may further comprise, prior to subjecting the heat sensitive or thermolabile polypeptide of interest to the elevated temperature, contacting the polypeptide of interest with one or more compounds upon which the cellulose and the polypeptide of interest act.
(85) The present invention method also relates to a method for controlling activity of the polypeptide of interest in the fermentation broth of the present invention, wherein the polypeptide of interest may be heat sensitive or thermolabile, wherein the method may comprise subjecting the fermentation broth to an elevated temperature sufficient to inactivate the endogenous polypeptide and the heat-sensitive or thermolabile polypeptide. In an advantageous embodiment, the endogenous polypeptide may be a cellulose. The method may further comprise, prior to subjecting the fermentation broth to the elevated temperature, contacting the fermentation broth with a compound of interest upon which the polypeptide of interest acts. The method may further comprise, prior to subjecting the fermentation broth to the elevated temperature, contacting the fermentation broth with one or more compounds upon which the cellulase and the polypeptide of interest act.
(86) A compound upon which the polypeptide of interest and/or a cellulase acts may be any compound which directly or indirectly interacts with the polypeptide of interest and/or a cellulase. The compound of interest may be a compound that binds directly to the polypeptide of interest and/or a cellulase, i.e., a cis-acting compound. In one embodiment, the compound of interest may be a substrate of the polypeptide of interest and/or a cellulase, such as, for example, a cellulose, a hemicelluloses, a lignin, a pectin or a derivative thereof. Examples include, but are not limited to, cellulose acetate, cellulose triacetate, cellulose propionate, cellulose acetate propionate, cellulose acetate butyrate, nitrocellulose (cellulose nitrate), cellulose sulfate, methylcellulose, ethylcellulose, ethyl methyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose (HPC), hydroxyethyl methyl cellulose, hydroxypropyl methyl cellulose (HPMC), ethyl hydroxyethyl cellulose and carboxymethyl cellulose (CMC). In another embodiment, the compound of interest may be a compound that indirectly interacts with the polypeptide of interest and/or a cellulase, i.e., a trans-acting compound.
(87) The present invention also relates to a method for controlling the activity of a cellulase present in a composition obtained from the modified Trichoderma host cells, wherein the composition may comprise at least one cellulase enzyme other than EGV, and the method may comprise subjecting the composition to an elevated temperature sufficient to inactivate the polypeptide of interest, and wherein following subjecting the composition to an elevated temperature the composition is substantially free of cellulase activity. The polypeptide of interest may be heat sensitive or thermolabile. In another embodiment, the polypeptide may be heat tolerant or thermostable. The subjecting the composition to an elevated temperature may be performed in a foodstuff or beverage. In another embodiment, the elevated temperature may be less than about 100 degrees C. The elevated temperature of the present invention is not meant to encompass baking, frying, pasturization, or other heat treatments, which destroy thermostable cellulases. In another embodiment, the composition obtained from the modified Trichoderma host cells may be a hydrophobin-comprising fermentation broth.
(88) The following examples are intended to further illustrate, but not limit, the compositions and methods.
EXAMPLES
Example 1. Construction of a T. reesei Strain with a Disrupted pyr2 Gene
(89) A fragment of sucA from Aspergillus niger was amplified by PCR using primers oANSUCA5 and oANSUCA3. Similarly, the hexokinase gene promoter was amplified from the chromosome of T. reesei using primers oHXK5 and oHXK3. The amplified sucA DNA fragment was restricted with EcoRI and AscI. The amplified DNA fragment carrying the hexokinase promoter was digested with HindIII and EcoRI. The two digested fragments were incubated together in a ligation reaction along with plasmid pTrex3(AGL51M) (see WO 08/118382, incorporated herein by reference) digested with HindIII and AscI. The resulting vector, pTHXK(SUCA) was digested with HindIII and BamHI and a 3.5 kb DNA fragment carrying a fragment of the sucA gene fused with the hexokinase promoter was isolated by agarose gel electrophoresis. The nucleotide sequence of this fragment is provided in
(90) pF1X is a small plasmid comprising an origin of replication and an ampicillin resistance gene from pUC19 and a bacteriophage fl origin of replication. Its complete nucleotide sequence is provided in
(91) The pyr2 gene of T. reesei was amplified using primers oPYR2 51 and oPYR2 31. The resulting fragment was digested with SfiI and NotI and incubated in a ligation reaction along with pF1X digested with the same enzymes. The resulting plasmid was designated pF1X(pyr2hxksuc). The E. coli strain XL1-Blue MRF′ was transformed with pF1X(pyr2hxksuc) and transfected with the helper phage M13K07 (Invitrogen). The DNA from the phagemid form of pF1X(pyr2hxksuc) was isolated using standard methods (see, e.g., instructions from Invitrogen).
(92) The phagemid DNA was dissolved in H-restriction enzyme buffer at about 1 mg/ml concentration and annealed to the two oligonucleotides oPYR2F_3M and oPYR2_5P, both present a concentration of 5 μM, by heating the solution to 75° C. and letting it cool to room temperature slowly. The resulting, partially double-stranded DNA was digested with BamHI and the larger of the two resulting DNA fragments from this digest purified by agarose gel electrophoresis.
(93) The larger BamHI DNA fragment was used to transform a quad-deleted (Δcbh1, Δcbh2, Δeg1 and Δeg2) strain (i.e., “Quad;” U.S. Pat. No. 5,650,322) of T. reesei by spore electroporation (see, e.g., Miasnikov, A. and Kim, S. (2009) Abstracts of the 25th Fungal Genetics conference at Asilomar. p. 232). Transformants were selected for their ability to grow on sucrose minimal medium (sucrose, 5 g/l; KH.sub.2PO.sub.4, 5 g/l; (NH.sub.4)2SO.sub.4, 6.6 g/l; MgCl.sub.2, 1 g/l; MgSO.sub.4, 0.1 g/l; CaCl.sub.2, 0.25 g/l; FeSO.sub.4, 5.0 mg/l; MnSO.sub.4, 1.6 mg/l; ZnSO.sub.4, 1.4 mg/l; uridine, 100 mg/l). Transformants that grew on sucrose were sub-cultured on plates containing the same medium with 1 g/l fluoroorotic acid (FOA). Chromosomal DNA was isolated from the transformant (coded DURA) that demonstrated the best growth in the presence of FOA. This DNA was analyzed by PCR using primer pairs (i) oPYR2FD_R1 and oSUC2_D1 and (ii) oPYR2FU_D1 and oSUC2_R1. In both cases, PCR products of the expected size (2.4 and 1.8 kb, respectively) were observed. Strain DURA did not grow on sucrose minimal medium lacking uridine, confirming that the pyr2 gene is disrupted in this strain.
(94) The sequences of the primers referred to in this Example are described in Table 1.
(95) TABLE-US-00001 TABLE 1 Primers used for disruption of the pyr2 gene SEQ Oligo Sequence ID Name (5′.fwdarw.3′) NO oANSUCA5 GGAATTCAAACATGTCGCCTTCCATGCAG 4 ACGCGGGCCTC oANSUCA3 GTTGGCGCGCCTGGATCCCGAAACTTCAC 5 CTGCTAC oHXK5 CGATAAGCGATTGGCGAGCGAGCTTTG 6 oHXK3 GGTGAATTCTGGCGGGGTAGCTGTTGAAA 7 AGTG oPYR2 51 GTTTCGGCCATTTAGGCCGGATCCACACC 8 TTGCTCCTGTCGCATGCGTATCTGG oPYR2 31 GTTTGCGGCCGCGGATCCTGCTCAGCACA 9 ATGTCCAGAAACTCCTGGTG oPYR2F_3M GCCGGATCCACACCTTGCTCCTGTCGCAT 10 G oPYR2_5P GCAGGATCCGCGGCCGCAAACTCATCAAT 11 G oPYR2FD_R1 GCGTGGTTTCAGCAGCCCACTGGTGAGTG 12 oSUC2_D1 GCCAGACTGCAATTCCGTCAACAATAACG 13 oPYR2FU_D1 AGCCGGCACGGATCTGAGTGGGCAGTTTG 14 oSUC2_R1 GGTTTGGAGGTGCGACATTGTAGTCGATG 15
Example 2. Disruption of the egl5 Gene
(96) The T. reesei egl5 gene was amplified by PCR using T. reesei chromosomal DNA as a template and the primers oEG5_5 and oEG5_3. The amplified DNA fragment was digested with restriction endonucleases SfiI and NotI and cloned into pF1X digested with the same enzymes, resulting in plasmid pF1X(EG5). Another fragment of T. reesei chromosomal DNA, located further upstream of the egl5 coding region (subsequently referred to as “repeat region”), was similarly amplified using the primers oEG5R_5 and oEG5R_3. The amplified fragment was digested with SpeI and SalI and cloned into pF1X(EG5) digested with AvaII and XhoI, generating plasmid pF1X(EG5R).
(97) The last step of constructing of the egl5 disruption cassette was to amplify the T. reesei pyr2 gene by PCR using the primers oPYR2_55 and oPYR2_35 and chromosomal DNA of the quad-deleted T. reesei strain (supra) as the template, digest the amplified DNA fragment with XhoI and SpeI, and incubate the digested fragmentin a ligation reaction along with XhoI and XbaI-digested pFl(EG5R). The final plasmid, designated pFIX(EG5RPyr2) carried the T. reesei egl5 gene disrupted with both a functional copy of the pyr2 gene and the egl5 5′-repeat region (
(98) The disruption cassette was amplified by PCR using pF1X(EG5RPyr2) as a template and the primers oEG5f and oEG5r. The PCR product was used to transform the T. reesei strain DURA (described in Example 1) to impart uridine prototrophy. The chromosomal DNA was isolated from a number of transformants and analyzed by PCR using the primer pairs: oEG5R_D1 and oEG5D_R1, oEG5R_D2 and oEG5DR2, oEG5R_D2 and oPYR2U_R2, and oPYR2D_D2 and oEG5D_R2. Three transformants (i.e., DURA ΔEG5 18, DURA ΔEG5 22, and DURA ΔEG5 23) yielded PCR products of the expected sizes with all four primer pairs (i.e., 1.2 kb, 1.15 kb, 1.4 kb, and 1.5 kb, respectively;
(99) The sequences of the primers referred to in this Example are described in Table 2.
(100) TABLE-US-00002 TABLE 2 Primers used for making and analyzing the egl5 gene disruption SEQ Oligo Sequence ID Name (5′.fwdarw.>3′) NO: oEG5_5 GTTGCGGCCGCAATTCAGATATTCCAAATC 16 ATCTTGCAC oEG5_3 GTGGCCATTTAGGCCATGGGATCGTACGGC 17 ATAATACATC oEG5R_5 GTTACTAGTCTCGAGTTTTCTAGAGCCGAC 18 GAGTATCGTGGGGCAATTGC oEG5R_3 GTTGTCGACGTCGTGCAAGATGATTTGGAA 19 TATC oPYR2_55 AGTACTAGTCAATTGCTCGAGTTTATAAGT 20 GACAACATGC oPYR2_35 TTGCAATTGACTAGTGGATCCAACGCCGGC 21 TATTAGGCCATAAG oEG5f AATTAATGAAGCAAAATAGAGTATTTTCAC 22 oEG5r GATCGTACGGCATAATACATCGGCCAAATG 23 oEG5D_RI CCTAGATCCGGGAATTCCCATGGGATCGTA 24 C oEG5D_R2 CTGACAGCGAGCTACCTTACATGTACATAA 25 G oEG5R_DI GGCGCATCATATCAAGAAACAGAATGATAC 26 TC oEG5R_D2 CACAAGAAGACCCACGTCAGAGAAGACAA 27 AG oEG5FU_DI GGAAGAAGCCATGCTCAAGCGCATTTCTAC 28 oEG5FU_D2 ATCGCCACGCCAATGACCCAGCAGTTTCTC 29 oPYR2D_D2 GAAAAGGTGGAAAGAAGAGGCAAATTGTT 30 G oPYR2U_R2 GAGTTTTCACATGGAAGTCAAAGCGTACAG 31
Example 3. Cellulose Activity in T. reesei Control and egl5 Deletion Strains Based on Detection of Reducing Sugars
(101) T. reesei strains Quad (as a control), and independently isolated transformants DURA ΔEG5 18, DURA ΔEG5 22, and DURA ΔEG5 23, were grown for 6 days at 28° C. in shake-flasks using a minimal medium with 1.6% glucose-sophorose mixture as the carbon and energy source. Mycelia were separated by filtration through a 0.22 γm membrane and the culture supernatants were concentrated about 100-fold by ultra-filtration using a 10 kDa-cutoff membrane.
(102) Concentrated culture supernatants (100 μl) were diluted with water (100 μl) and heated to 60° C. or 90° C. for 60 minutes in an Eppendorf Thermomixer R PCR machine. Heat-treated supernatants (10 μL) were then mixed with 195 μl polysaccharide substrate (0.5% carboxymethyl cellulose, 50 mM sodium citrate, pH 5.45) in a 96 well plate. The plate was covered with aluminum seal film and incubated at 40° C. for 16 hours with shaking at 400 rpm. A portion of the resulting cellulase reaction mixture (75 μL) was mixed with 75 μL DNS reagent (1% 3,5-dinitrosalicylic acid, 1% NaOH, 0.2% phenol, 0.05% sodium metabisulfite, and 10% sodium potassium tartrate) in a 96 well PCR plate and incubated at 99° C. for 10 minutes in an Eppendorf Thermomixer R PCR machine. DNS is used to measure the amounts of reducing sugars. The absorbance at 540 nm of the resulting DNS reaction (100 μL) was measured in a clear-bottom 96 well plate (Molecular Devices SpectraMax M2 UV plate reader). The activity was reported as the concentration of glucose (Glc) equivalents released (
(103) No cellulase activity was detected in any of the three T. reesei strains with the deleted egl5 gene. The control Quad strain retained about one half of its original cellulase activity after being subjected to heat treatment at 90° C. Results based on three replicates are shown in Table 3.
(104) The experiment demonstrates that deletion of the egl5 gene from a T. reesei strain that includes other functional cellulase genes (i.e., other than egl5), permits all cellulase activity in cell materials to be abolished by exposure to an elevated temperature. The use of an elevated temperature to abolish all cellulase activity is not possible when a from a T. reesei strain includes a functional egl5 gene, because the EGV cellulase gene product is thermostable.
(105) TABLE-US-00003 TABLE 3 Cellulase activity in beat-treated supernatants (DNS assay) Heat treat temp. A.sub.540 (standard Sample/strain (° C.) A.sub.540 (average) devation) Quad 60 0.49 0.04 DURA ΔEG5 23 60 0.28 0.04 DURA ΔEG5 22 60 0.29 0.02 DURA ΔEG5 18 60 0.27 0.03 Quad 90 0.22 0.02 DURA ΔEG5 23 90 −0.03 0.01 DURA ΔEG5 22 90 0.03 0.01 DURA ΔEG5 18 90 0.01 0.02
Example 4. Cellulase Activity Assay Based on Changes in Viscosity
(106) Polysaccharide substrate [300 mL, 1.0% carboxymethyl cellulose (CMC), 50 mM sodium citrate (pH 5.45)] was added to 400 mL glass beakers and initial viscosity was measured (Brookfield Viscometer DV-II Pro, spindle 62, 10 rpm). In preparation for addition to these CMC solutions/suspensions, concentrated culture supernatants (220 μL) from T. reesei control or egl5-deletion strains were incubated at either 4° C. or 90° C. for 60 minutes in an Eppendorf Thermomixer R PCR machine. Portions of the heat-treated supernatants (100 μL) were added to the CMC solutions/suspensions and stirred at 150 rpm at 22° C. for 16 hours. The final viscosities of the reactions were measured as above. The results are shown in Table 4 and
(107) Incubation of the CMC solution/suspension with culture supernatant from the Quad (control) strain lead to a significant decrease in viscosity independent of heat-treatment. Culture supernatant from the DURA ΔEG5 18 strain also produced a significant reduction in the viscosity of the CMC solution/suspension but not after heat-treatment at 90° C. These result suggested that EGV was the only heat-stable cellulase present in T. reesei cells, and that deletion of the egl5 gene in T. reesei allowed heat inactivation of all cellulase enzymes present in a T. reesei culture supernatant.
(108) TABLE-US-00004 TABLE 4 Cellulase activity based on a viscosity assay Pre-incubation % torque % torque Fold Sample temperature (° C.) (initial) (final) decrease Water control 63 47 1.34 Quad (4° C.) 4 64 0.1 640.00 DURA ΔEG5 18 4 63 0.1 630.00 Quad 90 62 9 6.89 DURA ΔEG5 18 90 62 53 1.17
Example 5. Excision of the pyr2 Marker from egl5 Disrupted Strains
(109) Strains DURA ΔEG5 18, DURA ΔEG5 22, and DURA ΔEG5 23 were allowed to sporulate and the spore suspensions were plated onto the sucrose minimal medium supplemented with uridine and FOA. A few FOA resistant clones were selected from the progeny of each of the three strains, and their chromosomal DNA isolated and analyzed by PCR using primer pairs (i) oEG5FU_D1 and oEG5D_R1 and (ii) oEG5FU_D2 and oEG5D_R2 (as described in Table 2). Chromosomal DNA obtained from the large majority of analyzed clones produced PCR products of the size expected (i.e., about 1.6-1.7 kb) following a homologous recombination between the two “repeat regions” in the chromosomes of DURA ΔEG5 18, DURA ΔEG5 22, and DURA ΔEGS 23 (
Example 6. Cellulase and Mannanse Activity Assays
(110) The following assays were used to measure cellulase activity and mannanse activity in hydrophobin preparations:
(111) Cellulase Assay
(112) Cellulase activity was determined using 4-methylumbellifery β-D-cellobioside (4MUC, SigmaAldrich, M6018) as a substrate in 100 mM sodium acetate buffer, pH 5.5. A standard cellulase composition (i.e., EG3 cellulase, Genencor) was used as a reference. Serial dilutions of the sample composition (e.g., a hydrophobin-comprising fermentation broth) and the standard cellulase composition were prepared and incubated with 4MUC reagent for 1 hr at 40° C. in a plate incubator with shaking at 400 rpm.
(113) Fluorescence was read on a SpectraMax fluorescence plate reader using the following parameters: excitation=360 nm, emission=460 nm, auto cutoff=455 nm. The amount of fluorescent signal produced by the experimental samples was correlated with the amount of fluorescent signal produced by the standard cellulase composition and reported as NPC/mL=μmole o-nitrophenol liberated/min/mL (a standard measure of cellulase activity).
(114) Mannanase Assay
(115) Mannanase activity was determined using 4-methylumbelliferyl β-D-mannopyranoside (4MUM, SigmaAldrich, M0905) as a substrate in 100 mM sodium acetate buffer, pH 5.5. A standard mannanase composition (Genencor) was used as a reference. Serial dilutions of the sample composition (e.g., a hydrophobin-comprising fermentation broth) and the standard mannanase composition are prepared and incubated with 4MUM reagent for 1 hr at 40° C. in a plate incubator with shaking at 400 rpm.
(116) Fluorescence was read on a SpectraMax fluorescence plate reader using the following parameters: excitation=360 nm, emission=460 nm, auto cutoff=455 nm. The amount of fluorescent signal produced by the experimental samples was correlated with amount of fluorescent signal produced by the standard mannanase composition and reported as MU/L=μmole o-nitrophenol liberated/min/mL.
(117) Assay of Hydrophobin Produced as Described
(118) Residual cellulase and mannanase activities in a hydrophobin-containing fermentation broth composition produced as described, were tested by incubating samples with 4-methylumbelliferyl β-D-cellobioside (cellulase) or 4-methylumbelliferyl β-D-annopyranoside (mannanase), as described, and comparing these values to those obtained using the EG3 cellulase standard or Mannanase standard (Genencor). The data (shown in Table 5) are expressed as activity per mL (or L) of solution or as activity per gram of hydrophobin. In this fermentation broth composition, cells were removed by microfiltration and the proteins were concentrated by ultrafiltration; however, no purification steps were performed to alter the ratio of hydrophobin to other proteins, such as residual mannanases and cellulase.
(119) TABLE-US-00005 TABLE 5 Residual mannanase and cellulase activity in a fermentation broth composition Sample NCP/mL MU/L NCP/g HFB MU/g HFB Concentrate #1 2282.504 139.646 13077.401 0.800 Concentrate #2 929.546 14.347 4786.125 0.074 Heat-treated 0.241 1.936 1.494 0.012 concentrate #2
As shown in the Table, the levels of residual mannanase activity, and particularly and cellulase were significantly reduced following heat treatment.
Example 7. HFB2 Expression in an egl5-Deleted Strain
(120) Construction of pTrex8R(Hfb2) and pTrex3gM(Hfb2)
(121) Two vectors were both designed to drive the expression of HFB2 from its native coding sequence under control of a strong cbhI promoter. The expression cassettes of the two vectors are identical, the only difference between these two molecules is that pTrex3gM(Hfb2) has amdS gene as the selectable marker while pTrex8R(Hfb2) has pyr2. Both vectors were constructed by LR-Gateway® cloning procedure using a chromosomal copy of hfb2 gene cloned in pENTR TOPO/D vector and destination vectors pTrex3gM and pTrex8R. Table 6 provides a complete list of functional elements in plasmids pTrex8R(hfb2) and pTrex3gM(hfb2). Any sequences not listed in Table 6 are short fragments of DNA used for genetic engineering purposes like restriction sites or sequences generated by LR-Gateway® reaction. Functional and partial restriction maps of plasmids pTrex8R(Hfb2) and pTrex3gM(Hfb2) are provided in
(122) TABLE-US-00006 TABLE 3 Functional elements comprising the plasmids pTrex8R(hfb2) and pTrex3gM(hfb2) pTrex3gM(Hfb2) pTrex8R(Hfb2) Functional element Start End Start End ColE1 replication origin 18 681 18 681 ampicillin resistance marker 689 1725 689 1725 cbhl promoter 1734 3185 1734 3185 hfb2 coding sequence 3262 3664 3262 3664 cbh1 terminator 3754 4078 3754 4078 amdS marker 4091 6713 — — pyr2 marker — — 4091 5961
Transformation of T. reesei DUD5 with the HFB2 Expression Cassettes
(123) The transformation was done in two successive stages. Firstly, strain DUD5 was transformed with an isolated large SfiI fragment of plasmid pTrex8R(hfb2) to uridine prototrophy using the standard protoplast transformation technique. Three clones (DUD5 HFB#176, #194 and #228) were selected after screening the culture media of a random set of transformants for high level of expression of HFB2. These isolates were further transformed with a large SfiI fragment of the plasmid pTrex3gM(hfb2) to acetamide assimilation phenotype. After a second round of screening (again, by growing the individual transformants in liquid culture under conditions inducing cbhI promoter and analyzing the culture media by SDS PAGE) clones DUD5 HFB2 B, DUD5 HFB2 D, DUD5 HFB2 K and DUD5 HFB2 N were selected as the best HFB2 producers.
(124) The invention is further described by the following numbered paragraphs:
(125) 1. A Trichoderma host cell modified to substantially reduce or prevent the production of a thermostable EGV polypeptide.
(126) 2. The Trichoderma host cell of paragraph 1, comprising a disrupted egl5 gene.
(127) 3. The Trichoderma host cell of paragraph 1 or 2, comprising a deleted egl5 gene.
(128) 4. The Trichoderma host cell of any of the preceding paragraphs, wherein the egl5 gene is deleted by homologous recombination.
(129) 5. The Trichoderma host cell of any of the preceding paragraphs, produced by modifying a parental host cell comprising a functional egl5 gene.
(130) 6. The Trichoderma host cell of any of the preceding paragraphs, further comprising one or more endogenous functional genes encoding a thermolabile enzyme.
(131) 7. The Trichoderma host cell of any of the preceding paragraphs, further comprising one or more functional genes encoding a thermolabile enzyme selected from the group consisting of a cellulase, a hemi-cellulase, and a protease.
(132) 8. The Trichoderma host cell of any of the preceding paragraphs, further comprising a functional gene encoding a thermolabile cellulase or hemi-cellulase.
(133) 9. The Trichoderma host cell of any of the preceding paragraphs, further comprising a functional gene of interest.
(134) 10. The Trichoderma host cell of paragraph 9, wherein the gene of interest encodes a thermostable polypeptide.
(135) 11. The Trichoderma host cell of paragraph 10, wherein the thermostable polypeptide is a hydrophobin.
(136) 12. A method for making a thermostable protein of interest in the Trichoderma host cell, comprising: introducing a gene encoding the thermostable protein of interest into a Trichoderma host cell having a disrupted egl5 gene and one or more endogenous genes encoding additional functional proteins; incubating the host cell in a medium suitable for producing the protein of interest and additional functional proteins; and subjecting the protein of interest and additional functional proteins to an elevated temperature sufficient to substantially inactivate the additional proteins; wherein the elevated temperature is insufficient to inactivate the thermostable protein of interest and would be insufficient to inactivate EGV cellulase produced by a functional egl5 gene; wherein the thermostable protein of interest is produced in active or functional form substantially in the absence of activity from the additional proteins.
(137) 13. A method for making a thermostable protein of interest in a Trichoderma host cell, comprising: producing the thermostable protein of interest and one or more additional functional proteins in Trichoderma host cells comprising a gene encoding the protein of interest, a disrupted egl5 gene, and a gene or genes encoding the one or more additional functional proteins; subjecting a protein mixture obtained from the host cells to an elevated temperature that is sufficient to substantially inactivate the one or more additional functional proteins but insufficient to inactive the thermostable protein of interest and EGV cellulase produced by a functional egl5 gene; wherein the thermostable protein of interest is produced in active or functional form substantially in the absence of activity from the additional functional proteins.
(138) 14. A method for making a thermostable protein of interest in a Trichoderma host cell, comprising: subjecting a protein mixture obtained from the Trichoderma host cells comprising a gene encoding the thermostable protein of interest, a disrupted egl5 gene, and one or more genes encoding additional functional proteins to an elevated temperature to inactivate the one or more additional functional proteins; thereby producing the thermostable or protein of interest in active or functional form in the absence of activity from the additional functional proteins.
(139) 15. The method of any of paragraphs 12-14, wherein the egl5 gene is disrupted in host cells naturally comprising an egl5 gene.
(140) 16. The method of any of paragraphs 12-15, wherein the egl5 gene is deleted in host cells naturally comprising an egl5 gene.
(141) 17. The method of any of paragraphs 12-16, wherein the egl5 gene is deleted by homologous recombination.
(142) 18. The method of any of paragraphs 12-17, wherein the one or more additional proteins are thermolabile proteins.
(143) 19. The method any of paragraphs 12-18, wherein the one or more additional proteins are selected from the group consisting a cellulase, a hemi-cellulase, and a protease.
(144) 20. The method of any of paragraphs 12-18, wherein the one or more additional proteins are selected from the group consisting of an exo-cellobiohydrolase, an endoglucanase, and a β-glucosidase.
(145) 21. The method of any of paragraphs 12-20, wherein the protein of interest is thermostable by virtue of being reversibly heat-denaturable.
(146) 22. The method of any of paragraphs 12-20, wherein the protein of interest is a hydrophobin.
(147) 23. The method of any of paragraphs 12-22, wherein the elevated temperature is a temperature of 90° C. or more.
(148) 24. The method of any of paragraphs 12-23, wherein exposure to the elevated temperature is for a time of 5 minutes or more.
(149) 25. The method of any of paragraphs 12-23, wherein exposure to the elevated temperature is for a time of 60 minutes or more.
(150) 26. A thermostable or reversibly heat-denaturable protein produced by the method of any of paragraphs 12-25.
(151) 27. A fermentation broth composition obtained from filamentous fungus host cells and comprising a hydrophobin polypeptide, said fermentation broth being substantially free of cellulase and/or mannanase activity.
(152) 28. The fermentation broth composition of paragraph 27, wherein the hydrophobin polypeptide is produced in the presence of thermolabile cellulase and/or mannanase polypeptides, and subjected to an elevated temperature to inactivate the cellulase and/or mannanase polypeptides.
(153) 29. The fermentation broth composition of paragraph 27, wherein the hydrophobin polypeptide is produced in host cells having disrupted genes encoding cellulase and/or mannanase polypeptides.
(154) 30. The fermentation broth composition of paragraph 27, wherein the hydrophobin polypeptide is produced in host cells lacking genes encoding cellulase and/or mannanase polypeptides.
(155) Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.