Anti-BLyS antibody
09828423 · 2017-11-28
Assignee
- WUHAN THERASOURCE BIOSCIENCES INC. (Wuhan, Hubei Province, CN)
- SHANGHAI JUNSHI BIOSCIENCE CO., LTD. (Shanghai, CN)
Inventors
Cpc classification
C07K16/2875
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C07K2317/14
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
A61K39/3955
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
C12P21/02
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K16/24
CHEMISTRY; METALLURGY
A61K39/395
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
Abstract
The present invention belongs to the field of biopharmaceutics. Disclosed is an anti-BLyS antibody. The anti-BLyS antibody specifically targets BLyS, can combine with a B lymphocyte stimulating factor, and can inhibit the combination of the B lymphocyte stimulating factor with the receptor BR3-Fc thereof. Also provided are uses of the anti-BLyS antibody in the manufacture of a medicament for preventing and/or treating diseases caused by the excessive proliferation of B cells such as systemic lupus erythematorsus.
Claims
1. An anti-B lymphocyte Stimulator (anti-BlyS) antibody, wherein the amino acid sequences of the light chains CDR1, CDR2 and CDR3, and the amino acid sequences of the heavy chains CDR1, CDR2 and CDR3 are selected from one of the following groups: (a) SEQ ID NOs: 1, 2, 3, 4, 5, and 6, respectively; (b) SEQ ID NOs: 7, 8, 9, 10, 11, and 12, respectively; (c) SEQ ID NOs: 13, 14, 15, 16, 17, and 18, respectively; (d) SEQ ID NOs: 19, 20, 21, 22, 23, and 24, respectively; and (e) SEQ ID NOs: 25, 26, 27, 28, 29, and 30, respectively.
2. The anti-BLyS antibody according to claim 1, wherein the amino acid sequences of the light chain variable region and the amino acid sequences of the heavy chain variable region of the anti-BLyS antibody are selected from the group consisting of: a: amino acid sequences as shown by SEQ ID NO: 31 and SEQ ID NO: 32; b: amino acid sequences as shown by SEQ ID NO: 33 and SEQ ID NO: 34; c: amino acid sequences as shown by SEQ ID NO: 35 and SEQ ID NO: 36; d: amino acid sequences as shown by SEQ ID NO: 37 and SEQ ID NO: 38; and e: amino acid sequences as shown by SEQ ID NO: 39 and SEQ ID NO: 40.
3. The anti-BLyS antibody according to claim 1, wherein said antibody is humanized.
4. The anti-BLyS antibody according to claim 3, wherein said antibody further comprises a human light chain constant region and a human heavy chain constant region, and the light chain variable region and the heavy chain variable region connect to the human light chain constant region and the human heavy chain constant region respectively.
5. The anti-BLyS antibody according to claim 4, wherein the human light chain constant region is a human light chain κ constant region.
6. The anti-BLyS antibody according to claim 4, wherein the human heavy chain constant region is a human heavy chain Fc fragment.
7. The anti-BLyS antibody according to claim 1, wherein the amino acid sequences of the light chain variable region and the amino acid sequences of the heavy chain variable region of the anti-BLyS antibody are selected from the group consisting of: I: amino acid sequences as shown by SEQ ID NO: 41 and SEQ ID NO: 42; II: amino acid sequences as shown by SEQ ID NO: 43 and SEQ ID NO: 44; III: amino acid sequences as shown by SEQ ID NO: 45 and SEQ ID NO: 46; and IV: amino acid sequences as shown by SEQ ID NO: 47 and SEQ ID NO: 48.
8. A DNA molecule encoding the anti-BLyS antibody of claim 1.
9. The DNA molecule according to claim 8, wherein the DNA molecule has a nucleotide sequence selected from one of SEQ ID NOs: 49-58.
10. A recombinant DNA vector, comprising the DNA molecule of claim 8.
11. A host cell, comprising the recombinant DNA vector of claim 10.
12. A method for preparing an anti-BLyS antibody, comprising: incubating the host cell of claim 11, and obtaining the antibody.
13. A method for treating diseases caused by over proliferation of B cells in an individual in need thereof, comprising administrating to said individual an effective dosage of the anti-BLyS antibody of claim 1.
14. The method according to claim 13, wherein the diseases caused by over proliferation of B cells are selected from systemic lupus erythematosus, rheumatoid arthritis, ankylosing arthritis or B cell lymphoma.
15. A pharmaceutical composition, comprising an effective dosage of the antibody of claim 1 and a pharmaceutically acceptable carrier.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
SPECIFIC EMBODIMENTS
(11) The embodiments of the invention disclose anti-BLyS antibody and the use thereof. The skilled one in the art can achieve them by making reference to this content and improving the process parameter properly. Specially, all the similar replacement and modification are obvious to the skilled one, and are within the scope of the invention. The product of the invention is described by preferred examples, and those skilled in the art can modify or change and combine properly according to the method described herein without departing from the concept, spirit and scope of the invention, to achieve and apply the technology of the invention.
(12) For further understanding the invention, detailed descriptions to the invention are provided below in combination with examples.
Example 1: Cloning and Expression of Human BLyS Gene
(13) Healthy human peripheral blood was isolated, and the total RNA was extracted and purified with commercial RNA kit (Qiagen Company). The first chain of cDNA was synthesized by reverse transcription with purified total RNA being used as template. The cDNA reaction system was as below:
(14) TABLE-US-00003 RNase free dH.sub.2O 9.5 μL 5xRT buffer (with 25 mM Mg.sup.2+) 4 μL dNTP (10 mM each) 2 μL RNase Inhibitor (10 U/μL) 0.5 μL Oligo (dT).sub.20 (10 μmol/L) 1 μL Total RNA template 2 μL ReverTra Ace 1 μL
(15) Sterilized distilled water was added to the system to a total volume of 20 μL.
(16) Reaction conditions were: 30° C. 10 min, 42° C. 30 min, 99° C. 5 min, 4° C. 5 min. The system was placed in an ice bath for 5 min after the reaction was completed.
(17) On the basis of full-length DNA sequence of human BLyS, the cloned secreted BLyS primers P1 and P2 were designed and synthesized. PCR amplification was performed using upstream primer P1 and downstream primer P2 with the cDNA synthesized by reverse transcription being used as template. The nucleotide sequences of P1 and P2 were as below:
(18) TABLE-US-00004 P1: (SEQ ID NO: 59) 5′tacgaagctt gcatcatcat catcatcatg gcggcggctc cggcggcggc tccccgttca gggtccagaa gaa; P2: (SEQ ID NO: 60) 5′cgacgtcgac tcacagcagt ttcaatgcac caaaaaatgt gacatc.
(19) The reaction system of PCR amplification was:
(20) TABLE-US-00005 10xtaq buffer (with 1.5 mM Mg.sup.2+) 5 μL dNTP (5 mM) 4 μL Upstream primer (100 ng/μL) 1 μL Downtream primer (100 ng/μL) 1 μL Template (5-50 ng/μL) 1 μL Taq enzyme (2 U/μL) 0.5 μL
(21) Sterilized distilled water was added to the system to a total volume of 50 μL.
(22) PCR reaction procedure was as follows:
(23) TABLE-US-00006 predenaturating at 94° C. 300 s denaturating at 94° C. 45 s annealing at 55° C. 45 s {close oversize brace} 32 cycles extending at 72° C. 45 s extending at 72° C. 200 s
(24) The product of PCR amplification was recovered by gel electrophoresis, double enzyme digested with Sal I and Hind III, and cloned to pCDNA3.1 eukaryotic expression plasmid system. Using the plasmid transformed with blank vector as control, 3 days after transfecting 293T cells (China Center for Type Culture Collection), the supernatant of culture medium was collected, and purified by His affinity chromatography to obtain purified his-hBLyS protein. It was assayed by SDS-PAGE. The result was shown in
(25) It can be seen from the result in
Example 2: Assaying the Binding Capacity to Receptor on BJAB Cell
(26) 1. Labeling His-hBLyS recombinant protein with biotin.
(27) Purified His-hBLyS recombinant protein obtained from example 1 was mixed with biotin-xx-NHS dissolved in DMSO, in a weight-to-volume ratio of 1:4 in ng/mL, and placed at room temperature for 1 hour. The reaction mixture was chromatographed through a gel column to isolate the biotin-labeled his-hBLyS and free biotin.
(28) 2. Binding biotin-labeled his-hBLyS recombinant protein to BJAB cell.
(29) The isolated biotin-labeled his-hBLyS recombinant proteins were divided into four groups having different concentrations of 25 ng/mL, 50 ng/mL, 100 ng/mL and 200 ng/mL, mixed with 1×10.sup.6 human Burkitt lymphoma cells (BJAB) respectively, incubated at 4° C. for 15 min, washed with PBS for 3 times, added with streptavidin-allophycocyanin (SA-APC) to reach a final concentration of 0.2 μg/mL, and incubated at 4° C. for 20 min. After washing with PBS for 3 times, it was assayed by flow cytometer. The result was shown in
(30) It can be seen from the result of
Example 3: Immunizing Mouse
(31) The his-hBLyS recombinant protein obtained from example 1 was used as antigen to mix with the same amount of immunologic adjuvant (Freund adjuvant). 4 female FVB mice of 6 weeks old were tested, 3 of which were immunized, and the other one was used for control mimic experiment. After first immunization, a reinforce immunization was given once a week. Before the last reinforce immunization, blood was drawn from the tail vein of the immunized mice. The serum was mixed with biotin-labeled his-hBLyS recombinant protein (with a concentration of 50 ng/mL) and incubated at room temperature for 20 min. Then, the mixture was incubated with BJAB cell at 4° C. for 15 min, washed with normal saline for 3 times, added with streptavidin-allophycocyanin of 0.2 μg/mL and incubated at 4° C. for 15 min. After washing with normal saline for 3 times, the sample was assayed by flow cytometer to test whether the serum of immunized mouse can inhibit BLyS from binding to its receptor BR3-Fc. The result was shown in
(32) It can be seen from the result of
Example 4: Cell Fusion and Screening of Monoclonal Hybridoma Cell
(33) After the last reinforce immunization, the lymph node at thigh root of the mouse was harvested, and ground in normal saline. The suspension riched in B cell was taken and fused with myeloma cell SP2/0 by electroporating with routine method. The fused cells were distributed in 96-well plate, and incubated in complete medium RPMI-1640 containing HAT under the condition of 5% CO.sub.2 at 37° C. By enzyme labelled method, 211 clones that secreted the antibodies capable of binding to BLyS protein were screened out of different monoclonal hybridoma cells.
(34) The antibodies produced by 211 clones which can bind to BLyS protein were mixed with biotin-labeled his-hBLyS recombinant protein respectively and incubated at room temperature for 20 min. Then, the mixture was incubated with BJAB cells at 4° C. for 15 min, washed with normal saline for 3 times, added with streptavidin-allophycocyanin of 0.2 μg/mL and incubated at 4° C. for 15 min. After washing with normal saline for 3 times, the sample was assayed on a flow cytometer to screen out the monoclonal hybridoma cells which can inhibit the binding of biotin-labeled his-hBLyS recombinant protein to BJAB cells. As a result, the antibodies secreted by 11 monoclonal hybridoma cells can inhibit the binding of biotin-labeled his-hBLyS recombinant protein to BLyS receptor on BJAB in different degrees, as shown in table 1. The inhibition capacity of antibodies secreted by monoclonal hybridoma cells named as 1D12, 2B10, 2G3, 5A5 and 13G8 was stronger than that of antibodies secreted by monoclonal hybridoma cells named as 3H9, 1D7, and 4D3. The assay results of 1D12, 2B10, 2G3, 5A5 and 13G8 were shown in
(35) TABLE-US-00007 TABLE 1 Subtypes of antibodies secreted by cells which inhibit binding of biotin-labeled his-hBLyS recombinant protein to BLyS receptor on BJAB. Clone Subtype 1 1D12 IgG2b/kappa 2 2B10 IgG2b/kappa 3 2G3 IgG2a/kappa 4 5A5 IgG3/kappa 5 13G8 IgG2a/kappa 6 1D7 IgG2a/kappa 7 2A9 IgG1/kappa 8 4D3 IgG2a/kappa 9 5E5 IgG3/kappa 10 5F4 IgG1/kappa 11 5H5 IgG2b/kappa
Example 5: Testing the Binding to Other Protein of Tumor Necrosis Factor (TNF) Family
(36) For further testing the binding specificity of candidate antibodies, 1 μg/mL his-hBLyS recombinant protein, tumor necrosis factor-α (TNF-α), tumor necrosis factor-β (TNF-β), and BSA were introduced to 96 wells ELISA plate, and stood overnight at 4° C. in carbonate coating buffer of 0.05 M with Ph 9.0. The next day, the solution in the wells was abandoned, and the wells were washed with washing buffer for 3 times. Then, PBS solution containing 3% BSA was added and sealed for 20 min. After washing with washing buffer for 3 times, 100 μL diluted antibodies secreted by monoclonal hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 were added, incubated for 1 hour at room temperature and washed with washing buffer for 3 times. Goat anti-mouse antibody was crosslinked with Horseradish Peroxidase (HRP) diluted with washing buffer at 1:10000 times, and incubated for 1 hour at room temperature. After washing with washing buffer for 3 times, 50 μL 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate solution was added for color development, and reacted at room temperature for 10 min. Then the reaction was terminated with 25 μL sulfuric acid solution of 0.5 M. Absorbance at 450 nm was read. The statistical result was shown in
(37) It can be seen from
Example 6: Determination of the Sequence of the Variable Region of Antibody Secreted by Monoclonal Hybridoma Cell
(38) The monoclonal hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 obtained by screening were incubated. Cells were collected by centrifuging at 1000 rpm. The first chain of cDNA was synthesized by the inverse transcription of individual hybridoma cell RNA extracted according to the method of example 1. The DNA sequence of variable region corresponding to hybridoma cells was amplified with the synthesized first chain of cDNA being used as a template. The primer sequences used in the amplification reaction were as below:
(39) The primers required for amplification of heavy chain was as follows:
(40) TABLE-US-00008 primer 1: (SEQ ID NO: 61) 5′atg g(a/g)a tg(c/g) agctg(t/g) gt(ca) at(c/g) ctc tt; primer 2: (SEQ ID NO: 62) 5′ggg gatatc cacc atg (a/g)ac ttc ggg (t/c) tg agc t(tg)g gtt tt; and primer 3: (SEQ ID NO: 63) 5′ggg tatatc cacc atg get gtc ttg gggctg ctatct.
(41) The primers required for amplification of light chain was as follows:
(42) TABLE-US-00009 primer 1: (SEQ ID NO: 64) 5′ atg gag aca gac aca ctcctgctat; primer 2: (SEQ ID NO: 65) 5′atg gattttcaa gtg cag a tt ttc ag; primer 3: (SEQ ID NO: 66) 5′atg gag (t/a)ca ca(g/t)(t/a)ct cag gtc ttt (g/a)t a; and primer 4: (SEQ ID NO: 67) 5′atg (g/t)cc c(a/t) (g/a) ct cag (c/t)t(c/t) ct(t/g)gt.
(43) The amplification reaction system was:
(44) TABLE-US-00010 10xPCR buffer (with 25 mM Mg.sup.2+) 5 μL dNTP (5 mM) 1 μL Primer mixture of heavy chain or primer mixture of light chain 1 μL (each primer of 100 ng/μL) cDNA (5-50 ng/μL) 1 μL Taq enzyme (2 U/μL) 1 μL
(45) Sterilized distilled water was added to the system to reach a total volume of 50 μL.
(46) PCR reaction procedure was:
(47) TABLE-US-00011 predenaturating at 95° C. 10 min denaturating at 94° C. 1 min annealing at 55° C. 1 min {close oversize brace} 30 cycles extending at 72° C. 115 min extending at 72° C. 10 min
(48) The PCR amplification product was recovered by gel electrophoresis, and sent to biological company for sequencing. Serial analysis was conducted for the obtained sequences according to www.expasy.ch. The amino acid sequences of light chain variable region and heavy chain variable region were shown in table 2. Kabat classification analysis was conducted based on the derived amino acid sequences to determine the FR region and CDR region of light chain and heavy chain of individual hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8. The amino acid sequences of the light chain variable region and the amino acid sequences of the heavy chain variable region of individual hybridoma cells 1D12, 2B10, 2G3, 5A5 and 13G8 were shown in table 2:
(49) TABLE-US-00012 TABLE 2 Amino acid sequences of light chain variable region and heavy chain variable region of anti-BLyS antibody. Amino acid sequences Amino acid sequences of light chain variable region of heavy chain variable region 1D12 SEQ ID NO. 31 SEQ ID NO. 32 2B10 SEQ ID NO. 33 SEQ ID NO. 34 2G3 SEQ ID NO. 35 SEQ ID NO. 36 5A5 SEQ ID NO. 37 SEQ ID NO. 38 13G8 SEQ ID NO. 39 SEQ ID NO. 40
Example 7: The Humanization of Anti-BLyS Antibody
(50) Humanized transformation was performed to the variable region sequences of antibodies secreted by individual hybridoma cells.
(51) The procedure of the humanized transformation mainly involved in the following key steps.
(52) A. The gene sequences of antibodies secreted by individual hybridoma cells were compared with the antibody gene sequences of human embryonic system to find the sequences having high homology.
(53) B. The affinity with HLA-DR was tested by analysis in silicon to select the frame sequence of human embryonic system having low affinity.
(54) C. The frame amino acid sequences of variable region and periphery thereof were analyzed by applying molecular docking utilizing computer simulation technology to investigate the form of stereoscopic combination. By calculating electrostatic force, van der waals force, hydrophobic and hydrophilic properties, and entropy value, the key amino acid individuals in gene sequence of antibody secreted by individual hybridoma cells which may interact with BLyS and maintain the spacial framework were analyzed, and were grafted back to the selected gene frame of human embryonic system. On this basis, 4 different humanized anti-BLyS antibodies were obtained. The sequences of light chain variable region and heavy chain variable region of them were shown in table 3.
(55) TABLE-US-00013 TABLE 3 Sequences of light chain variable region and heavy chain variable region of humanized anti-BLyS antibody. Amino acid sequences Amino acid sequences of light chain variable region of heavy chain variable region I SEQ ID NO. 41 SEQ ID NO. 42 II SEQ ID NO. 43 SEQ ID NO. 44 III SEQ ID NO. 45 SEQ ID NO. 46 IV SEQ ID NO. 47 SEQ ID NO. 48
Example 8: The Construction of Expression Vector of Humanized Anti-BLyS Antibody
(56) The heavy chain constant region Fc fragment was amplified from human blood cell by using upstream primer VH5 and downstream primer VH3. The light chain k constant region was amplified from human blood cell by using upstream primer VL5 and downstream primer VL3. Xho I and Age I endounclease sites were introduced in heavy chain. Sma I and Dra III endounclease sites were introduced in light chain fragment. pCDNA 3.1 plasmid was incorporated, and correct clone was confirmed by sequencing. Sequential experimental materials were all obtained by extracting from the cells which were tranfected by this series of plasmid. The nucleotide sequences of VH5, VH3, VL5 and VL3 were as below:
(57) TABLE-US-00014 VH5: (SEQ ID NO: 68) 5′gcggaattc(c/g)a ggtg(a/c)agct(g/t)c a(c/g)(c/g)a (a/g)tc(a/t)gg; VH3: (SEQ ID NO: 69) 5′accgccggat ccaccaccgc ccg agccacc gccacctgcg gagacgatga cc(a/g)tggtccc; VL5: (SEQ ID NO: 70) 5′ggtggtggatccggeggtgg cggttccgacattgtgatgacccagtc tcca; VL3: (SEQ ID NO: 71) 5′ggatacagttggtgcagcctcgagctacc gttt.
(58) Four humanized antibodies were obtained, which were named as BLyS-I, BLyS-II, BLyS-III and BLyS-IV respectively.
Example 9: Humanized Anti-BLyS Antibodies Inhibit the Prolification of B Cell In Vitro
(59) B cells were extracted by CD19 labeled MACS magnetic beads from human peripheral blood, and were subcultured into 96-well plate in 100,000 per plate and incubated. Recombinant BLyS (10 ng/mL) and Fab fragment of goat anti-human IgM (4 μg/mL) were introduced into complete medium to stimulate the growth of B cell. Different humanized anti-BLyS antibodies having different concentrations obtained from example 8 were introduced into the medium and incubated for 6 days. Thereafter, B cell was counted by Celltiter Glo from Promega Company. The value (RLU) was counted by fluorescence. The result was shown in
(60) It can be seen from
(61) The above examples are only used for helping understand the method of the invention and the concept thereof. For the normal skilled one in the art, many revisions and modifications can be made to the invention, which still fall into the scope of the invention, without departing from the principle of the invention.
Example 10: Pharmacodynamics Study of Humanized Anti-BLyS Antibody In Vivo
(62) 1) Determining the dosage of BLyS for stimulating proliferation of B cell.
(63) Recombinant BLyS having different concentrations were injected into caudal vein of mice. The body weight (gram), spleen weight (mg), and lymph node weight (mg) of the mouse were measured after a week. The results were shown in table 4.
(64) TABLE-US-00015 TABLE 4 Body weight, Spleen weight, lymph node Group ID gram mg weight, mg Average PBS 1 17.8 64.5 7.9 7.6 2 17.9 128 7.3 0.1 mg/kg 3 18.4 99.4 7.8 7.8 4 17.9 98.6 7.8 0.3 mg/kg 5 17.9 107 7.4 8.75 6 17.5 98.6 10.1 0.9 mg/kg 7 18.1 115 12.4 10.2 8 16.6 79.6 8 2.7 mg/kg 9 18 81.6 10.6 12.3 10 18.2 89.3 14
(65) The results showed that self-produced BLyS of 0.3 mg/Kg can effectively stimulate the growth of B cell in vivo. The weight of lymph node can be used as the main pharmacodynamic evaluation indicator for evaluating the proliferation of B cell stimulating by BLyS. This was mainly due to the fact that 50% of the lymph node were B cell, and the ratio of B cell became higher after being stimulated by BLyS.
(66) 2) In vivo study of inhibiting effect of anti-BLyS antibody on BlyS
(67) On this basis, the BLyS of 0.3 mg/kg was mixed with mouse 1D12, 2B10, 2G3, and 5A5 and human BLyS-I (13G8) of 0.05 mg/kg. Then, their lymph node weight and IgA content in serum were measured (see
(68) The result showed: mouse 1D12, 2B10, 2G3, and 5A5 and human BlyS-I (13G8) can effectively inhibit the effect of BLyS.