KDO-FREE PRODUCTION HOSTS FOR OLIGOSACCHARIDE SYNTHESIS
20230174991 · 2023-06-08
Inventors
Cpc classification
C12P19/18
CHEMISTRY; METALLURGY
C12P19/00
CHEMISTRY; METALLURGY
C12P19/04
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12P19/26
CHEMISTRY; METALLURGY
C12Y204/99001
CHEMISTRY; METALLURGY
C12P19/44
CHEMISTRY; METALLURGY
International classification
C12P19/04
CHEMISTRY; METALLURGY
C12P19/18
CHEMISTRY; METALLURGY
C12P19/26
CHEMISTRY; METALLURGY
Abstract
This disclosure relates to the technical field of synthetic biology and metabolic engineering. More particularly, this disclosure relates to the technical field of fermentation of metabolically engineered microorganisms. This disclosure describes engineered micro-organisms that produce oligosaccharides that are free of KDO-lactose impurities and/or KDO-oligosaccharide impurities.
Claims
1. A microbial cell that naturally synthesizes keto-deoxyoctulosonate (KDO), which cell is genetically modified to produce an oligosaccharide, wherein KDO biosynthesis of the cell is knocked out or rendered less functional.
2. The cell according to claim 1, wherein the cell comprises at least one glycosyltransferase with affinity for cytidine 5′-monophospho-3-deoxy-d-manno-2-octulosonic acid (CMP-KDO).
3. The cell according to claim 1, wherein the cell is capable of synthesizing a nucleotide sugar selected from the group consisting of guanosine diphosphate (GDP)-fucose, GDP-mannose, GDP-rhamnose, CMP-N-acetylneuraminic acid, CMP-N-glycolylneuraminic acid, uridine diphosphate (UDP)-glucose, deoxythymidine diphosphate (dTDP)-glucose, UDP-galactose, UDP-N-acetylmannosamine, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, UDP-glucuronic acid, UDP-xylose, UDP-arabinose, and UDP-galacturonic acid.
4. The cell according to claim 1, wherein: an adenosine triphosphate (ATP)-dependent translocator encoding gene is overexpressed; an inner membrane protein encoding gene is overexpressed; a lauroyl acyltransferase encoding gene is overexpressed; an endogenous ATP-dependent translocator encoding gene is modified; and/or an endogenous inner membrane protein encoding gene is modified.
5. The cell according to claim 1, wherein the cell comprises a KDO-independent lauroyl acyltransferase encoding gene and/or wherein the cell comprises an adenosine triphosphate (ATP)-binding cassette multidrug transporter encoding gene.
6. The cell according to claim 4, wherein the ATP-dependent translocator, the inner membrane protein and/or lauroyl acyltransferase is overexpressed by an overexpression of the endogenous gene encoding the ATP-dependent translocator, inner membrane protein and/or lauroyl acyltransferase or by introducing and expressing the ATP-dependent translocator, inner membrane protein and/or lauroyl acyltransferase.
7. The cell according to claim 4, wherein the endogenous ATP-dependent translocator encoding gene is modified and/or the endogenous inner membrane protein encoding gene is modified as a point-mutation.
8. The cell according to claim 4, wherein: the ATP-dependent translocator has 80% or more sequence identity to SEQ ID NO: 4 and has ATP-dependent translocator activity; the inner membrane protein has 80% or more sequence identity to SEQ ID NO: 21 and has transmembrane transporter activity; and/or the lauroyl acyltransferase has 80% or more sequence identity to SEQ ID NO: 1 and has lauroyl acyltransferase activity.
9. The cell according to claim 5, wherein the KDO-independent lauroyl acyltransferase encoding gene and/or the ATP-binding cassette multidrug transporter is i) introduced and expressed or ii) overexpressed in the cell.
10. The cell according to claim 5, wherein the cell expresses a gene encoding the KDO-independent lauroyl acyltransferase of SEQ ID NO: 2 or SEQ ID NO: 3, or a protein having at least 80% sequence identity thereto and having KDO-independent lauroyl acyltransferase activity.
11. The cell according to claim 5, wherein the cell expresses a gene encoding the ATP-binding cassette multidrug transporter of SEQ ID NO: 22, or a protein having at least 80% sequence identity thereto and having transmembrane transporter activity.
12. The cell according to claim 1, comprising at least one gene selected from the group consisting of genes encoding for D-arabinose 5-phosphate isomerase, 3-deoxy-D-manno-octulosonate 8-phosphate synthase, 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, and 3-deoxy-manno-octulosonate cytidylyltransferase, which is rendered less functional or knocked out.
13. The cell according to claim 1, wherein the cell produces a neutral, sialylated and/or fucosylated oligosaccharide.
14. The cell according to claim 1, wherein the cell produces a mammalian milk oligosaccharide.
15. The cell according to claim 2, wherein the glycosyltransferase is a sialyltransferase.
16. The cell according to claim 1, wherein the cell comprises a deleted or inactivated endogenous beta-galactosidase gene.
17. The cell according to claim 16, wherein the deleted or inactivated beta-galactosidase gene comprises E. coli lacZ gene.
18. The cell according to claim 1, wherein the microbial cell further comprises a deleted, inactivated, or mutated galactoside-O-acyltransferase (lacA) encoding gene.
19. The cell according to claim 1, wherein the cell further comprises a polynucleotide encoding at least one of the following additional proteins: an exporter protein or a permease exporting the synthesized oligosaccharide from the microbial cell.
20. The cell according to claim 1, wherein the cell is further genetically modified to contain a polynucleotide encoding a glycosidase for degrading interfering oligosaccharides, intermediates, side products or endogenous oligosaccharides generated by bacterial host cell, wherein the expression of the glycosidase is under control of a regulatory sequence.
21. The microbial cell according to claim 1, which is isolated.
22. A method of using the cell according to claim 1, the method comprising using the cell to produce sialylated oligosaccharides substantially free of KDO-lactose and/or KDO-oligosaccharide.
23. A method for fermentative production of an oligosaccharide substantially free of KDO-oligosaccharide, the method comprising: cultivating a cell in favorable growing conditions, wherein the cell is the microbial cell of claim 1; and optionally separating or isolating the oligosaccharide from the culture.
24. A method for producing a sialylated oligosaccharide by fermentation through genetically modified microbial cell naturally synthesizing keto-deoxyoctulosonate (KDO), the method comprising the steps of: a) obtaining a microbial cell that naturally synthesizes KDO and is able to produce sialylated oligosaccharides and expressing a sialyltransferase with affinity for cytidine 5′-monophospho-3-deoxy-d-manno-2-octulosonic acid (CMP-KDO), and wherein the KDO-biosynthesis route of the cell is knocked out or rendered less functional; b) culturing the cell from step a) in favorable growing conditions, thus producing the sialylated oligosaccharides; and c) optionally, separating or isolating the sialylated oligosaccharide from the culture medium.
25. The method of claim 24, wherein the culture medium comprises at least one precursor for the production of the oligosaccharide.
26. The method of claim 25, wherein the cell produces the precursor internally.
27. The method according to claim 24, wherein the sialylated oligosaccharide is 3′-sialyllactose, 6′-sialyllactose, disialyl lacto-N-tetraose, sialylated lacto-N-triose, sialylated lacto-N-tetraose, sialylated lacto-N-neotetraose, 3-fucosyl-3′-sialyllactose, lacto-N-sialylpentaose LSTa, LSTb, LSTc, or LSTd.
28. The microbial cell of claim 1, wherein the cell is a Gram-negative microbial cell.
29. The method according to claim 24, wherein the oligosaccharide is isolated from the culture medium by means of unit operation selected from the group consisting of centrifugation, filtration, microfiltration, ultrafiltration, nanofiltration, ion exchange, electrodialysis, chromatography, simulated moving bed chromatography, simulated moving bed ion exchange, evaporation, precipitation, crystallization, spray drying and any combination thereof.
30. (canceled)
31. The method of claim 23, wherein the culture comprises at least one precursor for the production of the oligosaccharide.
32. The method of claim 31, wherein the cell produces the precursor internally.
33. The method according to claim 23, wherein the oligosaccharide is isolated from the culture in a manner selected from the group consisting of centrifugation, filtration, microfiltration, ultrafiltration, nanofiltration, ion exchange, electrodialysis, chromatography, simulated moving bed chromatography, simulated moving bed ion exchange, evaporation, precipitation, crystallization, spray drying, and any combination thereof.
34. The microbial cell according to claim 13, wherein the sialylated oligosaccharide is 3′-sialyllactose, 6′-sialyllactose, disialyl lacto-N-tetraose, sialylated lacto-N-triose, sialylated lacto-N-tetraose, sialylated lacto-N-neotetraose, 3-fucosyl-3′-sialyllactose, lacto-N-sialylpentaose LSTa, LSTb, LSTc, or LSTd.
Description
DETAILED DESCRIPTION
[0054] This disclosure provides a microbial host cell. In particular, this disclosure provides a microbial cell naturally synthesizing KDO genetically modified to produce an oligosaccharide. The KDO biosynthesis of the cell is knocked out or rendered less functional.
[0055] In a preferred embodiment, the cell comprises at least one glycosyltransferase with affinity for CMP-KDO. In a further preferred embodiment, the glycosyltransferase is overexpressed.
[0056] In a specific preferred embodiment, the cell according to the disclosure, is capable of synthesizing a nucleotide sugar selected from the group: GDP-fucose, GDP-mannose, GDP-rhamnose, CMP-N-acetylneuraminic acid, CMP-N-glycolylneuraminic acid, UDP-glucose, dTDP-glucose, UDP-galactose, UDP-N-acetylmannosamine, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, UDP-glucuronic acid, UDP-xylose, UDP-arabinose, and/or UDP-galacturonic acid.
[0057] The cell according to the disclosure can comprise i) an overexpressed ATP-dependent translocator encoding gene; and/or ii) an overexpressed inner membrane protein encoding gene; and/or iii) an overexpressed lauroyl acyltransferase encoding gene. Preferably, the inner membrane protein is a transmembrane transporter. Alternatively or additionally, the cell can comprise a modified endogenous ATP-dependent translocator encoding gene; and/or a modified endogenous inner membrane protein encoding gene. Preferably, the inner membrane protein is a transmembrane transporter.
[0058] In a preferred embodiment, the overexpression of the ATP-dependent translocator, the inner membrane protein and/or lauroyl acyltransferase is an overexpression of the endogenous gene encoding the protein. Alternatively, the overexpression is obtained by introducing and expressing the protein(s). It has been shown that overexpression of any of the above proteins provides for a reduced or abolished KDO-biosynthesis. This reduced and/or abolished KDO-biosynthesis provides for production of oligosaccharide without at the same time producing KDO-by-products or KDO-side products, such as KDO-lactose, in general KDO-oligosaccharide or KDO containing lipopolysaccharides.
[0059] In another preferred embodiment, modification of the endogenous ATP-dependent translocator encoding gene and/or the endogenous inner membrane protein encoding gene is a point-mutation. It has been shown herein that also a point mutation in any of the genes encoding the endogenous ATP-dependent translocator or inner membrane protein provides for a reduced or abolished KDO-biosynthesis.
[0060] In preferred embodiments of this disclosure, the ATP-dependent translocator has 80% or more sequence identity to SEQ ID NO: 4 and has ATP-dependent translocator activity; the inner membrane protein has 80% or more sequence identity to SEQ ID NO: 21 and has transmembrane transporter activity and/or the lauroyl acyltransferase has 80% or more sequence identity to SEQ ID NO: 1 and has lauroyl acyltransferase activity.
[0061] The amino acid sequence of the polypeptide used herein can be a sequence chosen from SEQ ID NOS: 4, 21 or 1 of the attached sequence listing. The amino acid sequence of the polypeptide can also be an amino acid sequence that has 80% or more sequence identity, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity to the full length amino acid sequence of any one of SEQ NO 4, 21 or 1.
[0062] In another preferred embodiment, the cell comprises a KDO-independent lauroyl acyltransferase encoding gene and/or an ATP-binding cassette multidrug transporter encoding gene. Preferably, the KDO-independent lauroyl acyltransferase encoding gene and/or the ATP-binding cassette multidrug transporter is/are i) introduced and expressed or ii) overexpressed in the cell. This type of LpxL proteins is independent of KDO modified Lipid IVa, allowing full acylation of the lipidA structure when the KDO biosynthesis pathway is knocked out.
[0063] Preferably, the cell comprises expression of the gene encoding the KDO-independent lauroyl acyltransferase of SEQ ID NO: 2 or SEQ ID NO: 3, or a polypeptide having at least 80% sequence identity thereto and having KDO-independent lauroyl acyltransferase activity. The amino acid sequence of the polypeptide used herein can be a sequence chosen from SEQ ID NO: 2 or 3 of the attached sequence listing. The amino acid sequence can also be an amino acid sequence that has 80% or more sequence identity, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity to the full length amino acid sequence of any one of SEQ ID NO: 2 or 3.
[0064] In a preferred embodiment of this disclosure, the ATP-binding cassette multidrug transporter is LmrA from Lactococcus lactis, preferably comprising SEQ ID NO: 22. In another preferred embodiment, the cell comprises expression of a gene encoding a polypeptide having 80% or more sequence identity to SEQ ID NO: 22 and having transmembrane transporter activity. The amino acid sequence of the polypeptide can also be an amino acid sequence that has 80% or more sequence identity, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity to the full length amino acid sequence of SEQ ID NO: 22.
[0065] In a specific embodiment of the disclosure, the cell is an Escherichia coli wherein an msbA encoding gene is overexpressed and/or an yhjD encoding gene is overexpressed and/or a LpxL encoding gene is overexpressed and/or an endogenous msbA encoding gene is modified and/or an endogenous yhjD encoding gene is modified.
[0066] In a further preferred embodiment, the microbial cell naturally synthesizing KDO and genetically modified to produce an oligosaccharide, as described herein additionally or alternatively comprises at least one of the genes selected from the group of genes encoding for D-arabinose 5-phosphate isomerase, 3-deoxy-D-manno-octulosonate 8-phosphate synthase, 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, and/or 3-deoxy-manno-octulosonate cytidylyltransferase, which is rendered less functional or knocked out.
[0067] The microbial cell according to the disclosure is genetically modified to produce an oligosaccharide. Such oligosaccharide can be any oligosaccharide as described herein. Preferably, the cell produces a neutral, sialylated or fucosylated oligosaccharide. More preferably a mammalian milk oligosaccharide, even more preferably chosen from fucosylated milk oligosaccharides, neutral milk oligosaccharides and/or sialylated milk oligosaccharides.
[0068] In a preferred embodiment, the glycosyltransferase is a sialyltransferase. Preferably, the cell is then producing sialylated oligosaccharide, preferably sialylated mammalian milk oligosaccharide as described herein.
[0069] The cell according to the disclosure described herein can further comprise a deleted or inactivated endogenous beta-galactosidase gene. In case the cell is an E. coli cell, preferably the deleted or inactivated beta-galactosidase gene is E. coli lacZ gene.
[0070] The cell according to the disclosure described herein can further comprise a deleted, inactivated, or mutated galactoside-O-acyltransferase encoding gene. In case the cell is an E. coli cell, preferably the deleted, inactivated, or mutated galactoside-O-acyltransferase encoding gene is E. coli lacA gene.
[0071] The cell according to the disclosure described herein can further comprise a nucleic acid sequence encoding at least one of the following additional proteins: an exporter protein or a permease exporting the synthesized oligosaccharide from the microbial cell. Such exporter or permease will enable the export of the oligosaccharide out of the cell.
[0072] The cell according to the disclosure described herein can further be genetically modified to contain a nucleic acid sequence encoding a glycosidase for the specific degradation of interfering oligosaccharides, such as intermediates, side products or endogenous oligosaccharides generated by bacterial host cell, wherein the expression of glycosidase is under control of a regulatory sequence.
[0073] The cell according to the disclosure described herein can further be an isolated microbial cell according to any invention described herein.
[0074] This disclosure also provides for the use of a cell according to any one of embodiments described herein, for the production of oligosaccharides substantially free of KDO-lactose and/or KDO-oligosaccharide.
[0075] This disclosure provides for a method for the fermentative production of an oligosaccharide substantially free of KDO-oligosaccharide, the method comprising: providing a microbial cell according to any one of the embodiments described herein, cultivating the cells in favorable growing conditions and optionally separating or isolating the oligosaccharide from the culture.
[0076] In a specific embodiment, this disclosure provides for a method for producing a sialylated oligosaccharide by fermentation through a genetically modified microbial cell naturally synthesizing KDO, the method comprising the steps of: [0077] a) Obtaining a microbial cell naturally synthesizing KDO and being capable to produce sialylated oligosaccharides and expressing a sialyltransferase with affinity for CMP-KDO, and wherein the KDO-biosynthesis route of the cell is knocked out or rendered less functional; [0078] b) Culturing the host cell from step a) in favorable growing conditions, thus producing the sialylated oligosaccharide; and [0079] c) Optionally, separating or isolating the sialylated oligosaccharide from the culture medium.
[0080] The culture medium used in the methods described herein preferably comprises precursor for the production of the oligosaccharide, preferably the culture medium comprises any one or more of lactose, galactose, N-acetylglucosamine, N-acetyl-D-lactosamine, Lacto-N-biose, sialic acid, N-acetylneuraminic acid, fucose. Alternatively or additionally, the cell produces the precursor internally; preferably, the cell produces any one or more of lactose, N-acetyl-D-lactosamine, Lacto-N-biose, sialic acid, N-acetylneuraminic acid, fucose.
[0081] According to a preferred embodiment of the disclosure described herein, the microbial cell produces a sialylated oligosaccharide, preferably chosen from the group comprising 3′-sialyllactose, 6′-sialyllactose, disialyl lacto-N-tetraose, sialylated lacto-N-triose, sialylated lacto-N-tetraose, sialylated lacto-N-neotetraose, 3-fucosyl-3′-sialyllactose, lacto-N-sialylpentaose, LSTa, LSTb, LSTc, LSTd. Alternatively or additionally, the cell produces a fucosylated and/or neutral oligosaccharide as described herein.
[0082] According to a preferred embodiment of the disclosure described herein, the microbial cell is a Gram-negative microbial cell, preferably, the cell is an Escherichia coli strain, preferably an Escherichia coli strain, which is a K12 strain, more preferably, the Escherichia coli K12 strain is Escherichia coli K12 substr. MG1655.
[0083] This disclosure, however, contemplates the use of any type of Gram-negative bacterial cell in the construction of microbial cells naturally synthesizing KDO, but wherein the KDO biosynthesis is knocked out or rendered less functional. Examples of Gram-negative bacteria useful in this disclosure include, but are not limited to of Escherichia spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Citrobacter spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter spp., Moraxella spp., Stenotrophomonas spp., Bdellovibrio spp., Acinetobacter spp., Enterobacter spp. and Vibrio spp. Even more preferably, the host cell is selected from Escherichia spp., Salmonella spp., and Pseudomonas spp. In preferred embodiments, Escherichia coli is used. Examples of Escherichia strains that can be used include, but are not limited to, Escherichia coli B, Escherichia coli C, Escherichia coli W, Escherichia coli K12, Escherichia coli Nissle. More specifically, the latter term relates to cultivated Escherichia coli strains—designated as E. coli K12 strains—which are well-adapted to the laboratory environment, and, unlike wild-type strains, have lost their ability to thrive in the intestine. Well-known examples of the E. coli K12 strains are K12 Wild type, W3110, MG1655, M182, MC1000, MC1060, MC1061, MC4100, JM101, NZN111 and AA200. Hence, this disclosure specifically relates to a mutated and/or transformed Escherichia coli strain as indicated above wherein the E. coli strain is a K12 strain. More specifically, this disclosure relates to a mutated and/or transformed Escherichia coli strain as indicated above wherein the K12 strain is E. coli K12 substr. MG1655.
[0084] Alternatively, the E. coli is selected from the group consisting of K-12 strain, W3110, MG1655, B/r, BL21, O157:h7, 042, 101-1,1180, 1357, 1412, 1520, 1827-70, 2362-75, 3431, 53638, 83972, 929-78, 98NK2, ABU 83972, B, B088, B171, B185, B354, B646, B7A, C, c7122, CFT073, DH1, DH5a, E110019, E128010, E74/68, E851/71, EAEC 042, EPECa11, EPECa12, EPECa14, ETEC, H10407, F11, F18+, FVEC1302, FVEC1412, GEMS EPEC1, HB101, HT115, K011, LF82, LT-41, LT-62, LT-68, MS107-1, MS119-7, MS124-1, MS 145-7, MS 79-2, MS 85-1, NCTC 86, Nissle 1917, NT:H19, NT:H40, NU14, O103:H2, O103:HNM, O103:K+, O104:H12, O108:H25, O109:H9, O111H−, O111:H19, O111:H2, O111:H21, O111:NM, O115:H−, O115:HMN, O115:K+, O119:H6, O119:UT, O124:H40, O127a:H6, O127:H6, O128:H2, O131:H25, O136:H−, O139:H28 (strain E24377A/ETEC), O13:H11, O142:H6, O145:H−, O153:H21, O153:H7, O154:H9, O157:12, O157:H−, O157:H12, O157:H43, O157:H45, O157:H7 EDL933, O157:NM, O15:NM, O177:H11, O17:K52:H18 (strain UMN026/ExPEC), O180:H−, O1:K1/APEC, O26, O26:H−, O26:H11, O26:H11:K60, O26:NM, O41:H−, O45:K1 (strain S88/ExPEC), O51:H−, O55:H51, O55:H6, O55:H7, O5:H−, O6, O63:H6, O63:HNM, O6:K15:H31 (strain 536/UPEC), O7:K1 (strain IAI39/ExPEC), O8 (strain IAI1), O81 (strain ED1a), O84:H−, O86a:H34, O86a:H40, O90:H8, O91:H21, O9:H4 (strain HS), O9:H51, ONT:H−, ONT:H25, OP50, Orough:H12, Orough:H19, Orough:H34, Orough:H37, Orough:H9, OUT:H12, OUT:H45, OUT:H6, OUT:H7, OUT:HNM, OUT:NM, RN587/1, RS218, 55989/EAEC, B/BL21, B/BL21-DE3, SE11, SMS-3-5/SECEC, UTI89/UPEC, TA004, TA155, TX1999, and Vir68.
[0085] In the methods of the disclosure, the oligosaccharide can be isolated from the culture medium by means of unit operation selected from the group comprising centrifugation, filtration, microfiltration, ultrafiltration, nanofiltration, ion exchange, electrodialysis, chromatography, simulated moving bed chromatography, simulated moving bed ion exchange, evaporation, precipitation, crystallization, spray drying and any combination thereof.
[0086] In a preferred embodiment of the methods of the disclosure, the produced oligosaccharide or mix of oligosaccharides is separated from the culture.
[0087] As used herein, the term “separating” means harvesting, collecting or retrieving the oligosaccharide from the host cell and/or the medium of its growth as explained herein.
[0088] Oligosaccharide can be separated in a conventional manner from the culture or aqueous culture medium, in which the mixture was made. In case the oligosaccharide is still present in the cells producing the oligosaccharide, conventional manners to free or to extract the oligosaccharide out of the cells can be used, such as cell destruction using high pH, heat shock, sonication, French press, homogenization, enzymatic hydrolysis, chemical hydrolysis, solvent hydrolysis, detergent, hydrolysis, . . . . The culture medium, reaction mixture and/or cell extract, together and separately called oligosaccharide containing mixture or culture, can then be further used for separating the oligosaccharide.
[0089] Typically oligosaccharides are purified by first removing macro components, i.e., first the cells and cell debris, then the smaller components, i.e., proteins, endotoxins and other components between 1000 Da and 1000 kDa and then the oligosaccharide is desalted by means of retaining the oligosaccharide with a nanofiltration membrane or with electrodialysis in a first step and ion exchange in a second step, which consists of a cation exchange resin and anion exchange resin, wherein most preferably the cation exchange chromatography is performed before the anion exchange chromatography. These steps do not separate sugars with a small difference in degree of polymerization from each other. The separation is done, for instance, by chromatographical separation.
[0090] Separation preferably involves clarifying the oligosaccharide containing mixtures to remove suspended particulates and contaminants, particularly cells, cell components, insoluble metabolites and debris produced by culturing the genetically modified cell and/or performing the enzymatic reaction. In this step, the oligosaccharide containing mixture can be clarified in a conventional manner. Preferably, the oligosaccharide containing mixture is clarified by centrifugation, flocculation, decantation and/or filtration. A second step of separating the oligosaccharide from the oligosaccharide containing mixture preferably involves removing substantially all the proteins, as well as peptides, amino acids, RNA and DNA and any endotoxins and glycolipids that could interfere with the subsequent separation step, from the oligosaccharide containing mixture, preferably after it has been clarified. In this step, proteins and related impurities can be removed from the oligosaccharide containing mixture in a conventional manner. Preferably, proteins, salts, by-products, color, and other related impurities are removed from the oligosaccharide containing mixture by ultrafiltration, nanofiltration, reverse osmosis, microfiltration, activated charcoal or carbon treatment, tangential flow high-performance filtration, tangential flow ultrafiltration, affinity chromatography, ion exchange chromatography (such as but not limited to cation exchange, anion exchange, mixed bed ion exchange), hydrophobic interaction chromatography and/or gel filtration (i.e., size exclusion chromatography), particularly by chromatography, more particularly by ion exchange chromatography or hydrophobic interaction chromatography or ligand exchange chromatography. With the exception of size exclusion chromatography, proteins and related impurities are retained by a chromatography medium or a selected membrane, while oligosaccharide remains in the oligosaccharide containing mixture.
[0091] Contaminating compounds with a molecular weight above 1000 Da (dalton) are removed by means of ultrafiltration membranes with a cut-off above 1000 Da to approximately 1000 kDa. The membrane retains the contaminant and the oligosaccharide goes to the filtrate. Typical ultrafiltration principles are well known in the art and are based on Tubular modules, Hollow fiber, spiral-wound or plates. These are used in cross flow conditions or as a dead-end filtration. The membrane composition is well known and available from several vendors, and is composed of PES (Polyethylene sulfone), polyvinylpyrrolidone, PAN (Polyacrylonitrile), PA (Poly-amide), Polyvinylidene difluoride (PVDF), NC (Nitrocellulose), ceramic materials or combinations thereof.
[0092] Components smaller than the oligosaccharide, for instance, monosaccharides, salts, disaccharides, acids, bases, medium constituents are separated by means of a nano-filtration or/and electrodialysis. Such membranes have molecular weight cut-offs between 100 Da and 1000 Da. For an oligosaccharide such as 3′-sialyllactose or 6′-sialyllactose the optimal cut-off is between 300 Da and 500 Da, minimizing losses in the filtrate. Typical membrane compositions are well known and are, for example, polyamide (PA), TFC, PA-TFC, Polypiperazine-amide, PES, Cellulose Acetate or combinations thereof.
[0093] The oligosaccharide is further isolated from the culture medium and/or cell with or without further purification steps by evaporation, lyophilization, crystallization, precipitation, and/or drying, spray drying. Further purification steps allow the formulation of oligosaccharide in combination with other oligosaccharides and/or products, for instance, but not limited to the co-formulation by means of spray drying, drying or lyophilization or concentration by means of evaporation in liquid form.
[0094] In an even further aspect, this disclosure also provides for a further purification of the oligosaccharide. A further purification of the oligosaccharide may be accomplished, for example, by use of (activated) charcoal or carbon, nanofiltration, ultrafiltration or ion exchange to remove any remaining DNA, protein, LPS, endotoxins, or other impurity. Alcohols, such as ethanol, and aqueous alcohol mixtures can also be used. Another purification step is accomplished by crystallization or precipitation of the product. Another purification step is to spray dry or lyophilize oligosaccharide.
[0095] The separated and preferably also purified oligosaccharide can be used as a supplement in infant formulas and for treating various diseases in new-born infants.
[0096] In a specific embodiment, an oligosaccharide is produced by the cell according to any one of embodiments described herein and/or according to the method described in any one of embodiments described herein. The oligosaccharide is added to food formulation, feed formulation, pharmaceutical formulation, cosmetic formulation, or agrochemical formulation.
[0097] Moreover, this disclosure relates to the following specific embodiments:
[0098] 1. Microbial cell naturally synthesizing KDO genetically modified to produce an oligosaccharide, wherein the KDO biosynthesis of the cell is knocked out or rendered less functional.
[0099] 2. A cell according to embodiment 1, wherein the cell comprises at least one glycosyltransferase with affinity for CMP-KDO, preferably the glycosyltransferase is overexpressed.
[0100] 3. A cell according to any one of embodiments 1 and 2, wherein the cell is capable of synthesizing a nucleotide sugar selected from the group: GDP-fucose, GDP-mannose, GDP-rhamnose, CMP-N-acetylneuraminic acid, CMP-N-glycolylneuraminic acid, UDP-glucose, dTDP-glucose, UDP-galactose, UDP-N-acetylmannosamine, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, UDP-glucuronic acid, UDP-xylose, UDP-arabinose, and/or UDP-galacturonic acid.
[0101] 4. The cell according to any one of embodiments 1 to 3, wherein an ATP-dependent translocator encoding gene is overexpressed and/or an inner membrane protein encoding gene is overexpressed and/or an lauroyl acyltransferase encoding gene is overexpressed and/or an endogenous ATP-dependent translocator encoding gene is modified and/or an endogenous inner membrane protein encoding gene is modified, preferably, the inner membrane protein is a transmembrane transporter.
[0102] 5. The cell according to any one of embodiments 1 to 4, wherein the cell comprises a KDO-independent lauroyl acyltransferase encoding gene and/or wherein the cell comprises an ATP-binding cassette multidrug transporter encoding gene.
[0103] 6. Cell according to any one of embodiments 1 to 5, wherein the cell comprises expression of a gene encoding a KDO-independent lauroyl acyltransferase of SEQ ID NO: 2 or SEQ ID NO: 3, or a protein having at least 80% sequence identity thereto and having KDO-independent lauroyl acyltransferase activity.
[0104] 7. Cell according to any one of embodiments 1 to 6, wherein the cell is an Escherichia coli and wherein an msbA encoding gene is overexpressed and/or an yhjD encoding gene is overexpressed and/or a LpxL encoding gene is overexpressed and/or an endogenous msbA encoding gene is modified and/or an endogenous yhjD encoding gene is modified.
[0105] 8. Cell according to any one of embodiments 1 to 7, wherein the ATP-dependent translocator has 80% or more sequence identity to SEQ ID NO: 4 and has ATP-dependent translocator activity; the inner membrane protein has 80% or more sequence identity to SEQ ID NO: 21 and has transmembrane transporter activity and the lauroyl acyltransferase has 80% or more sequence identity to SEQ ID NO: 1 and has lauroyl acyltransferase activity.
[0106] 9. Cell according to any one of embodiments 1 to 8, wherein the overexpression of the ATP-dependent translocator, the inner membrane protein and/or lauroyl acyltransferase is an overexpression of the endogenous gene encoding the protein or obtained by introducing and expressing the protein.
[0107] 10. Cell according to any one of embodiments 1 to 9, wherein the modification of the endogenous ATP-dependent translocator encoding gene and/or the endogenous inner membrane protein encoding gene is a point-mutation.
[0108] 11. Cell according to any one of embodiments 1 to 10, wherein the KDO-independent lauroyl acyltransferase encoding gene and/or wherein the ATP-binding cassette multidrug transporter is i) introduced and expressed or ii) overexpressed in the cell.
[0109] 12. Cell according to any one of embodiments 1 to 11, wherein the cell comprises expression of the gene encoding the KDO-independent lauroyl acyltransferase of SEQ ID NO: 2 or SEQ ID NO: 3, or a protein having at least 80% sequence identity thereto and having KDO-independent lauroyl acyltransferase activity.
[0110] 13. Cell according to any one of embodiments 1 to 12, wherein the cell comprises expression of the gene encoding the ATP-binding cassette multidrug transporter of SEQ ID NO: 22, or a protein having at least 80% sequence identity thereto and having transmembrane transporter activity.
[0111] 14. The cell according to any one of embodiments 1 to 13, wherein at least one of the genes selected from the group of genes encoding for D-arabinose 5-phosphate isomerase, 3-deoxy-D-manno-octulosonate 8-phosphate synthase, 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, and/or 3-deoxy-manno-octulosonate cytidylyltransferase is rendered less functional or knocked out.
[0112] 15. Cell according to any one of embodiments 1 to 14, wherein the cell produces a neutral, sialylated and/or fucosylated oligosaccharide.
[0113] 16. Cell according to any one of embodiments 1 to 15, wherein the cell produces a mammalian milk oligosaccharide, preferably a neutral, sialylated and/or fucosylated milk oligosaccharide.
[0114] 17. Cell according to any one of embodiments 1 to 16, wherein the glycosyltransferase is a sialyltransferase.
[0115] 18. Cell according to any one of embodiments 1 to 17, wherein the cell comprises a deleted or inactivated endogenous beta-galactosidase gene.
[0116] 19. Cell according to embodiment 18, wherein the deleted or inactivated beta-galactosidase gene comprises E. coli lacZ gene.
[0117] 20. Cell according to any one of the preceding embodiments, wherein the microbial cell further comprises a deleted, inactivated, or mutated galactoside-O-acyltransferase (lacA) encoding gene.
[0118] 21. Cell according to any one of the preceding embodiments, wherein the cell further comprises a nucleic acid sequence encoding at least one of the following additional proteins: an exporter protein or a permease exporting the synthesized oligosaccharide from the microbial cell.
[0119] 22. Cell according to any one of the preceding embodiments, wherein the cell is further genetically modified to contain a nucleic acid sequence encoding a glycosidase for the specific degradation of interfering oligosaccharides, such as intermediates, side products or endogenous oligosaccharides generated by bacterial host cell, wherein the expression of the glycosidase is under control of a regulatory sequence.
[0120] 23. An isolated microbial cell according to any one of embodiments 1 to 22.
[0121] 24. Use of a cell according to any one of embodiments 1 to 23, for the production of sialylated oligosaccharides substantially free of KDO-lactose and/or KDO-oligosaccharide.
[0122] 25. Method for the fermentative production of an oligosaccharide substantially free of KDO-oligosaccharide, the method comprising: providing a microbial cell according to any one of embodiments 1 to 23, cultivating the cells in favorable growing conditions and optionally separating or isolating the oligosaccharide from the culture.
[0123] 26. Method for producing a sialylated oligosaccharide by fermentation through genetically modified microbial cell naturally synthesizing KDO, the method comprising the steps of: [0124] a) Obtaining a microbial cell naturally synthesizing KDO and being capable to produce sialylated oligosaccharides and expressing a sialyltransferase with affinity for CMP-KDO, and wherein the KDO-biosynthesis route of the cell is knocked out or rendered less functional; [0125] b) Culturing the cell from step a) in favorable growing conditions, thus producing the sialylated oligosaccharide and [0126] c) Optionally, separating or isolating the sialylated oligosaccharide from the culture medium.
[0127] 27. The method according to any one of embodiment 25 or 26, wherein the culture medium comprises precursor for the production of the oligosaccharide, preferably, the culture medium comprises any one or more of lactose, galactose, N-acetylglucosamine, N-acetyl-D-lactosamine, Lacto-N-biose, sialic acid, N-acetylneuraminic acid, fucose.
[0128] 28. Method according to any one of embodiments 25 to 27, wherein the cell produces the precursor internally, preferably, the cell produces any one or more of lactose, N-acetyl-D-lactosamine, Lacto-N-biose, sialic acid, N-acetylneuraminic acid, fucose.
[0129] 29. Method according to any one of embodiments 25 to 28, wherein the sialylated oligosaccharide is 3′-sialyllactose, 6′-sialyllactose, disialyl lacto-N-tetraose, sialylated lacto-N-triose, sialylated lacto-N-tetraose, sialylated lacto-N-neotetraose, 3-fucosyl-3′-sialyllactose, lacto-N-sialylpentaose LSTa, LSTb, LSTc, LSTd.
[0130] 30. Microbial cell according to any one of embodiments 1 to 23, wherein the sialylated oligosaccharide is 3′-sialyllactose, 6′-sialyllactose, disialyl lacto-N-tetraose, sialylated lacto-N-triose, sialylated lacto-N-tetraose, sialylated lacto-N-neotetraose, 3-fucosyl-3′-sialyllactose, lacto-N-sialylpentaose LSTa, LSTb, LSTc, LSTd.
[0131] 31. Method according to any one of embodiments 25 to 29, wherein the cell is a Gram-negative microbial cell, preferably, the cell is an Escherichia coli strain, preferably an Escherichia coli strain that is a K12 strain, more preferably the Escherichia coli K12 strain is Escherichia coli K12 substr. MG1655.
[0132] 32. Microbial cell according to any one of claim 1 to 23, or 30, wherein the cell is a Gram-negative microbial cell, preferably, the cell is an Escherichia coli strain, preferably an Escherichia coli strain that is a K12 strain, more preferably the Escherichia coli K12 strain is Escherichia coli K12 substr. MG1655.
[0133] 33. The method according to any one of embodiments 25 to 29, or 31, wherein the oligosaccharide is isolated from the culture medium by means of unit operation selected from the group comprising centrifugation, filtration, microfiltration, ultrafiltration, nanofiltration, ion exchange, electrodialysis, chromatography, simulated moving bed chromatography, simulated moving bed ion exchange, evaporation, precipitation, crystallization, spray drying and any combination thereof.
[0134] 34. An oligosaccharide produced by the cell according to any one of embodiments 1 to 23, 30 or 32 and/or according to the method described in any one of embodiments 25 to 29, 31 or 33, wherein the oligosaccharide is added to food formulation, feed formulation, pharmaceutical formulation, cosmetic formulation, or agrochemical formulation.
[0135] The following examples will serve as further illustration and clarification of this disclosure and are not intended to be limiting.
EXAMPLES
Example 1: Material and Methods Escherichia coli
Media
[0136] Three different media were used, namely a rich Luria Broth (LB), a minimal medium for shake flask (MMsf) and a minimal medium for fermentation (MMf). Both minimal media use a trace element mix.
[0137] Trace element mix consisted of 3.6 g/L FeCl.sub.2.4H.sub.2O, 5 g/L CaCl.sub.2.2H.sub.2O, 1.3 g/L MnCl.sub.2.2H.sub.2O, 0.38 g/L CuCl.sub.2.2H.sub.2O, 0.5 g/L CoCl.sub.2.6H.sub.2O, 0.94 g/L ZnCl.sub.2, 0.0311 g/L H.sub.3BO.sub.4, 0.4 g/L Na.sub.2EDTA.2H.sub.2O and 1.01 g/L thiamine.HCl. The molybdate solution contained 0.967 g/L NaMoO.sub.4.2H.sub.2O. The selenium solution contained 42 g/L SeO.sub.2.
[0138] The Luria Broth (LB) medium consisted of 1% tryptone peptone (Difco, Erembodegem, Belgium), 0.5% yeast extract (Difco) and 0.5% sodium chloride (VWR. Leuven, Belgium). Luria Broth agar (LBA) plates consisted of the LB media, with 12 g/L agar (Difco, Erembodegem, Belgium) added.
[0139] The minimal medium for the shake flasks (MMsf) experiments contained 2.00 g/L NH.sub.4Cl, 5.00 g/L (NH.sub.4).sub.2SO.sub.4, 2.993 g/L KH.sub.2PO.sub.4, 7.315 g/L K.sub.2HPO.sub.4, 8.372 g/L MOPS, 0.5 g/L NaCl, 0.5 g/L MgSO.sub.4.7H.sub.2O, 14.26 g/L sucrose or another carbon source when specified in the examples, 1 ml/L trace element mix, 100 μl/L molybdate solution, and 1 mL/L selenium solution. The medium was set to a pH of 7 with 1 M KOH. Depending on the experiment lactose, LNB or LacNAc could be added as a precursor.
[0140] The minimal medium for fermentations (MMf) contained 6.75 g/L NH.sub.4Cl, 1.25 g/L (NH.sub.4).sub.2SO.sub.4, 2.93 g/L KH.sub.2PO.sub.4 and 7.31 g/L KH.sub.2PO.sub.4, 0.5 g/L NaCl, 0.5 g/L MgSO.sub.4.7H2O, 14.26 g/L sucrose, 1 mL/L trace element mix, 100 μL/L molybdate solution, and 1 mL/L selenium solution with the same composition as described above.
[0141] Complex medium, e.g., LB, was sterilized by autoclaving (121° C., 21′) and minimal medium by filtration (0.22 μm Sartorius). When necessary, the medium was made selective by adding an antibiotic (e.g., ampicillin (100 mg/L), chloramphenicol (20 mg/L), carbenicillin (100 mg/L), spectinomycin (40 mg/L) and/or kanamycin (50 mg/L)).
Plasmids
[0142] pKD46 (Red helper plasmid, Ampicillin resistance), pKD3 (contains an FRT-flanked chloramphenicol resistance (cat) gene), pKD4 (contains an FRT-flanked kanamycin resistance (kan) gene), and pCP20 (expresses FLP recombinase activity) plasmids were obtained from Prof. R. Cunin (Vrije Universiteit Brussel, Belgium in 2007).
[0143] Plasmids for additional sialyltransferase expression were constructed in a pSC101 or a p15A ori containing backbone vector, respectively, using Golden Gate assembly. The sialyltransferases used in the enclosed examples are an alpha-2,6-sialyltransferases from Photobacterium sp. JT-ISH-224 and an alpha-2,3-sialyltransferase from Neisseria meningitidis with protein sequence SEQ ID 06 and 07, respectively. Table 1 gives an overview of the genes used to allow the deletion of the KDO biosynthetic pathway and to allow production of sialylated oligosaccharides. Genes that needed to be expressed, be it from a plasmid or from the genome were synthetically synthesized with one of the following companies: DNA2.0, Gen9, IDT or Twist Bioscience, or cloned in the genome of the original organism E. coli K12 and wherein specific genetic mutations are introduced via kits such as Quickchange site-directed mutagenesis (NEB). Expression could be further facilitated by optimizing the codon usage to the codon usage of the expression host. Genes were optimized using the tools of the supplier.
Transcription Units
[0144] Heterologous genes allowing a deletion of the KDO biosynthetic pathway genes and sialyltransferase genes were expressed in different transcriptional units (TUs) using specific promoter, UTR and terminator combinations as enlisted in Table 2. The genes were expressed using promoters from Mutalik et al. (Nat. Methods 2013, No. 10, 354-360), as described herein as “PROM0005,” “PROM0006,” “PROM0012,” “PROM0035,” and “PROM0052” and a promoter from the Anderson promoter library (http://parts.igem.org/Promoters/Catalog/Anderson), as described herein as “PROM0024,” an IPTG-inducible promoter described herein as “PROM0017” and an inducible arabinose promotor as described herein as “PROM0018.” UTRs used as described herein as “UTR0002,” “UTR0006,” “UTR0010,” “UTR0017,” “UTR0018,” “UTR0029,” and “UTR0049” were obtained from Mutalik et al. (Nat. Methods 2013, No. 10, 354-360). Terminators used in the examples are described as “TER0002” (Orosz et al. (Eur. J. Biochem. 1991, 201, 653-59)) and as “TER0004” obtained from Kim et al. (Mol. Cells 1997 Feb. 28; 7(1):110-4). Table 2 shows the overview of the transcriptional units used in the examples by combination of the above promoters, UTRs and terminators.
TABLE-US-00001 TABLE 1 SEQ ID Name/ Country of origin NO: TCDB of digital sequence (protein) group Organism Origin information 01 EcLpxL E. coli K12 substr. MG1655 Synthetic USA 02 FtLpxL1 Francisella tularensis subsp. Synthetic USA Novicida 03 FtLpxL2 Francisella tularensis subsp. Synthetic USA Novicida 04 EcMsbA E. coli K12 substr. MG1655 Synthetic USA 05 NmNeuA N. meningitidis Synthetic UK 06 PbST224 Photobacterium sp. JT-ISH-224 Synthetic Japan 07 NmST N. meningitidis Synthetic UK 08 EclacY Escherichia coli K12 Synthetic US 09 EwcscB Escherichia coli W Synthetic US 10 BaSP Bifidobacterium adolescentis Synthetic Germany 11 Zmfrk Zymomonas mobilis Synthetic UK 12 EcglmS Escherichia coli K12 Synthetic US 13 ScGNA1 Saccharomyces cerevisiae Synthetic US 14 BoAGE Bacteroides ovatus Synthetic US 15 CjneuB Campylobacter jejuni Synthetic US 16 NmlgtA Neisseria meningitidis Synthetic UK 17 NmlgtB Neisseria meningitidis Synthetic UK 18 EcwbgO E. coli O55:H7 Synthetic Germany 19 CjneuC Campylobacter jejuni Synthetic US 20 kdsA E. coli K12 substr. MG1655 Synthetic US 21 yhjD E. coli K12 substr. MG1655 Synthetic US 22 LmrA Lactococcus lactis Synthetic NA
TABLE-US-00002 TABLE 2 Promoter Terminator TU number part CDS part UTR part part TU 01 PROM0012 EcLpxL UTR0049 TER0004 TU 02 PROM0012 EcLpxL UTR0002 TER0004 TU 03 PROM0012 EcLpxL UTR0017 TER0004 TU 04 PROM0006 EcLpxL UTR0049 TER0004 TU 05 PROM0006 EcLpxL UTR0002 TER0004 TU 06 PROM0006 EcLpxL UTR0017 TER0004 TU 07 PROM0052 EcLpxL UTR0029 TER0004 TU 08 PROM0024 EcLpxL UTR0049 TER0004 TU 09 PROM0024 EcLpxL UTR0002 TER0004 TU 10 PROM0024 EcLpxL UTR0017 TER0004 TU 11 PROM0017 EcLpxL UTR0006 TER0004 TU 12 PROM0018 EcLpxL UTR0002 TER0004 TU 13 PROM0012 FtLpxL1 UTR0049 TER0004 TU 14 PROM0012 FtLpxL1 UTR0002 TER0004 TU 15 PROM0012 FtLpxL1 UTR0017 TER0004 TU 16 PROM0006 FtLpxL1 UTR0049 TER0004 TU 17 PROM0006 FtLpxL1 UTR0002 TER0004 TU 18 PROM0006 FtLpxL1 UTR0017 TER0004 TU 19 PROM0052 FtLpxL1 UTR0029 TER0004 TU 20 PROM0024 FtLpxL1 UTR0049 TER0004 TU 21 PROM0024 FtLpxL1 UTR0002 TER0004 TU 22 PROM0024 FtLpxL1 UTR0017 TER0004 TU 23 PROM0012 FtLpxL2 UTR0049 TER0004 TU 24 PROM0012 FtLpxL2 UTR0002 TER0004 TU 25 PROM0012 FtLpxL2 UTR0017 TER0004 TU 26 PROM0006 FtLpxL2 UTR0049 TER0004 TU 27 PROM0006 FtLpxL2 UTR0002 TER0004 TU 28 PROM0006 FtLpxL2 UTR0017 TER0004 TU 29 PROM0052 FtLpxL2 UTR0029 TER0004 TU 30 PROM0024 FtLpxL2 UTR0049 TER0004 TU 31 PROM0024 FtLpxL2 UTR0002 TER0004 TU 32 PROM0024 FtLpxL2 UTR0017 TER0004 TU 33 PROM0017 FtLpxL2 UTR0006 TER0004 TU 34 PROM0018 FtLpxL2 UTR0002 TER0004 TU 35 PROM0035 NmNeuA UTR0018 TER0002 TU 36 PROM0005 PbST224 UTR0010 TER0002 TU 37 PROM0005 NmST UTR0010 TER0002
Strains and Mutations
[0145] Escherichia coli K12 substr. MG1655 [lambda.sup.−, F.sup.−, rph-1] was obtained from the Coli Genetic Stock Center (US), CGSC Strain #: 7740, in March 2007. Gene disruptions as well as gene introductions were performed using the technique published by Datsenko and Wanner (PNAS 97 (2000), 6640-6645). This technique is based on antibiotic selection after homologous recombination performed by lambda Red recombinase. Subsequent catalysis of a flippase recombinase ensures removal of the antibiotic selection cassette in the final production strain.
[0146] Transformants carrying a Red helper plasmid pKD46 were grown in 10 mL LB media with ampicillin, (100 mg/L) and L-arabinose (10 mM) at 30° C. to an OD.sup.600 nm of 0.6. The cells were made electrocompetent by washing them with 50 mL of ice-cold water, a first time, and with 1 mL ice cold water, a second time. Then, the cells were resuspended in 50 μL of ice-cold water. Electroporation was done with 50 μL of cells and 10-100 ng of linear double-stranded-DNA product by using a Gene Pulser™ (BioRad) (600Ω, 25 μFD and 250 volts).
[0147] After electroporation, cells were added to 1 mL LB media incubated 1 hour at 37° C., and finally spread onto LB-agar containing 25 mg/L of chloramphenicol or 50 mg/L of kanamycin to select antibiotic resistant transformants. The selected mutants were verified by PCR with primers upstream and downstream of the modified region and were grown in LB-agar at 42° C. for the loss of the helper plasmid. The mutants were tested for ampicillin sensitivity.
[0148] The linear ds-DNA amplicons were obtained by PCR using pKD3, pKD4 and their derivates as template. The primers used had a part of the sequence complementary to the template and another part complementary to the side on the chromosomal DNA where the recombination must take place. For the genomic knockout, the region of homology was designed 50-nt upstream and 50-nt downstream of the start and stop codon of the gene of interest. For the genomic knock-in, the transcriptional starting point (+1) had to be respected. PCR products were PCR-purified, digested with Dpnl, repurified from an agarose gel, and suspended in elution buffer (5 mM Tris, pH 8.0).
[0149] The selected mutants (chloramphenicol or kanamycin resistant) were transformed with pCP20 plasmid, which is an ampicillin and chloramphenicol resistant plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis. The ampicillin-resistant transformants were selected at 30° C., after which a few were colony purified in LB at 42° C. and then tested for loss of all antibiotic resistance and of the FLP helper plasmid. The gene knockouts and knock-ins are checked with control primers (Fw/Rv-gene-out).
[0150] A sialic acid producing base strain derived from E. coli K12 substr. MG1655 was created by knocking out the genes asl, ldhA, poxB, atpI-gidB and ackA-pta, and knocking out the operons lacZYA, nagAB and the genes nanA, nanE and nanK. Additionally, the E. coli lacY gene (SEQ ID NO: 08) was introduced at the location of lacZYA. A fructose kinase gene (frk, SEQ ID NO: 11) originating from Zymomonas mobilis, an E. coli W sucrose transporter (cscB, SEQ ID NO: 09), a sucrose phosphorylase (SP, SEQ ID NO: 10) originating from Bifidobacterium adolescentis, an E. coli mutant fructose-6-P-aminotransferase (EcglmS*54, as described by Deng et al. (Biochimie 88, 419-29 (2006), SEQ ID NO: 12), glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1, SEQ ID NO: 13), an N-acetylglucosamine-2-epimerase from Bacteroides ovatus (BoAGE, SEQ ID NO: 14) and a sialic acid synthase from Campylobacter jejuni (CjneuB, SEQ ID NO: 15) were knocked in into the genome.
[0151] All strains are stored in cryovials at −80° C. (overnight LB culture mixed in a 1:1 ratio with 70% glycerol).
Cultivation Conditions
[0152] A preculture of 96-well microtiter plate experiments was started from a cryovial, in 150 μL LB and was incubated overnight at 37° C. on an orbital shaker at 800 rpm. This culture was used as inoculum for a 96-well square microtiter plate, with 400 μL MMsf medium by diluting 400×. Each strain was grown in multiple wells of the 96-well plate as biological replicates. These final 96-well culture plates were then incubated at 37° C. on an orbital shaker at 800 rpm for 72 hours, or shorter, or longer.
[0153] Alternatively, a preculture for shake flask experiments was started from a cryovial, in 5 mL LB medium and was incubated for 8 hours at 37° C. on an orbital shaker at 200 rpm. From this preculture, 1 mL was transferred to 100 mL minimal medium (MMsf) in a 500 mL shake flask and incubated at 37° C. on an orbital shaker at 200 rpm for 72 hours, or shorter, or longer. This setup is used for shake flask experiments.
[0154] At the end of the cultivation experiment samples were taken from each well to measure the supernatant concentration (extracellular sugar concentrations, after 5 minutes spinning down the cells), or the whole broth concentration (by boiling the culture broth for 15 minutes at 60° C. before spinning down the cells (=intra- and extracellular sugar concentrations together).
[0155] Also, a dilution of the cultures was made to measure the optical density at 600 nm. The cell performance index or CPI is determined by dividing the oligosaccharide concentrations, e.g., sialyllactose concentrations, measured in the whole broth by the biomass, in relative percentages compared to the reference strain. The biomass is empirically determined to be approximately ⅓.sup.rd of the optical density measured at 600 nm.
[0156] A preculture for the bioreactor was started from an entire 1 mL cryovial of a certain strain, inoculated in 250 mL or 500 mL of MMsf medium in a 1 L or 2.5 L shake flask and incubated for 24 hours at 37° C. on an orbital shaker at 200 rpm. A 5 L bioreactor was then inoculated (250 mL inoculum in 2 L batch medium); the process was controlled by MFCS control software (Sartorius Stedim Biotech, Melsungen, Germany). Culturing conditions were set to 37° C., and maximal stirring; pressure gas flow rates were dependent on the strain and bioreactor. The pH was controlled at 6.8 using 0.5 M H.sub.2S0.sub.4 and 20% NH.sub.4OH. The exhaust gas was cooled. 10% solution of silicone antifoaming agent was added when foaming raised during the fermentation.
Analytical Methods
Optical Density
[0157] Cell density of the cultures was frequently monitored by measuring optical density at 600 nm (Implen Nanophotometer NP80, Westburg, Belgium or with a Spark 10M microplate reader, Tecan, Switzerland).
Productivity
[0158] The specific productivity Qp is the specific production rate of the oligosaccharide product, typically expressed in mass units of product per mass unit of biomass per time unit (=g oligosaccharide/g biomass/h). The Qp value has been determined for each phase of the fermentation runs, i.e., Batch and Fed-Batch phase, by measuring both the amount of product and biomass formed at the end of each phase and the time frame each phase lasted.
[0159] The specific productivity Qs is the specific consumption rate of the substrate, e.g., sucrose, typically expressed in mass units of substrate per mass unit of biomass per time unit (=g sucrose/g biomass/h). The Qs value has been determined for each phase of the fermentation runs, i.e., Batch and Fed-Batch phase, by measuring both the total amount of sucrose consumed and biomass formed at the end of each phase and the time frame each phase lasted.
[0160] The yield on sucrose Ys is the fraction of product that is made from substrate and is typically expressed in mass unit of product per mass unit of substrate (=g oligosaccharide/g sucrose). The Ys has been determined for each phase of the fermentation runs, i.e., Batch and Fed-Batch phase, by measuring both the total amount of oligosaccharide produced and total amount of sucrose consumed at the end of each phase.
[0161] The yield on biomass Yx is the fraction of biomass that is made from substrate and is typically expressed in mass unit of biomass per mass unit of substrate (=g biomass/g sucrose). The Yp has been determined for each phase of the fermentation runs, i.e., Batch and Fed-Batch phase, by measuring both the total amount of biomass produced and total amount of sucrose consumed at the end of each phase.
[0162] The rate is the speed by which the product is made in a fermentation run, typically expressed in concentration of product made per time unit (=g oligosaccharide/L/h). The rate is determined by measuring the concentration of oligosaccharide that has been made at the end of the Fed-Batch phase and dividing this concentration by the total fermentation time.
[0163] The lactose conversion rate is the speed by which lactose is consumed in a fermentation run, typically expressed in mass units of lactose per time unit (=g lactose consumed/h). The lactose conversion rate is determined by measurement of the total lactose that is consumed during a fermentation run, divided by the total fermentation time. Similar conversion rates can be calculated for other precursors such as Lacto-N-biose, N-acetyl-lactosamine, Lacto-N-tetraose, or Lacto-N-neotetraose.
Growth Rate/Speed Measurement
[0164] The maximal growth rate (μMax) was calculated based on the observed optical densities at 600 nm using the R package grofit.
Liquid Chromatography
[0165] Standards for 6′-sialyllactose, 3′-sialyllactose, LNT and LNnT were synthetized in house. Other standards such as but not limited to lactose, sucrose, glucose, glycerol, fructose were purchased from Sigma, and LST, LacNAc and LNB were purchased from Carbosynth.
[0166] TLC analysis for oligosaccharide measurement was carried out on silica gels and the oligosaccharides were eluted with butanol-acetic acid-water (2:1:1 two runs). Sugars were detected by dipping the plate in orcinol sulfuric reagent and heating.
[0167] Carbohydrates were also analyzed via an UPLC-RI (Waters, USA) method, whereby RI (Refractive Index) detects the change in the refraction index of a mobile phase when containing a sample. The sugars were separated in an isocratic flow using an Acquity BEH Amide column (Waters, USA) and a mobile phase containing 70% acetonitrile, 26% ammonium acetate buffer and 4% methanol. The column size was 2.1×100 mm with 1.7 μm particle size. The temperature of the column was set at 25° C. and the pump flow rate was 0.13 mL/minute.
[0168] KDO-oligosaccharides and sialylated oligosaccharides were also measured by LC MS. Separation was performed on a Waters Acquity LC system with column heater set to 30° C. and a PGC column (Hypercarb 100×2.1 mm, 3 μm, Thermo Scientific). The injection volume was 5 μL. The mobile phases consisted of Milli-Q ultrapure water (A) and CH3CN (B), both containing 0.1% CH2O2 and delivered at a flow rate of 200 μL/minute. The gradient consisted of an initial increase from 0 to 12% B over 21 minutes, from 12 to 40% B over 11 minutes, from 40 to 100% B over 5 minutes. A washing step was conducted at 100% B for 5 minutes. The gradient was then decreased to 0% B over 1 minute and maintained at 0% B for 12 minutes for column equilibration. Total run time was 55 minutes. As mass-spectrometer, a Xevo TQ-MS was used with ESI in negative ionization mode, a cone voltage of 20V, desolvation temperature of 350° C. and nitrogen gas flow of 6501/hour. KDO (MW: 237 g/mol) containing oligosaccharides differ in mass from N-acetylneuraminate (MW: 309 g/mol) containing oligosaccharides and can be discriminated as such.
Normalization of the Data
[0169] For all types of cultivation conditions, data obtained from the mutant strains was normalized against data obtained in identical cultivation conditions with reference strains having an identical genetic background as the mutant strains but having an active KDO biosynthesis pathway. The dashed horizontal line on each plot that is shown in the examples, indicates the setpoint to which all adaptations were normalized. All data is given in relative percentages to that setpoint.
Example 2: Production Hosts for the Synthesis of an Oligosaccharide
[0170] A production host was created capable to synthesize a sialylated oligosaccharide. To do so, a sialic acid producing base strain as described in Example 1 was used for the overexpression on plasmid and/or on the genome of a CMP-sialic acid synthetase from Neisseria meningitidis (NmneuA, SEQ ID NO: 05, TU 35) and an α-2,6-sialyltransferase from Photobacterium sp. JT-ISH-224 (PbST224, SEQ ID NO: 06, TU 36). This transferase is known to accept both CMP-sialic acid and CMP-KDO. The production host was cultivated in lactose containing medium as described in Example 1 and formed KDO-lactose and 6′-SL. Oversialylation is avoided by adding lactose in excess to the medium, eliminating the formation of 6,6′-disialyllactose.
[0171] An alternative biosynthetic route toward sialylated oligosaccharides makes use of the internally available UDP-GlcNAc, by expressing a heterologous UDP-GlcNAc-2-epimerase (neuC), converting UDP-GlcNAc to N-acetylmannosamine, which is further converted into sialic acid by means of overexpression of a sialic acid synthase (NeuB) and to CMP-sialic acid by means of the overexpression of a CMP-sialic acid synthase (NeuA). To do so, a sialic acid producing base strain as described in Example 1 without a glucosamine-6-P-aminotransferase from Saccharomyces cerevisiae (ScGNA1, SEQ ID NO: 13) and without an N-acetylglucosamine epimerase from Bacteroides ovatus (BoAGE, SEQ ID NO: 14), but with an UDP-GlcNAc epimerase from Campylobacter jejuni (CjneuC, SEQ ID NO: 19) and a sialic acid synthase from Campylobacter jejuni (CjneuB, SEQ ID NO: 15) was created with the methods as described in Example 1. Further on, this sialic acid producing strain was used for the overexpression on plasmid and/or on the genome of a CMP-sialic acid synthetase from Neisseria meningitidis (NmneuA, SEQ ID NO: 05, TU 35) and an α-2,6-sialyltransferase from Photobacterium sp. JT-ISH-224 (PbST224, SEQ ID NO: 06, TU 36). This transferase is known to accept both CMP-sialic acid and CMP-KDO. The production host was cultivated in lactose containing medium as described in Example 1 and formed KDO-lactose and 6′-SL. Oversialylation is avoided by adding lactose in excess to the medium, eliminating the formation of 6,6′-disialyllactose.
[0172] Also, another production host was created as described in Example 1 capable to synthesize a sialylated oligosaccharide such as sialylated LacNAc (sLacNAc). To allow production of sLacNAc, a sialic acid base strain as described above is modified by the overexpression on plasmid and/or on the genome of a CMP-sialic acid synthetase from Neisseria meningitidis (NmneuA, SEQ ID NO: 05, TU 35) and an α-2,6-sialyltransferase from Photobacterium sp. JT-ISH-224 (PbST224, SEQ ID NO: 06, TU 36). This transferase is known to accept both CMP-sialic acid and CMP-KDO. The production host was cultivated in LacNAc containing medium as described in Example 1 and formed KDO-LacNAc and 6′-sLacNAc. Oversialylation is avoided by adding LacNAc in excess to the medium, eliminating the formation of 6,6′-disialylLacNAc.
[0173] Also, another production host was created as described in Example 1 capable to synthesize a sialylated oligosaccharide such as sialylated LNB (sLNB). To allow production of sLNB, a sialic acid base strain as described above is modified by the overexpression on plasmid and/or on the genome of a CMP-sialic acid synthetase from Neisseria meningitidis (NmneuA, SEQ ID NO: 05, TU 35) and an α-2,6-sialyltransferase from Photobacterium sp. JT-ISH-224 (PbST224, SEQ ID NO: 06, TU 36). This transferase is known to accept both CMP-sialic acid and CMP-KDO. The production host was cultivated in LNB containing medium as described in Example 1 and formed KDO-LNB and 6′-sLNB. Oversialylation is avoided by adding LNB in excess to the medium, eliminating the formation of 6,6′-disialylLNB.
Example 3: A First Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0174] A production host as described in Example 2 was further modified by introducing a point mutation in the endogenous msbA gene (SEQ ID NO: 04) at nucleotide 52 causing a C:G to T:A transition, changing the amino acid form a proline to a serine. The mutation allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0175] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
TABLE-US-00003 TABLE 3 Knockout (KO) / mutation Primer sequence (5′ - 3′) construction attgtgctgcattaattaatcgacattttactcaagattaaggcgatcctccgcggtgcgggtgccaggg kdsA KO (SEQ ID NO: 23) Atgaaaaaagtcttaacgcagaacgctaatactttatttttcaagcaaaaaagactacgcccccaactgag kdsA KO agaac (SEQ ID NO: 24) tgctggaaacggaagcccgcgtgctgactgctgatgagagtaaatcatgaccgcggtgcgggtgccag kdsB KO (SEQ ID NO: 25) taacggtacgacactcctcccaaaattggctgaagtgtcgtgaagtgaaactacgcccccaactgagaga kdsB KO ac (SEQ ID NO: 26) catgatttactgcgtgcaggcgtagtgtaaagattcaaggataaacaacaccgcggtgcgggtgccagg kdsC KO g (SEQ ID NO: 27) agaaccgccagtgatagcacaatgataacccaacgtctggctttactcatctacgcccccaactgagaga kdsC KO ac (SEQ ID NO: 28) gttgtactggttatcgccaatactcgttgaataactggaaacgcattatgccgcggtgcgggtgccaggg kdsP KO (SEQ ID NO: 29) tttgctcattgttgtttatccttgaatctttacactacgcctgcacgcagctacgcccccaactgagagaac kdsD KO (SEQ ID NO:30) agagagcaatgagtgaagcactactgaacgcgggacgtcagacgttaatgccgcggtgcgggtgcca gutQ KO g (SEQ ID NO: 31) cggctggcgaaacgtctgggattgaaggattaaataatcccggcctgatactacgcccccaactgagag gutQ KO (SEQ ID NO: 32) gcatcgtctcaatctggtctcaaatgcataacgacaaagatctctctacgtggcagacattccgccgactgt msbA nt 52: C:G ggtcaacc to T:A (SEQ ID NO: 33) tgccgtctcactaaggtctcacagcttattggccaaactgcattttgtg msbA nt 52: C:G (SEQ ID NO: 34) to T:A gcatcgtctcaatctggtctcaaatgcataacgacaaagatctctctacg msbA nt 148: (SEQ ID NO: 35) C:G to T:A tatgcgtctctgtgacttaaggagcgataacatg msbA nt 148: (SEQ ID NO: 36) C:G to T:A actacgtctcatcacttcttgatgatggctttgg msbA nt 148: (SEQ ID NO: 37) C:G to T:A tgccgtctcactaaggtctcacagcttattggccaaactgcattttgtg msbA nt 148: (SEQ ID NO: 38) C:G to T:A gcatcgtctcaatctggtctcaaatgacgcaggaaaacgagatc vhjD nt 400 C:G (SEQ ID NO: 39) to T:A tatgcgtctcttacactgctgaacggcggtgttg yhjD nt 400 C:G (SEQ ID NO: 40) to T:A actacgtctcatgtacgactgtagggcttgtcg yhjD nt 400 C:G (SEQ ID NO: 41) to T:A atgccgtctcactaaggtctcacagcttaaggctgcgttttcccc yhjD nt 400 C:G (SEQ ID NO: 42) to T:A
TABLE-US-00004 TABLE 4 Knockout Primer sequence (5′ - 3′) (KO) check tccggatggcgaaatttggc (SEQ ID NO: 43) kdsA KO tttactggcttcctggtggc (SEQ ID NO: 44) kdsA KO agatccctatgaaattcgcg (SEQ ID NO: 45) kdsA KO cgcatctggcactgtttgcc (SEQ ID NO: 46) kdsA KO ggtgacattaggatgctgcc (SEQ ID NO: 47) kdsB KO tctttgagttgttcccagcg (SEQ ID NO: 48) kdsB KO cgtctgcttgaaatcattgcc (SEQ ID NO: 49) kdsB KO aatggcttaattcggcacgc (SEQ ID NO: 50) kdsB KO atacgggcgatgagatcccg (SEQ ID NO: 51) kdsC KO ttctgggttatagacgagcg (SEQ ID NO: 52) kdsC KO tgaggcactgaacttaatgc (SEQ ID NO: 53) kdsC KO tgcgaagttgagagtctggc (SEQ ID NO: 54) kdsC KO gtgagtgatccccaatgtggc (SEQ ID NO: 55) kdsD KO cccgcgctgataacgccagg (SEQ ID NO: 56) kdsD KO ctgattgcagaagctgccg (SEQ ID NO: 57) gutQ KO gaagtggcggcggtgcccg (SEQ ID NO: 58) gutQ KO
Example 4: A Second Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0176] A production host as described in Example 2 was further modified by introducing a point mutation in the endogenous msbA gene (SEQ ID NO: 04) at base 148 causing a C:G to T:A transition, changing the amino acid form a proline to a serine. The mutation allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0177] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
Example 5: A Third Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0178] A production host as described in Example 2 was further modified by overexpressing the endogenous msbA (SEQ ID NO: 04) in the production host. The overexpression allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0179] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
Example 6: A Fourth Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0180] A production host as described in Example 2 was further modified by introducing a point mutation in the endogenous yhjD gene causing a C:G to T:A transition at nucleotide number 400 leading to a change from arginine to cysteine at amino acid position 134. The mutation allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0181] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
Example 7: A Fifth Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0182] A production host as described in Example 2 was further modified by introducing additional copies of the endogenous LpxL (SEQ ID NO: 01). The lpxL gene was overexpressed and evaluated in different transcription units (TU 01-TU 12). This overexpressed LpxL gene allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0183] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
Example 8: A Sixth Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0184] A production host as described in Example 2 was further modified by introducing an alternative LpxL gene originating from Francisella tularensis subsp. novicida, LpxL1 (SEQ ID NO: 02). This group of LpxL proteins is independent of KDO modified Lipid IVa, allowing full acylation of the lipidA structure when the KDO biosynthesis pathway is knocked out. The gene was overexpressed and evaluated in different transcription units (TU 13-TU 22). This overexpressed FtLpxL1 gene allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0185] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
Example 9: A Seventh Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0186] A production host as described in Example 2 was further modified by introducing an alternative LpxL gene originating from Francisella tularensis subsp. novicida, LpxL2 (SEQ ID NO: 03). This group of LpxL proteins is independent of KDO modified Lipid IVa, allowing full acylation of the lipidA structure when the KDO biosynthesis pathway is knocked out. The gene was overexpressed and evaluated in different transcription units (TU 23-34). This overexpressed FtLpxL2 gene allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0187] The modified organism was cultivated as described in Example 1 and the formation of KDO-containing oligosaccharides was evaluated. No KDO-oligosaccharides were formed in this host, only 6′-SL, 6′-sLacNAc or 6′-sLNB depending on the used medium.
Example 10: A Production Host for the Synthesis of LSTc
[0188] A production host as described in Example 2 wherein the genes encoding for a beta-1,3-GlcNAc transferase from Neisseria meningitidis (NmlgtA, SEQ ID NO: 16) and a beta-1,4-galactosyltransferase from Neisseria meningitidis (NmlgtB, SEQ ID NO: 17) are introduced in the genome, allowing the synthesis of the precursor LNnT.
[0189] This organism produces in the culture conditions supplemented with lactose as described in Example 1 sialylated lacto-N-neotetraose (LSTc, a-NeuNAc-(2-6)-b-Gal-(1-4)-b-GlcNAc-(1-3)-b-Gal-(1-4)-Glc), and KDO containing oligosaccharides such as KDO-lactose.
Example 11: An Eighth Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0190] The production host as described in Example 10 was further modified by introducing additional copies of EcLpxL (SEQ ID NO: 01), FtLpxL1 (SEQ ID NO: 02) or FtLpxL2 (SEQ ID NO: 03). The LpxL genes were overexpressed and evaluated in different transcription units (TU 01-TU 34). These gene overexpressions allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0191] This organism was cultured in the culture conditions supplemented with lactose as described in Example 1 and produced the sialylated lacto-N-neotetraose (LSTc, a-NeuNAc-(2-6)-b-Gal-(1-4)-b-GlcNAc-(1-3)-b-Gal-(1-4)-Glc). No KDO-containing oligosaccharides were found in the culture medium.
Example 12: A Ninth Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0192] The production host as described in Example 10 was further modified by overexpressing the endogenous msbA (SEQ ID NO: 04) in the production host. The overexpression allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0193] This organism was cultured in the culture conditions supplemented with lactose as described in Example 1 and produced the sialylated lacto-N-neotetraose (LSTc, a-NeuNAc-(2-6)-b-Gal-(1-4)-b-GlcNAc-(1-3)-b-Gal-(1-4)-Glc). No KDO-containing oligosaccharides were found in the culture medium.
Example 13: A Production Host for the Synthesis of LSTb
[0194] The production host as described in Example 2 wherein the genes encoding for a beta-1,3-GlcNAc transferase from Neisseria meningitidis (NmlgtA, SEQ ID NO: 16) and a beta-1,3-galactosyltransferase from E. coli 055:H7 (EcwbgO, SEQ ID NO: 18) are introduced in the genome, allowing the synthesis of the precursor LNT. The organism is further modified with the α-2,6-sialyltransferase ST6gall or ST6Galll instead of the α-2,6-sialyltransferase from Photobacterium sp. JT-ISH-224.
[0195] This organism produces in the culture conditions supplemented with lactose as described in Example 1 sialylated lacto-N-tetraose (LSTb, a-NeuNAc-(2-6)-(b-D-Gal-[1-3])-b-D-GlcNAc-(1-3)-b-D-Gal-(1-4)-Glc), and KDO containing oligosaccharides such as KDO-lactose.
Example 14: A Tenth Modified Production Host Wherein the KDO Biosynthesis Route is Knocked Out
[0196] The production host as described in Example 13 was further modified by introducing additional copies of EcLpxL (SEQ ID NO: 01), FtLpxL1 (SEQ ID NO: 02) or FtLpxL2 (SEQ ID NO: 03). The LpxL genes were overexpressed and evaluated in different transcription units (TU 01-TU 34). These gene overexpressions allowed the deletion of the KDO biosynthesis pathway. In particular, the KDO biosynthesis pathway genes coding for D-arabinose 5-phosphate isomerase, which is for E. coli coded by gutQ and kdsD, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate synthase, which is for E. coli coded by kdsA, the genes coding for 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase, which is for E. coli coded by kdsC, and/or the gene coding for 3-deoxy-manno-octulosonate cytidylyltransferase, which is for E. coli coded by kdsB were deleted. Primers to construct these genetic deletions and the specific msbA mutation are listed in Table 3. Primers to check the specific KDO pathway gene knockouts are listed in Table 4.
[0197] This organism was cultured in the culture conditions supplemented with lactose as described in Example 1 and produced sialylated lacto-N-tetraose (LSTb, a-NeuNAc-(2-6)-(b-D-Gal-[1-3])-b-D-GlcNAc-(1-3)-b-D-Gal-(1-4)-Glc). No KDO-containing oligosaccharides were found in the culture medium.
Example 15: Modified Production Hosts Wherein the KDO Biosynthesis Route is Knocked Out for the Synthesis of 3′-Sialyllactose (3′-SL)
[0198] The production hosts as described in Example 3 to 9 were modified so that the 6′-SL forming transferase is replaced by a 3′-SL forming transferase. The α-2,3-sialyltransferase from Neisseria meningitidis (NmST, SEQ ID NO: 07) was expressed on a plasmid and/or on the genome within TU 37.
[0199] These organisms were cultured in the culture conditions supplemented with lactose, LacNAc or LNB as described in Example 1 and produced 3′-SL, 3′-sLacNAc or 3′-sLNB depending on the used medium. Within the culture fluid no KDO-containing oligosaccharides were found.
Example 16: Modified Production Hosts Wherein the KDO Biosynthesis Route is Knocked Out for the Synthesis of LSTd
[0200] The production hosts as described in Example 15, wherein the genes encoding for a beta-1,3-GlcNAc transferase from Neisseria meningitidis (NmlgtA, SEQ ID NO: 16) and a beta-1,4-galactosyltransferase from Neisseria meningitidis (NmlgtB, SEQ ID NO: 17) are introduced in the genome, allowing the synthesis of the precursor LNnT.
[0201] These organisms were cultured in the culture conditions supplemented with lactose as described in Example 1 and produced LSTd (a-NeuNAc-(2-3)-b-D-Gal-(1-4)-b-D-GlcNAc-(1-3)-b-D-Gal-(1-4)-Glc). Within the culture fluid no KDO-containing oligosaccharides were found.
Example 17: Modified Production Hosts Wherein the KDO Biosynthesis Route is Knocked Out for the Synthesis of LSTa
[0202] The production hosts as described in Example 15, wherein the genes encoding for a beta-1,3-GlcNAc transferase from Neisseria meningitidis (NmlgtA, SEQ ID NO: 16) and a beta-1,3-galactosyltransferase from E. coli 055:H7 (EcwbgO, SEQ ID NO: 18) are introduced in the genome, allowing the synthesis of the precursor LNT.
[0203] These organisms were cultured in the culture conditions supplemented with lactose as described in Example 1 and produced LSTa (a-NeuNAc-(2-3)-b-D-Gal-(1-3)-b-D-GlcNAc-(1-3)-b-D-Gal-(1-4)-Glc). Within the culture fluid no KDO-containing oligosaccharides were found.
Example 18: Modified Production Hosts Wherein the KDO Biosynthesis Route is Knocked Out for the Synthesis of DSLNT
[0204] The production hosts as described in Example 15, wherein the genes encoding for a beta-1,3-GlcNAc transferase from Neisseria meningitidis (NmlgtA, SEQ ID NO: 16) and a beta-1,3-galactosyltransferase from E. coli 055:H7 (EcwbgO, SEQ ID NO: 18) are introduced in the genome, allowing the synthesis of the precursor LNT. Beside the α-2,3-sialyltransferase from Neisseria meningitidis (NmST, SEQ ID NO: 07), an extra α-2,6-sialyltransferase like ST6gall or ST6Galll was expressed on a plasmid and/or on the genome.
[0205] These organisms were cultured in the culture conditions supplemented with lactose as described in Example 1 and produced DSLNT (a-NeuNAc-(2-3)-b-Gal-(1-3)-[a-NeuNAc-(2-6)]-b-GlcNAc-(1-3)-b-Gal-(1-4)-Glc). Within the culture fluid no KDO-containing oligosaccharides were found.
Example 19: Rendering Genes Less Functional
[0206] So called rendering genes less functional is a common practice in biotechnology. As described above there are several techniques to lower expression or render a gene less functional (such as the usage of siRNA, CrispR interference, RNAi, miRNA, asRNA, mutating genes, knocking-out genes, transposon mutagenesis, . . . ).
[0207] CrispR interference is one of the newest techniques in rendering genes less functional. It entails the design of an sgRNA that recognizes the gene of interest (the gene to be rendered less functional) and the expression of a mutated RNA-guided DNA endonuclease enzyme that lost its endonuclease activity (e.g., the dCas9 protein). The sgRNA is composed of a base pairing region mostly existing of 20 nucleotides downstream or upstream next to a PAM region (e.g., NGG in the case of dCas9). The base pairing region is complementary to a region into the target gene. The closer the base pairing region binds to the 5′ end of the gene target, the better the repression. To avoid off target repression, the base pairing region is BLASTed against the genome, ensuring there are no other regions complementary to the base pairing region apart from the gene of interest. An example of a design tool is described by Doench et. al. 2016 [Nature Biotechnology volume 34, pages 184-191(2016)] and is provided by most synthetic DNA providers.
[0208] Both dCas9 and the sgRNA are expressed in the cell according to the methods described in Example 1. Preferentially both are expressed from the genome, ensuring stable expression over several generations.
[0209] As an example, the kdsA gene with SEQ ID NO: 20 was rendered less functional by using the CrispRi technique described above. The used sgRNA was CCGCTCCTCCATCCACTCTTATCGTGGACC with TGG as a PAM sequence (nucleotides 186-215 of SEQ ID NO:20). The sequence was expressed by means of a constitutive promoter sequence (“PROM0012”) as described in Example 1. The expression cassette, together with dCas9, were introduced in the strains described in Example 2. In the resulting strains the KDO biosynthesis pathway was rendered less functional and hence no detectable KDO oligosaccharides are formed.