SYSTEM FOR IMPROVED PRODUCTION TITERS IN FERMENTATIONS
20220348971 · 2022-11-03
Inventors
Cpc classification
C12P5/026
CHEMISTRY; METALLURGY
C12P7/40
CHEMISTRY; METALLURGY
C12P7/64
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12N15/72
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12N15/72
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
C12P7/40
CHEMISTRY; METALLURGY
Abstract
The invention provides a genetically modified micro-organism for intracellular biosynthesis of a cellular metabolite, comprising a synthetic error correction system having a penalty gene, whose expression leads to arrested growth or cell death (e.g. a toxin gene) in combination with a survival gene, whose expression provides an antidote that restores cell viability and normal growth (e.g. a cognate antitoxin gene). Alternatively, the system has a survival gene, alone, whose expression is essential for growth (i.e. essential gene). The synthetic error correction system further comprises a biosensor, whose function is to induce expression of the survival gene which leads to cell growth, only, when the cell produces a pre-defined level of a given metabolite. The invention further encompasses: a method for producing the genetically modified micro-organism; a method for producing a cellular metabolite with the genetically modified micro-organism; and use of the genetically modified micro-organism for producing a cellular metabolite.
Claims
1-15. (canceled)
16. A genetically modified microbial cell for intracellular biosynthesis of a cellular metabolite comprising: a. a first nucleic acid molecule wherein the transcription and/or translation of said molecule yields a biosensor capable of binding said cellular metabolite to form a complex; and b. a second nucleic acid molecule comprising a coding sequence encoding an essential protein, wherein expression alone of said coding sequence is essential for cell growth and/or survival, wherein: (1) said cell is not viable when said coding sequence encoding said essential protein is knocked-out; (2) the second nucleic acid molecule is operably linked to a first promoter; (3) said essential protein encoded by said second nucleic acid molecule is expressed when said second nucleic acid molecule is induced by said complex when said biosensor and said biosynthetic metabolite form said complex; and (4) arrest of growth and /or death of said cell due to an absence of complex formation does not depend on whether an externally supplied compound is present.
17. The genetically modified microbial cell of claim 16, wherein said first promoter is an inducible promoter.
18. The genetically modified cell of claim 16, wherein: (1) the second nucleic acid molecule is operably linked to a first promoter and a non-native ribosomal binding site; and (2) the nucleotide sequence of the ribosomal binding site regulates the rate of translation of the essential protein coding sequence in said cell such that multiplication of said cell or progeny cell is attenuated by a lack of biosynthetic metabolite production by the cell when cultured in a nutrient rich cultivation medium when compared to a parental cell lacking said first nucleic acid molecule and said second nucleic acid molecule.
19. The genetically modified cell of claim 16, wherein the nucleotide sequence of the ribosomal binding site regulates the rate of translation of the essential protein coding sequence in said cell such the multiplication of said cell or progeny cell is not attenuated during biosynthetic metabolite production by the cell when cultured in a nutrient rich cultivation medium when compared to a parental cell lacking said first nucleic acid molecule and said second nucleic acid molecule.
20. The genetically modified microbial of claim 18, wherein the sequence of the non-native ribosomal binding site modifies the rate of translation of the coding sequence encoding the essential protein compared to a native ribosomal binding site operably linked to the coding sequence encoding the essential protein.
21. The genetically modified microbial of claim 18, wherein the ribosomal binding site is obtained from variants of a native ribosomal binding site operably linked to the coding sequence encoding the essential protein, said variants predicted to modify the translational strength of the encoded essential protein.
22. The genetically modified microbial of claim 16, wherein the second nucleic acid molecule is a chromosomally located molecule.
23. The genetically modified microbial of claim 16, wherein a lack of biosynthetic metabolite production in said genetically modified microbial cell or progeny cell thereof attenuates multiplication of said cell as compared to the biosynthetic metabolite producing a genetically modified microbial cell.
24. The genetically modified microbial cell of claim 16, wherein the cellular metabolite is selected from the group consisting of: isoprenoid(s), vitamin(s), carboxylic acid(s), amino acid(s), fatty acid(s), alcohol(s), and polyketide(s).
25. A method for producing a biosynthetic metabolite comprising the steps of: a) providing a pre-seed microbial cell culture of genetically modified microbial cells wherein each cell comprises: i. a first nucleic acid molecule wherein said molecule is transcribed and/or translated to yield a biosensor and said biosensor binds to said biosynthetic metabolite to form a complex; and ii. a second nucleic acid molecule comprising a coding sequence encoding an essential protein wherein expression alone of said coding sequence is essential for cell growth and/or survival, wherein: (1) said cell is not viable when said coding sequence encoding said essential protein is knocked-out; (2) said essential protein encoded by said second nucleic acid molecule is expressed when said second nucleic acid molecule is induced by said complex when said biosensor and said biosynthetic metabolite form said complex; and (3) growth of said cell is arrested by an absence of complex formation; (4) arrest of growth does not depend on whether an externally supplied compound is present; b) introducing the pre-seed microbial cell culture into a nutrient rich cultivation medium comprising a substrate for production of said biosynthetic metabolite, wherein the cells of the cell culture produce said biosynthetic metabolite and undergo at least 40, 45, 50, 60, 70 or 150 generations of cell multiplication, and c) recovering the biosynthetic_metabolite produced by said culture, wherein (i) the productive life-time of said culture is prolonged by preventing proliferation of non-producing spontaneous mutants.
26. The method of claim 25, wherein the production of the metabolite has a high fitness cost of production of greater than or equal to about 15%, greater than or equal to about 20%, or greater than or equal to about 25%.
27. The method of claim 25, wherein: (1) the second nucleic acid molecule is operably linked to a first promoter and a non-native ribosomal binding site; and (2) the nucleotide sequence of the ribosomal binding site regulates the rate of translation of the essential protein coding sequence in said cell such that multiplication of said cell or progeny cell is attenuated by a lack of biosynthetic metabolite production by the cell when cultured in a nutrient rich cultivation medium when compared to a parental cell lacking said first nucleic acid molecule and said second nucleic acid molecule.
28. The method of claim 25, wherein the nucleotide sequence of the ribosomal binding site regulates the rate of translation of the essential protein coding sequence in said cell such the multiplication of said cell or progeny cell is not attenuated during biosynthetic metabolite production by the cell when cultured in a nutrient rich cultivation medium when compared to a parental cell lacking said first nucleic acid molecule and said second nucleic acid molecule.
29. The method of claim 27, wherein the sequence of the non-native ribosomal binding site modifies the rate of translation of the coding sequence encoding the essential protein compared to a native ribosomal binding site operably linked to the coding sequence encoding the essential protein.
30. The method of claim 27, wherein the ribosomal binding site is obtained from variants of a native ribosomal binding site operably linked to the coding sequence encoding the essential protein, said variants predicted to modify the translational strength of the encoded essential protein.
31. The method of claim 25, wherein the second nucleic acid molecule is a chromosomally located molecule.
32. The method of claim 25, wherein a lack of biosynthetic metabolite production in said genetically modified microbial cell or progeny cell thereof attenuates multiplication of said cell as compared to the biosynthetic metabolite producing a genetically modified microbial cell.
33. The method of claim 25, wherein the cell in the culture medium is cultivated under continuous, fed-batch or batch culture.
34. The method of claim 25, wherein the genetically modified microbial cells in the culture medium are cultivated under continuous culture.
35. The method of claim 25, wherein the genetically modified microbial cells in the culture medium are cultivated under fed-batch culture.
36. The method of claim 25, wherein the genetically modified microbial cells are bacterial cells.
Description
DESCRIPTION OF THE INVENTION
Figures
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
Abbreviations and Terms:
[0071] gi number: (genInfo identifier) is a unique integer which identifies a particular sequence, independent of the database source, which is assigned by NCBI to all sequences processed into Entrez, including nucleotide sequences from DDBJ/EMBL/GenBank, protein sequences from SWISS-PROT, PIR and many others.
[0072] Amino acid sequence identity: The term “sequence identity” as used herein, indicates a quantitative measure of the degree of homology between two amino acid sequences of substantially equal length. The two sequences to be compared must be aligned to give a best possible fit, by means of the insertion of gaps or alternatively, truncation at the ends of the protein sequences. The sequence identity can be calculated as ((Nref−Ndif)100)/(Nref), wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. Sequence identity can alternatively be calculated by the BLAST program e.g. the BLASTP program (Pearson W. R and D. J. Lipman (1988)) (www.ncbi.nlm.nih.gov/cgi-bin/BLAST). In one embodiment of the invention, alignment is performed with the sequence alignment method ClustalW with default parameters as described by Thompson J., et al 1994, available at http://www2.ebi.ac.uk/clustalw/. Preferably, the numbers of substitutions, insertions, additions or deletions of one or more amino acid residues in the polypeptide as compared to its comparator polypeptide is limited, i.e. no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 insertions, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additions, and no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions. Preferably the substitutions are conservative amino acid substitutions: limited to exchanges within members of group 1: Glycine, Alanine, Valine, Leucine, Isoleucine; group 2: Serine, Cysteine, Selenocysteine, Threonine, Methionine; group 3: Proline; group 4: Phenylalanine, Tyrosine, Tryptophan; Group 5: Aspartate, Glutamate, Asparagine, Glutamine.
[0073] Native gene: endogenous gene in a microbial cell genome, homologous to host micro-organism.
[0074] Biosensor: Suitable biosensor effectors (small molecules or metabolites detectable by a sensor) and their sensors can be found in the Reg Precise Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes, available at:
http://regprecise.ibl.gov/RegPrecise/collections_effector.isp
[0075] Cell multiplication: process whereby cells multiply in number, as one cell divides into two cells, these two cells both divides to become four cells, four cells become eight, eight cells become sixteen etc. Each round of cell multiplication, by cell division, yields a new cell generation.
[0076] Cognate: in the context of Toxin-Antitoxin systems; an antitoxin protein interacts with its cognate toxin to neutralise the activity of the toxin.
[0077] Fitness cost: reduction in growth rate of a microbial cell e.g. due to producing a small molecule or metabolite (including a protein), measured relative to the growth rate of a reference microbial cell where production is inactivated. Fitness cost of a metabolic pathway can also be observed as an increase in growth lag phase, again relative to a reference cell where this pathway is inactivated.
[0078] Growth inhibitor/retardant of external origin: in the context of the invention, a growth inhibitor/retardant is a component of external origin that can inhibit or retard the growth of a micro-organism (such as a toxin or antibiotic), that is not produced by the micro-organism itself, but instead is supplied to the micro-organism either by addition to or its presence in the growth medium or environment in which the micro-organism is cultured.
[0079] Operably linked: a gene (nucleic acid molecule comprising a coding sequence) is operably linked to a promoter when its transcription is under the control of the promoter and where transcription results in a transcript whose subsequent translation yields the product encoded by the gene. Similarly a first nucleic acid molecule encoding a riboswitch may be operably linked to a second nucleic acid molecule upstream of its coding sequence; and also operably linked downstream of a promoter; whereby transcription of the downstream first nucleic acid molecule comprising the riboswitch linked to the second nucleic is under the control of the promoter and results in a transcript; and whereby translation of the transcript so produced (comprising the riboswitch and coding sequence) is under the control of the riboswitch.
[0080] Toxic: in the context of the invention a protein is defined as toxic if arrests or limits cell growth and/or prevents cell survival; e.g. a protein toxin.
DETAILED DESCRIPTION OF THE INVENTION
[0081] The present invention aims to prolong the productive life-time of an industrial fermentation by preventing the observed drift of a population of cells in an industrial fermentation from a productive state to a non-productive state. This drift typically arises as a result of spontaneous genetic mutations in cells of the production organism during continuous growth, and where a competitive advantage of a non-producing mutant favors its proliferation.
I: A Genetically Modified Microbial Cell Comprising a Synthetic Error Correction System Controlled by a Metabolite Biosensor
[0082] The invention is based on the general concept of a synthetic error correction system which is illustrated in
[0083] The second key component of the system is a biosensor, whose function is to induce an appropriate gene regulation response leading to cell growth only when the cell produces a pre-defined level of a given metabolite. Cell survival and growth is said to be “addicted” to the presence of its metabolite i.e. to its addiction molecule. The functional properties of the biosensor depend on the type of gene regulation response required. If the system employs a penalty gene (such as a toxin gene) in combination with a survival gene (a cognate anti-toxin gene), then cell survival requires an “ON” type sensor linked to the expression of the survival gene. If the system employs a penalty gene alone (and no antidote), then an “OFF” type sensor is required. If the system employs a survival gene alone (e.g. essential genes) a metabolite-linked “ON” type sensor is needed as in the first scenario.
[0084] Accordingly, the fate of a cell, namely its survival and growth versus its arrested growth and eventual death, when employing this system, is determined by its continued production of a given metabolite, which is the product, or a close biosynthesis intermediate of the product of the industrial fermentation. A key feature of the synthetic error correction system in cells of the invention, is that the penalty executed by means of the error correction system in non-producing cells is realized by the expression of the penalty gene(s) and/or the failure to express the survival gene(s) (i.e. the expression of these genes and the cellular products thereof is both necessary and sufficient for achieving error correction). Accordingly, the arrest of growth or death of non-producing cells of the invention does not require the presence or addition of externally supplied compounds (e.g. toxins or antibiotics) for the execution of the penalty. This is an advantageous feature of the present invention, since the use of antibiotics or other growth retardants in the cultivation medium during industrial scale microbial fermentation would compromise the economics, biosafety and stability of production. The invention provides a genetically modified microbial cell for use in the intracellular biosynthesis of a cellular metabolite, comprising the above described synthetic error correction system. The genetically modified microbial cell comprises at least: a first nucleic acid molecule wherein the transcription and/or translation of said molecule yields a biosensor capable of binding the cellular metabolite to form a complex; and a second nucleic acid molecule comprising a coding sequence operably linked to a promoter, and encoding a protein required for cell growth and/or survival; and optionally a third nucleic acid molecule comprising a coding sequence operably linked to a promoter, and encoding a protein that inhibits the growth and/or survival of the cell. The expression of the protein encoded by the second nucleic acid molecule is induced when the biosensor and the cellular metabolite form a complex. Various embodiments of the genetically modified microbial cell of the invention are described below:
II: A Genetically Modified Microbial Cell Comprising a Toxin-Antitoxin System Controlled by a Metabolite Biosensor
[0085] According to a first embodiment, the genetically modified microbial cell, which is for use in the intracellular biosynthesis of a given cellular metabolite, is a cell comprising a toxin-antitoxin system controlled by a metabolite biosensor which has at least the following features: [0086] 1. a first nucleic acid molecule encoding a transcription factor that functions as a biosensor and is capable of binding to the cellular metabolite produced by the cell to form a complex. The complex functions as an “activated transcription complex” in that it is able to interact with a gene promoter and induce expression of its cognate coding sequence; and [0087] 2. a second nucleic acid molecule which is operably linked to an inducible promoter and comprises a coding sequence encoding an anti-toxin protein that is cognate to and binds to the toxin, whereby the anti-toxin acts as an antidote to the toxin and permits the survival and growth of the cell; and [0088] 3. a third nucleic acid molecule encoding a toxin protein wherein the nucleic acid molecule comprises a coding sequence that is operably linked to a constitutive promoter; [0089] wherein expression of the antitoxin encoded by the second nucleic acid molecule is induced when the transcription factor and the cellular metabolite form a complex. As stated above, this complex, which functions as an “activated transcription complex” is capable of binding to the inducible promoter of the second nucleic acid molecule so as to induce expression of the antitoxin.
[0090] The Toxin/Antitoxin (TA) system, as used herein, is a two-component system whose features are used to slow the growth, or eliminate, non-producing micro-organisms that arise in a proliferating cell population during production of a metabolite e.g. during fermentation. The general concept of TA systems is given by the name: one component is a toxin molecule which affects a critical function in a cell, and the second component is an antitoxin that, upon expression in the cell, can cancel the effect of the toxin. The toxin usually causes growth arrest or cell death by impairing functions such as transcription, translation, cell division (replication and cytoskeleton formation), or membrane stability.
[0091] Examples of suitable TA systems include the type II TA pair, yefM-yoeB, from E. coli. The YoeB protein is a toxin that functions as an mRNA interferase, and binds to the 50S subunit of the ribosome to block translation initiation. The YoeB protein also has endoribonuclease activity without association to the ribosome. The antitoxin, YefM, forms a dimer which binds a single YoeB molecule to form a stable complex, which inactivates the mRNA-degrading action of YoeB. The YefM antitoxin is very sensitive to degradation by the Lon protease, whereby YoeB is then released and causes a growth arrest. Since the antitoxin has a short half-life, the absence of cellular metabolite required for continued expression of the antitoxin rapidly leads to release of the toxin and subsequent growth arrest.
[0092] The amino acid sequence of a functional YefM anti-toxin encoded by the coding sequence of the second nucleic acid molecule, has at least 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 99, or 100% sequence identity to SEQ ID No: 2.
[0093] The amino acid sequence of a functional YoeB toxin encoded by the coding sequence of the third nucleic acid molecule, has at least 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 99, or 100% sequence identity to SEQ ID No: 3.
[0094] Alternative suitable TA pairs include mazF-mazE (SEQ ID No. 36 and 38; encoded by SEQ ID No: 35 and 37 respectively), yafO-yafN (SEQ ID No. 40 and 42; encoded by SEQ ID No: 39 and 41 respectively) and relE-relB (SEQ ID No. 44 and 46; encoded by SEQ ID No: 43 and 45 respectively).
[0095] Use of alternative, suitable TA pairs when using the pBAD-TA5 vector requires that the DNA sequences encoding yoeB and yefM in pBAD-TA5 are replaced with the respective toxin and antitoxin encoding sequence above.
[0096] The third nucleic acid molecule comprises a constitutive promoter, operably linked to a coding sequence encoding a toxin protein that drives expression of the toxin protein. A suitable promoter is a constitutive promoter, whereby toxin protein is expressed continuously within the cell, for example J23100 having nucleotide sequence SEQ ID No: 48.
[0097] The second nucleic acid molecule comprises a coding sequence encoding an anti-toxin protein, operably linked to an inducible promoter that drives expression of the anti-toxin protein. A suitable inducible promoter is one that is activated and induces expression of the cognate coding sequence encoding the antitoxin protein, when the biosensor (a transcription factor) and the cellular metabolite form a complex. More specifically, transcription (and expression of the anti-toxin protein) may be induced on binding of this complex to this inducible promoter.
[0098] By way of example only, a suitable inducible promoter includes the p.sub.BAD (SEQ ID No: 66), that is inducible by the transcription factor biosensors that bind to the metabolites L-arabinose, and mevalonate, (see examples).
[0099] The first nucleic acid molecule encodes a transcription factor that is capable of binding to the cellular metabolite produced by the cell to form a complex. The complex functions as an “activated transcription complex” in that it is able to interact with a gene promoter and induce expression of its cognate coding sequence.
[0100] By way of example only, suitable transcription factors encoded by the coding sequence of the first nucleic acid molecule include AraC (SEQ ID No: 6), AraCmev (SEQ ID No:12) and FadR (SEQ ID No: 68) that function as biosensors by binding to the metabolites L-arabinose, mevalonate and fatty acid/fatty acid acyl-CoA respectively (see examples illustrating biosensor:inducible promoter pairs for a range of metabolites).
[0101] The first nucleic acid molecule comprises a promoter operatively linked to a coding sequence encoding the transcription factor. If a eukaryotic host cell is used, the transcription factor should comprise a nuclear localization signal peptide e.g. encoding the protein sequence Pro-Lys-Lys-Lys-Arg-Lys-Val.
[0102] A suitable promoter is a constitutive promoter, whereby the biosensor (transcription factor) is expressed continuously within the cell at a level where binding of effector yields responsive gene regulation, for example selected from among the synthetic promoters listed below, for example J23100 having nucleotide sequence of SEQ ID No: 48.
TABLE-US-00001 SEQ ID Promoter Sequence (5′-) No J23119 ttgacagctagctcagtcctaggtataatgctagc 47 J23100 ttgacggctagctcagtcctaggtacagtgctagc 48 J23101 tttacagctagctcagtcctaggtattatgctagc 49 J23102 ttgacagctagctcagtcctaggtactgtgctagc 50 J23103 ctgatagctagctcagtcctagggattatgctagc 51 J23104 ttgacagctagctcagtcctaggtattgtgctagc 52 J23105 tttacggctagctcagtcctaggtactatgctagc 53 J23106 tttacggctagctcagtcctaggtatagtgctagc 54 J23107 tttacggctagctcagccctaggtattatgctagc 55 J23108 ctgacagctagctcagtcctaggtataatgctagc 56 J23109 tttacagctagctcagtcctagggactgtgctagc 57 J23110 tttacggctagctcagtcctaggtacaatgctagc 58 J23111 ttgacggctagctcagtcctaggtatagtgctagc 59 J23112 ctgatagctagctcagtcctagggattatgctagc 60 J23113 ctgatggctagctcagtcctagggattatgctagc 61 J23114 tttatggctagctcagtcctaggtacaatgctagc 62 J23115 tttatagctagctcagcccttggtacaatgctagc 63 J23116 ttgacagctagctcagtcctagggactatgctagc 64 J23117 ttgacagctagctcagtcctagggattgtgctagc 65 J23118 ttgacggctagctcagtcctaggtattgtgctagc 89
III: A Genetically Modified Microbial Cell Comprising a Toxin-Antitoxin System Controlled by a Metabolite Riboswitch Biosensor
[0103] According to a second embodiment, the genetically modified microbial cell, which is for use in the intracellular biosynthesis of a given cellular metabolite, is a cell comprising a toxin-antitoxin system controlled by a metabolite biosensor which has at least the following features: [0104] 1. a first nucleic acid molecule, and [0105] 2. a second nucleic acid molecule comprising a coding sequence, [0106] wherein the first nucleic acid molecule is operably linked to the second nucleic acid molecule upstream if its coding sequence and operably linked downstream of a constitutive promoter; and [0107] wherein the second nucleic acid molecule comprises a coding sequence encoding an anti-toxin protein that is cognate to and binds to the toxin, whereby the anti-toxin acts as an antidote to the toxin and permits the survival and growth of the cell; and [0108] wherein the transcription product of the first nucleic acid molecule is a a riboswitch capable of binding to the cellular metabolite to form a complex; [0109] 3. a third nucleic acid molecule encoding a toxin protein wherein the nucleic acid molecule comprises a coding sequence that is operably linked to a constitutive promoter; [0110] wherein expression of the antitoxin encoded by the second nucleic acid molecule is induced when the riboswitch and the cellular metabolite form a complex.
[0111] The riboswitch system, as used herein, is a method of regulating expression of the component genes of the synthetic error correction system in the genetically modified micro-organisms of the invention. The regulation takes place at the translational level, and is mediated by mRNA structures which can be formed upstream or downstream of the coding region in the 3′- or 5′-untranslated region (UTR). These riboswitches are RNA structures, which are capable of binding effectors (e.g. small-molecules or metabolites) and modulate transcription or translation of a gene in cis. A riboswitch is composed of two separate domains: an aptamer domain responsible for ligand recognition and binding, and an expression system. These two typically overlap, and the overlap is known as a switching sequence, since it will base pair with either domain depending on the state of the riboswitch. Riboswitches can also modulate gene translation by forming a structure prone to degradation by RNases. Riboswitches can be both ON and OFF switches upon ligand binding, and transcriptional control can be carried out by the formation of terminators and anti-terminators (or anti-anti-terminators) in response to molecule recognition. Translational regulation is also carried out by affecting the availability of the ribosome binding site. The riboswitch two-dimensional structure will either sequester or expose the ribosome binding site upon binding of the small molecule, resulting in the existence of both ON switches (Ribosome binding site exposed upon molecule binding), and in the opposite case, OFF switches, for example by forming a ‘road-block’ preventing progress of the already bound ribosomal machinery.
[0112] By way of example, the nucleotide sequence of a first nucleic acid molecule that is transcribed into a suitable OFF riboswitch is selected from the group consisting of: btuB leader (adenosylcobalamin-responsive) [SEQ ID No: 69]; tc3 (tetracycline-responsive) [SEQ ID No: 70]; and ThiMwt (TPP-responsive) [SEQ ID No: 71].
[0113] An ON riboswitch, ThiMN15#19, is exemplified in Example 3.
IV: A Genetically Modified Microbial Cell Comprising a Toxin Gene Controlled by a Metabolite OFF-Type Biosensor
[0114] According to a third embodiment, the genetically modified microbial cell, which is for use in the intracellular biosynthesis of a given cellular metabolite, is a cell comprising a toxin system controlled by a metabolite biosensor which has at least the following features: [0115] 1. a first nucleic acid molecule wherein the transcription and/or translation of said molecule yields a biosensor capable of binding said cellular metabolite to form a complex, and [0116] 2. a second nucleic acid molecule which is operably linked to a constitutive promoter and where the second nucleic acid molecule comprises a coding sequence encoding a toxin protein that prevents the survival and/or growth of the cell; and [0117] wherein the complex functions to block the transcription and/or translation of the second nucleic acid molecule.
[0118] When the first nucleic acid encodes a transcription factor, the complex that is formed on its binding to the cellular metabolite is an “activated transcription complex” that is capable of interacting with the promoter of the second nucleic acid molecule so as to block expression of the toxin.
[0119] Alternatively, first nucleic acid molecule is operably linked to the second nucleic acid molecule upstream of its coding sequence of and operably linked downstream of the constitutive promoter, said biosensor obtained on transcription of said first nucleic acid molecule is a riboswitch capable of binding to said metabolite to form a complex, and thereby blocking expression of the toxin.
[0120] A suitable “OFF” transcription factor for this third embodiment includes XylR (repressor) biosensor (xylose-responsive) [SEQ ID No: 72] and its cognate responsive promoter [SEQ ID No: 73]); and a suitable “OFF” riboswitch for this variant of the third embodiment includes ThiMwt (TPP-responsive, SEQ ID No: 74)
V: A Genetically Modified Microbial Cell Comprising an Essential Gene Controlled by a Metabolite Biosensor
[0121] According to a fourth embodiment, the genetically modified microbial cell, which is for use in the intracellular biosynthesis of a given cellular metabolite, is a cell comprising an essential gene whose expression is controlled by a metabolite biosensor and which has at least the following features: [0122] 1. a first nucleic acid molecule encoding a transcription factor that functions as a biosensor and is capable of binding to the cellular metabolite produced by the cell to form a complex. The complex functions as an “activated transcription complex” in that it is able to interact with a gene promoter and induce expression of its cognate coding sequence; and [0123] 2. a second nucleic acid molecule (also known as an essential gene), which is operably linked to an inducible promoter, and comprises a coding sequence encoding an essential protein, and wherein expression of this essential protein permits the survival and growth of the cell; and [0124] wherein expression of the essential protein encoded by the second nucleic acid molecule is induced when the transcription factor and the cellular metabolite form a complex. As stated above, this complex, which functions as an “activated transcription complex” is capable of binding to the inducible promoter of the second nucleic acid molecule so as to induce expression of the essential protein. Examples of biosensors, encoded by the first nucleic acid molecule, and inducible promoters in the second nucleic acid molecule that control expression of the essential protein, are described in section II.
[0125] Essential genes, as used herein, provide an alternative synthetic error correction system, whereby the expression of a single gene product is used to control the fate of the genetically modified micro-organism of the invention. As the name reveals, the products of essential genes include those found necessary for cell growth under a defined set of conditions, as well as genes that become essential for growth of the genetically modified micro-organism of the invention. These conditions include the criteria that most of the necessary components for growth are present, alongside a temperature allowing for optimal growth rates. Characteristic of E. coli essential genes is that it is not possible to create viable cells of E. coli with knock-outs of these genes under the defined set of conditions.
[0126] By way of example only, the following six essential genes are suitable for use as this alternative synthetic error correction system. A characteristic of the following six essential genes is that their over-expression is not lethal for the cell: [0127] murZ [SEQ ID No. 75], encodes an enzyme in the first committed step of peptidoglycan biosynthesis (also known as MurA) [SEQ ID No. 76]; [0128] mraY [SEQ ID No. 77], encodes a membrane-bound translocase [SEQ ID No. 78] also termed a UDP-MurNAc-pentapeptide phosphotransferase, located at the inner membrane of the ER which, alongside the gene product of murG, facilitates lipid II synthesis; [0129] glmM [SEQ ID No. 79], encodes a phosphoglucosamine mutase [SEQ ID No. 80]; The glmM gene in E. coli encodes a phosphoglucosamine mutase; which catalyzes the isomeric conversion between glucosamine-6-phosphate and glucosamine-1-phosphate. This reaction is one of the first in the biosynthetic pathway leading to the metabolite precursor UDP-Nacetylglucosamine (UDPGlcNAc). This compound forms a branch-point for pathways leading to both peptidoglycan and lipopolysaccaride synthesis, which are both essential cell wall constituents; [0130] murI [SEQ ID No. 81], encodes a glutamase racemase [SEQ ID No. 82], required for synthesis of D-glutamic acid—another essential building block of peptidoglycan, also known as btuB; [0131] ribA [SEQ ID No. 83], encodes a GTP cyclohydrolase II [SEQ ID No. 84], which catalyses the first committed step in riboflavin biosynthesis; [0132] adk [SEQ ID No. 85], encodes an adenylate kinase [SEQ ID No. 86], which is an essential part of the nucleotide metabolism and catalyzes phosphorylation of AMP to ADP and dAMP to dATP (and nucleoside diphosphates to their correspond triphosphates).
[0133] In one embodiment the essential gene is glmM, which is present in a two-gene operon with another essential gene: folP. The folP gene functions as the essential gene because it is the first gene in this operon, but as seen in the examples, the presence of more than one essential gene in the synthetic error correction system can be used to control the fate of the genetically modified micro-organism of the invention. The folP gene [SEQ ID No:87], encodes dihydropteroate synthase [SEQ ID No. 88], which is part of the enzymatic pathway leading to production of tetrahydrofolate (vitamin B9). This compound is essential to normal cell growth, as folic acid cofactors are necessary for production of purines, methionine, thymidine, lysine and pantothenic acid.
VI A Cellular Metabolite Produced by a Genetically Modified Micro-Organism of the Invention
[0134] A cellular metabolite produced by intracellular biosynthesis by the genetically modified micro-organism of the invention may range from a small molecule up to larger products, such as proteins.
[0135] A small molecule, by way of example only, is mevalonate, which is a precursor to a diverse group of compounds termed isoprenoids. Isoprenoids cover a group of chemicals with a diverse range of functions, structures, and applications. With over 50,000 known compounds, isoprenoid functions include flavors and perfumes, hormones, mediators of membrane fluidity, and pharmaceuticals. Plants have especially been found to be an incredible reservoir of these diverse secondary metabolites. The existing method of obtaining these interesting molecules (e.g. by plant extraction) is however inefficient. Microbial production of isoprenoids represents a green and feasible alternative to obtaining these compounds.
[0136] Further small molecules, may include fatty acid ethyl esters and other biodiesel molecules, which represent another branch of biochemicals that can be produced in microbial cells, ultimately converting glucose or other carbon sources into combustible fuels. Polyunsaturated fatty acids, and many other metabolic products, such as amino acids and organic acids, are already existing or potential fermentation products that can be produced by the microbial cells of the invention and for which synthetic error correction system of the invention can be used, making use of known or adapted transcription or translation regulatory elements. For example, natural riboswitches have been found responsive to various vitamin B family molecules.
[0137] The present invention provides a powerful tool for enhancing the productivity of isoprenoid production by microbial cell factories, by eliminating non- producers from continuous fermentation. This is illustrated with respect to mevalonate production in the examples herein.
[0138] By way of example, a genetically modified micro-organism for production of mevalonate comprises three genes encoding a biosynthetic pathway for the production of mevalonate from acetyl-CoA, namely: the E. coli gene atoB, and the two genes HMGS (ERG13), and tHMGR from S. cerevisiae. The atoB gene encodes an acetoacetyl-CoA thiolase, which catalyzes the formation of acetoacetyl-CoA from two molecules of acetyl-CoA. The HMGS gene encodes a HMG-CoA synthase, which forms 3-hydroxy-methylglutayl-CoA (HMG-CoA) by a condensation reaction between acetoacetyl-CoA and another molecule of acetyl-CoA. Finally, HMG-CoA is converted to mevalonate by the tHMGR gene product, which is a truncated version of an HMGR gene. The product of HMG-CoA synthase activity is toxic to the cell, and it is the accumulation of HMG-CoA which promotes growth inhibition.
[0139] There is a fitness cost related to production of mevalonate, both in the length of the lag phase and the final OD of a producing strain (
VII Methods for Producing a Cellular Metabolite Using the Genetically Modified Micro-Organism of the Invention
[0140] According to a further embodiment, the invention provides a method for producing a biosynthetic metabolite comprising the steps of: a) providing a genetically modified microbial cell as defined above in sections I-IV, b) introducing the genetically modified microbial cell into a cultivation medium comprising a substrate for production of said metabolite, and c) recovering metabolite produced by said culture, wherein a lack of metabolite production in said genetically modified microbial cell or progeny cell thereof attenuates multiplication of said cell as compared to a non-genetically modified parent cell from which said modified microbial cell was derived.
[0141] In step b) it is contemplated that the cell in culture medium are cultivated under continuous; fed-batch or batch culture; and that the cells undergo at least 10, 15, 20, 25, 30, 35, 40, 45 or 50 generations of cell multiplication. The period of cultivation will depend on the micro-organism cultivated; but where the micro-organism is a bacterial cell, the accumulated period of cultivation is typically at least 2, 4, 6, 8, 10, 12, 14 , 16, 18 or 20 days. In the context of the present invention the term “accumulated period of cultivation” is to be understood to include the cultivation of a pre-seed culture; further cultivation after subsequent inoculation of the pre-seed culture into a larger fermenter, and optionally cultivation after subsequent inoculation of the previous culture into an even larger fermenter. Production of a metabolite using the genetically modified microbial cell of the invention wherein the production of the metabolite has a high fitness cost of production, such as ≥5%, ≥10%, ≥15%, ≥20%, and ≥25%.
VIII Micro-Organisms for the Intracellular Biosynthesis of a Cellular Metabolite
[0142] The micro-organism for the intracellular biosynthesis of a cellular metabolite according to the invention, may be a bacterium, a non-exhaustive list of suitable bacteria is given as follows: a species belonging to the genus Bacillus, a species belonging to the genus Escherichia, a species belonging to the genus Lactobacillus, a species belonging to the genus Lactococcus, a species belonging to the genus Corynebacterium, a species belonging to the genus Acetobacter, a species belonging to the genus Acinetobacter, a species belonging to the genus Pseudomonas; a species belonging to the genus Proprionibacterium, and a species belonging to the genus Bifidobacterium.
[0143] Alternatively, the micro-organism according to the invention may be a yeast belonging to the genus of Saccharomyces, e.g. S. cerevisiae, S. kluyveri, S. bayanus, S. exiguus, S. sevazzi, S. uvarum; a yeast belonging to the genus Kluyveromyces, e.g. K. lactis K. marxianus var. marxianus, K. thermotolerans; a yeast belonging to the genus Candida, e.g. C. utilis C. tropicalis, C. albicans, C. lipolytica, C. versatilis; a yeast belonging to the genus Pichia, e.g. P. stipidis, P. pastoris, P. sorbitophila, or other yeast genera, e.g. Cryptococcus, Debaromyces, Hansenula, Yarrowia, Zygosaccharomyces or Schizosaccharomyces. Alternatively, the micro-organisms may be a filamentous fungus belonging to the genus of Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella, Mucor, Mortierella, Trichoderma Thermomyces, Streptomyces and Aspergillus. More specifically, the micro-organism may be Fusarium Oxysporum, A. niger, A. awamori, A. oryzae, and A. nidulans.
[0144] The preferred micro-organisms of the invention may be S. cerevisiae, E. coli, L. lactis or L. plantarum. Bacillus subtilis, B. licheniformis, Trichoderma resei, Aspergillus niger, Aspergillus oryzae, Yarrowia lypolytica, and Pichia pastoris.
IX Methods for Producing a Micro-Organism of the Invention
[0145] Integration and self-replicating vectors, suitable for cloning and introducing a first, second, third or additional nucleic acid molecules into a micro-organism for the intracellular biosynthesis of a cellular metabolite, are commercially available and known to those skilled in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989). Cells of a micro-organism are genetically engineered by the introduction into the cells of heterologous DNA (RNA). Heterologous expression of genes encoding one or more polypeptide of the correction system in a micro-organism of the invention is demonstrated in the Examples.
[0146] A first, second, third or additional nucleic acid molecule(s) according to the invention, can be introduced into a cell or cells on plasmids or optionally integrated into the host cell genome using methods and techniques that are standard in the art. For example, nucleic acid molecules can be introduced by standard protocols such as transformation including chemical transformation and electroporation, transduction, particle bombardment, etc.
EXAMPLES
Example 1. TA Systems
1.1 L-Arabinose Addiction Coupled to a Type II TA System is Shown to Control Bacterial Cell Growth
[0147] The yefM-yoeB TA pair comprises two genes, where the yoeB gene encodes a toxin, and the yefM gene encodes its cognate antitoxin (
[0148] The use of the yefM-yoeB TA pair system to control the growth of bacteria based on L-arabinose addiction was demonstrated in E. coli, as follows.
[0149] The yefM-yoeB TA pair was cloned into a plasmid (pBAD-TA5: araC, p.sub.BAD-yefM, p.sub.Lac-yoeB, ampR) (Table 1) employing standard PCR cloning protocols (known in the art) and the plasmid was transformed into the host stain E. coli XL-1 with the genotype: recA1endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac[F′proAB lacIqZM15 Tn10 (TetR)]. Electroporation recovery of transformed cells was carried out in SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, and 20 mM glucose).
[0150] Transformed E. coli cultures were grown in 2xYT medium (10 g/L yeast extract, 16 g/L tryptone, 5 g/L NaCl). Antibiotics were added to select for maintenance of plasmids in strains transformed with these, according to their respective antibiotic resistance gene. Antibiotic concentrations when added were as follows: ampicillin 100 μg/mL, chloramphenicol 30 μg/mL, spectinomycin 50 μg/mL, kanamycin 50 μg/mL.
[0151] The expression of the yoeB gene in the yefM-yoeB TA pair construct (
[0152] The regulation of the p.sub.BAD promoter by AraC is dual. In the absence of L-arabinose, the AraC protein binds to operator sites within p.sub.BAD effectively repressing transcription. Upon binding of L-arabinose, the complex changes to another DNA-binding conformation leading to activation of p.sub.BAD and induction of transcription of a cognate gene.
[0153] While cell growth was strongly inhibited by addition of ≥0.1 mM IPTG of the toxin inducer; the co-addition of 0.1% L-arabinose was sufficient to restore wild-type growth in the presence of IPTG at concentrations up to 0.5 mM (
[0154] These data demonstrate that the TA system has a wide dynamic range, with gradual response in respect of growth inhibition. Thus a small change in the level of toxin expression relative to antitoxin expression, does not give rise to a dramatic change in cell growth rates, but is still provides sufficiently strong growth control to prevent growth as well as allow normal growth at extremes in the concentration of the inducer L-arabinose.
[0155] Table 1 listing the genetic features of the L-arabinose TA addicted strain based on the E. coli XL1 parent strain.
TABLE-US-00002 TABLE 1 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No pBAD-TA5 araC* SEQ ID No: 1 p.sub.BAD-yefM YefM SEQ ID No: 2 p.sub.Lac-yoeB YoeB SEQ ID No: 3 ampR Beta- SEQ ID No: 4 lactamase araC SEQ ID No: 5 araC SEQ ID No: 6 *araC gene [SEQ ID No: 5] encoding araC biosensor protein [SEQ ID No: 6] is located on the complementary strand to SEQ ID No: 1 at nucleotide positions: 96-974. The p.sub.BAD promoter is located a position 1246-1318 in SEQ ID No: 1.
[0156] Table 2 listing the genetic features of the mevalonate TA addicted strain m14 based on the E. coli XL1 parent strain. The chromosomally located sequence is an excerpt of the genome sequence that fully comprises the engineered features.
TABLE-US-00003 TABLE 2 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No pBAM-TA5 araCmev* SEQ ID No: 7 p.sub.BAD-yefM YefM SEQ ID No: 8 p.sub.Lac-yoeB YoeB SEQ ID No: 9 ampR Beta- SEQ ID No: 10 lactamase araCmev SEQ ID No: 11 araCmev SEQ ID No: 12 chromosome yefM- FRT- SEQ ID No: 13 Neomycin SEQ ID No: 14 kanR-FRT- phosphotransferase yoeB** II *araCmev gene [SEQ ID No: 11] encoding araCmev biosensor protein [SEQ ID No: 12] is located on the complementary strand to SEQ ID No: 7 at nucleotide positions: 96-974; **(1.sup.st) “FRT site” is located on complementary stand to SEQ ID No 13 at nucleotide positions: 247-281; (2.sup.nd) “FRT site” is located on complementary stand to SEQ ID No 13 at nucleotide positions: 1469-1503. The p.sub.BAD promoter is located a position 1241-1318 in SEQ ID No: 7.
[0157] In order to enhance to the stability of this plasmid based TA correction system, the native genomic copy of the yefM-yoeB gene pair was knocked-out. This was achieved using a DNA fragment comprising a FRT-kana-FRT resistance cassette fused to flanking sequences homologous to circa 200 bp flanking sequences homologous to each side of the junction between the chromosomal yefM-yoeB gene pair. Site specific integration of the FRT-kana-FRT resistance cassette into the native yefM-yoeB gene pair and functional knock-out was achieved by means of lambda-red-mediated recombineering.
1.2 Mevalonate Addiction Coupled to a Type II TA System is Shown to Control Bacterial Cell Growth
[0158] Mevalonate is one of the early precursors in the biosynthesis of a diverse group of compounds termed isoprenoids with a range of applications. The production of mevalonate in micro-organisms is seen to place a metabolic strain on the producing cells, meaning there is a fitness cost, and where the appearance of non-producing cells compromises the economics of mevalonate production. A Type II TA system coupled to mevalonate addiction according to the invention provides a method for slowing the growth or eliminating cells that are non-producers.
[0159] In order to control bacterial cell growth by mevalonate addiction, a mevalonate biosensor was introduced into the yefM-yoeB TA pair plasmid, pBAD-TA5 (Table 2), in place of the L-arabinose biosensor. The mevalonate-responsive biosensor was derived from the AraC sensor by introducing 4 point mutations (
[0160] Addition of mevalonate (37 mM) was sufficient to bind to the mevalonate biosensor and induce the cognate p.sub.BAD promoter to express the YefM antitoxin at levels sufficient to allow an increase in cell growth when compared to cell cultures devoid of mevalonate.
1.3 Engineering a Bacterial Strain Addicted to Internal Small Molecule Production
[0161] Mevalonate-addicted E. coli strains (as described in 1.2) were additionally engineered to produce mevalonate. Strains were transformed with a plasmid comprising genes encoding one of three alternative biosynthetic pathways for the conversion of endogenous acetyl CoA to mevalonate (
[0162] The plasmid, pMEV7C, comprises the E. coli gene AtoB; a Lactococcus lactis gene mvaS encoding an HMG-CoA synthase, and a Lactococcus lactis mvaE gene encoding a HMG-CoA reductase. This plasmid directs high level mevalonate production in a host strain (≤14.6 g/L in batch fermentation).
[0163] A negative control pathway pMevT5c features a point mutation in the ERG13 gene, rendering the strain incapable of producing mevalonate, but otherwise it maintains the same promoter, enzymatic pathway reactions, antibiotic selection gene and plasmid origin of replication. The pathway operon promoter in both plasmids pMEV7C and pMevT5C was the synthetic promoter J23100 [SEQ ID No: 48].
[0164] Table 3 listing the genetic features of the mevalonate TA addicted strain m29 with internal mevalonate biosynthesis, based on the E. coli XL1 parent strain.
TABLE-US-00004 TABLE 3 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No pBAM-TA5 araCmev* SEQ ID No: 7 p.sub.BAD-yefM YefM SEQ ID No: 8 p.sub.Lac-yoeB YoeB SEQ ID No: 9 ampR Beta-lactamase SEQ ID No: 10 araCmev SEQ ID No: 11 araCmev SEQ ID No: 12 chromosome yefM- FRT- SEQ ID No: 13 Neomycin SEQ ID No: 14 kanR-FRT- phosphotransferase yoeB** II pMEV7C atoB SEQ ID No: 15 acetyl-CoA SEQ ID No: 16 acetyltransferase mvaS HMG-CoA SEQ ID No: 17 synthase mvaE HMG-CoA SEQ ID No: 18 reductase camR*** camR SEQ ID No: 19 Chloramphenicol SEQ ID No: 20 acetyltransferase *araCmev gene [SEQ ID No: 11] encoding araCmev biosensor protein [SEQ ID No: 12] is located on the complementary strand to SEQ ID No: 7 at nucleotide positions: 96-974; **(1.sup.st) “FRT site” is located on complementary stand to SEQ ID No 13 at nucleotide positions: 247-281; (2.sup.nd) “FRT site” is located on complementary stand to SEQ ID No 13 at nucleotide positions: 1469-1503. ***camR gene [SEQ ID No: 19] encoding chloramphenicol acetyltransferase [SEQ ID No: 20] is located on the complementary strand to SEQ ID No: 15 at nucleotide positions 4745-5404. The p.sub.BAD promoter is located a position 1241-1318 in SEQ ID No: 7.
[0165] Table 4 listing the genetic features of the mevalonate TA addicted strain m16 without internal mevalonate biosynthesis, based on the E. coli XL1 parent strain.
TABLE-US-00005 TABLE 4 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No pBAM-TA5 araCmev* SEQ ID No: 7 p.sub.BAD-yefM YefM SEQ ID No: 8 p.sub.Lac-yoeB YoeB SEQ ID No: 9 ampR Beta-lactamase SEQ ID No: 10 araCmev SEQ ID No: 11 araCmev SEQ ID No: 12 chromosome yefM- FRT- SEQ ID No: 13 Neomycin SEQ ID No: 14 kanR-FRT- phosphotransferase yoeB** II pMevT5C atoB SEQ ID No: 21 acetyl-CoA SEQ ID No: 22 acetyltransferase Mutant Non-functional SEQ ID No: 23 ERG13 HMG-CoA synthase tHMGR Truncated HMG- SEQ ID No: 24 CoA reductase camR*** camR SEQ ID No: 19 Chloramphenicol SEQ ID No: 20 acetyltransferase *araCmev gene [SEQ ID No: 11] encoding araCmev biosensor protein [SEQ ID No: 12] is located on the complementary strand to SEQ ID No: 7 at nucleotide positions: 96-974; **(1.sup.st) “FRT site” located on complementary stand to SEQ ID No 13 at nucleotide positions: 247-281; (2.sup.nd) “FRT site” located on complementary stand to SEQ ID No 13 at nucleotide positions: 1469-1503. ***camR gene [SEQ ID No: 19] encoding chloramphenicol acetyltransferase [SEQ ID No: 20] is located on the complementary strand to SEQ ID No: 21 at nucleotide positions 5293-5952.
1.4 Mevalonate-Addiction Coupled to a TA System Cancels the Fitness Advantage of Non-Mevalonate Producing Cells.
[0166] Mevalonate production has a fitness cost for a bacterial cell. This is shown by the retarded growth of an E. coli strain, comprising the plasmid (pMEV7C) and producing ‘high’ level mevalonate, as compared to an E. coli strain, comprising the control plasmid (pMevT5c) and producing no mevalonate, but still having the metabolic burden of expressing the enzymes of the inactivated mevalonate biosynthesis pathway (
[0167] Co-expression of the mevalonate-addiction TA system (pBAM-TA5), despite a longer lag phase in these cells, was effective in countering the fitness advantage of non-producing cells (
1.5 Use of the TA System to Increase Small-Molecule Production by Bacterial Cultures Comprising Non-Producing Cells
[0168] The ability of the TA system to favor survival and growth of productive cells (i.e. cells producing the addiction molecule, mevalonate), was demonstrated by co-culturing mevalonate-producing cells, comprising the pMEV7C plasmid, and non-producing strains, comprising the pMevT5C plasmid. The ratios of non-producing:producing cells tested were: 0:100, 75:25 and 90:10. The total mevalonate production of the 3 co-cultured strains was tested with and without co-expression of the mevalonate-addiction TA system, encoded on the plasmid pBAM-TA5.
[0169] Previous experiments with strains possessing the mevalonate pathway had established a fitness cost of harboring a functional production plasmid (pMEV7c) versus a non-functional production plasmid (pMevT5c) to be a reduction in growth rate of approximately 20% (
The same cell inoculum mixes were cultured with the producing and non-producing strains, but both also harbored the correction plasmid (pBAM-TA5). This addition of the correction system was shown to significantly enhance mevalonate production in the co-cultures comprising non-producing cells (
Example 2 Essential Genes
2.1 L-Arabinose Addiction by Regulated Expression of an Essential Gene is Shown to Control Bacterial Cell Growth
[0170] The essential genes, used to control bacterial growth, are the E. coli genes folP and glmM, which are comprised together within a two-gene operon. The gene glmM encodes a phosphoglucosamine mutase; and the gene folP encodes a dihydropteroate synthase, which is part of the enzymatic pathway leading tetrahydrofolate (vitamin B9) synthesis, which is essential for normal cell growth.
[0171] The native single genomic copy of the essential gene operon folP, glmM in E. coli host strain XL1, was modified to allow its transcriptional control by the L-arabinose/mevalonate-responsive promoter p.sub.BAD. Replacement of the native promoter by the p.sub.BAD promoter was engineered by introducing a knockout fragment containing a kanamycin resistance cassette and the p.sub.BAD promoter, as illustrated in the cartoon in
[0172] The modified and transformed E. coli strains were grown in 2xYT medium (10 g/L yeast extract, 16 g/L tryptone, 5 g/L NaCl). Antibiotics were added to select for maintenance of plasmids in transformed strains, according to their respective antibiotic resistance gene. Antibiotic concentrations when added were as follows: ampicillin 100 μg/mL, chloramphenicol 30 μg/mL, spectinomycin 50 μg/mL, kanamycin 50 μg/mL.
[0173] Table 5 lists the genetic features of the essential gene-based mevalonate-addicted strain e3.9, based on an E. coli XL1 parent strain. The chromosomally located sequence is an excerpt of the genome sequence that fully comprises the engineered features.
TABLE-US-00006 TABLE 5 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome (FRT-kanR- SEQ ID No: 25 Dihydropteroate SEQ ID No: 26 FRT)-p.sub.BAD- synthase folP* kanR** SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBAMspec araCmev*** SEQ ID No: 29 specR spectinomycin SEQ ID No: 30 resistance protein pMEV7C atoB SEQ ID No: 15 acetyl-CoA SEQ ID No: 16 acetyltransferase mvaS HMG-CoA synthase SEQ ID No: 17 mvaE HMG-CoA SEQ ID No: 18 reductase camR**** *The native promoter of the chromosomal folP - glmM operon is replaced by the p.sub.BAD promoter via the (FRT-KanR-FRT)-p.sub.BAD-folP cassette [SEQ ID No. 25]; which comprises the pBAD promoter at position 1907-1979 and a portion of the folP gene. The nucleotide sequence of the folP gene in the e3.9 strain is SEQ ID No: 87. **kanR gene [SEQ ID No: 27] encoding Neomycin phosphotransferase II [SEQ ID No: 28] is located on the complementary strand to SEQ ID No: 25 at nucleotide positions 389-1183. ***araCmev gene [SEQ ID No: 11] encoding araCmev biosensor protein [SEQ ID No: 12] is located on the complementary strand to SEQ ID No: 29 at nucleotide positions: 96-974. ****camR gene [SEQ ID No: 19] encoding chloramphenicol acetyltransferase [SEQ ID No: 20] is located on the complementary strand to SEQ ID No: 21 at nucleotide positions 4745-5404.
[0174] Table 6 listing the genetic features of the essential gene-based L-arabinose-addicted strain e3.5, based on an E. coli XL1 parent strain. The chromosomally located sequence is an excerpt of the genome sequence that fully comprises the engineered features.
TABLE-US-00007 TABLE 6 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome (FRT-kanR**- SEQ ID No: 25 Dihydropteroate SEQ ID No: 26 FRT)-p.sub.BAD- synthase folP* pBAD18- araC AraC cam*** cam Chloramphenicol acetyltransferase *The native promoter of the chromosomal folp - glmM operon is replaced by the p.sub.BAD promoter via the (FRT-KanR-FRT)-p.sub.BAD-folP cassette [SEQ ID No. 25]; which comprises the pBAD promoter at position 1907-1979 and a portion of the folP gene. The nucleotide sequence of the folp gene in the e3.5 strain is SEQ ID No: 87. **kanR gene [SEQ ID No: 27] encoding Neomycin phosphotransferase II [SEQ ID No: 28] is located on the complementary strand to SEQ ID No: 25 at nucleotide positions 389-1183. ***Guzman et al, 1995
[0175] Table 7 listing the genetic features of the pe1 control strain producing mevalonate without the addiction system, based on an E. coli XL1 parent strain.
TABLE-US-00008 TABLE 7 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No pBAM18-spec araCmev* SEQ ID No: 29 AraCmev SEQ ID No: 12 specR aminoglycoside SEQ ID No: 30 nucleotidyltransferase pMEV7C atoB SEQ ID No: 15 acetyl-CoA SEQ ID No: 16 acetyltransferase mvaS HMG-CoA synthase SEQ ID No: 17 mvaE HMG-CoA SEQ ID No: 18 reductase camR** chloramphenicol SEQ ID No: 20 acetyltransferase *araCmev gene [SEQ ID No: 11] encoding araCmev biosensor protein [SEQ ID No: 12] is located on the complementary strand to SEQ ID No: 29 at nucleotide positions: 96-974; **camR gene [SEQ ID No: 19] encoding chloramphenicol acetyltransferase [SEQ ID No: 20] is located on the complementary strand to SEQ ID No: 21 at nucleotide positions 4745-5404; specR = spectomycin resistance protein (e.g. aminoglycoside nucleotidyltransferase).
[0176] Since the expression levels of essential genes is important for optimizing their use for growth control, a micro-library of four different ribosome binding sites (created by a single random base pair in one of the primers covering the RBS in front of the p.sub.BAD promoter), having different (RBS) strengths, were tested and one RBS was found to give a particularly good conditional growth, strictly in response to providing L-arabinose in the growth medium (
2.2 Use of Essential Genes to Enhance Small Molecule Production in Bacteria.
[0177] An E. coli strain comprising the essential gene operon folP-glmM, whose expression was regulated by a mevalonate-addiction, was engineered in order to demonstrate its use for the regulation of mevalonate-dependent cell growth.
[0178] The native single genomic copy of the essential gene operon folP-glmM in E. coli host strain XL1, was modified to allow its transcriptional control by the L-arabinose/mevalonate-responsive promoter p.sub.BAD (
[0179] In order to demonstrate that growth and mevalonate production by the “essential gene” regulated E. coli strain was dependent on internal mevalonate production the cells were also transformed with a plasmid carrying the genes encoding the mevalonate biosynthetic pathway (pMEV7C (Table 2) or genes encoding the inactivated the mevalonate biosynthetic pathway (pMevT5C). Growth of these E. coli strains of producing strains (having a functional mevalonate pathway) was exponential, while growth of non-producing strains (having an inactivated mevalonate pathway) was strongly inhibited (
2.3 Triacetic Acid Lactone Addiction by Regulated Expression of an Essential Gene is Shown to Control Bacterial Cell Growth
[0180] The native single genomic copy of the essential gene operon folP-glmM in the E. coli XL1 host strain was modified to allow its transcriptional control by the triacetic acid lactone-responsive promoter p.sub.BAD. First, a gene encoding a triacetic acid lactone biosensor (AraCtal (Tang et al., 2013)) was introduced into the XL1 host strain on the plasmid pBALspec (Table 8). Then, replacement of the native folP-glmM promoter in this host strain by the p.sub.BAD promoter was engineered by means of lambda red-mediated recombineering. Recombineering was performed using well-described methods utilizing the pKD46 plasmid (Datsenko and Wanner, 2000), but instead of gene disruption, a specific set of knock-out DNA fragments (produced by PCR) was used to only replace the native essential folP-glmM operon promoter and folP ribosomal binding site (RBS). This set of knockout DNA fragments each contained a kanamycin resistance cassette and the p.sub.BAD promoter, as illustrated in the cartoon in
TABLE-US-00009 TABLE 8 TAL responsive e3.16#5 clone Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome (FRT-kanR- SEQ ID No: 91* Dihydropteroate SEQ ID No: 26 FRT)-p.sub.BAD- synthase folP* kanR** SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBALspec AraCtal *** SEQ ID No: 93 Triacetic acid SEQ ID No: 96 lactone sensor protein specR spectinomycin SEQ ID No: 94 resistance protein *The native promoter of the chromosomal folP - glmM operon is replaced by the p.sub.BAD promoter via the (FRT-KanR-FRT)-p.sub.BAD-folp cassette [SEQ ID No. 91]; which comprises a p.sub.BAD promoter at position 1665-1990, a RBS at position 1980-1985, having the nucleotide sequence ACTTGC; and a portion of the folP gene. The nucleotide sequence of the complete folP gene in the e3.16#5 strain is SEQ ID No: 87. **kanR gene [SEQ ID No: 27] encoding Neomycin phosphotransferase II [SEQ ID No: 28] is located on the complementary strand to SEQ ID No: 91 at nucleotide positions 389-1183. ***araCtal gene [SEQ ID No: 95] encoding araCtal biosensor protein [SEQ ID No: 96] is located on the complementary strand to SEQ ID No: 93 at nucleotide positions: 96-1025. ****specR gene encoding spectinomycin resistance protein [SEQ ID No: 94] is located at nucleotide positions 1945-2916 of SEQ ID No: 93.
[0181] For recombineering, as performed in standard pKD46 protocols, the target strain was first transformed with pKD46, and a single colony of this strain was then cultured in a 25 mL 2xYT culture at 30 degrees C. and 250 rpm horizontal shaking. When the culture reached OD.sub.600=0.1, the lambda Red system of pKD46 was induced by addition of 0.2 vol % L-arabinose, and then further cultured to grow to OD.sub.600=0.4. The cells from the culture were then transformed with 300-500 ng knock-out DNA fragments by standard high-efficiency electroporation; the electroporated cells were then cultured in SOC medium (20 g/L tryptone, 5 g/L yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl.sub.2, 10 mM MgSO.sub.4, 20 mM glucose) at 37 degrees for at least 1-2 hours to recover and simultaneously cure the cells of the pKD46 plasmid. Following recovery, candidate recombineered cells were selected for by plating on LB agar plates supplemented with 10 mM triacetic acid lactone and spectinomycin for maintenance of pBALspec and kanamycin for selection of inserted knockout fragment.
[0182] A non-addicted control E. coli strain (e3.16CON), also equipped with spectinomycin and kanamycin resistance genes, but with wildtype control of folP-glmM expression (Table 9), was constructed in order to test the toxicity of triacetic acid lactone.
TABLE-US-00010 TABLE 9 Non-addicted control strain e3.16CON Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome kanR SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBALspec AraCtal *** SEQ ID No: 93 Triacetic acid SEQ ID No: 96 lactone sensor protein specR Spectinomycin SEQ ID No: 98 resistance protein *** araCtal gene [SEQ ID No: 95] encoding araCtal biosensor protein [SEQ ID No: 96] is located on the complementary strand to SEQ ID No: 93 at nucleotide positions: 96-1025.
[0183] The non-addicted control E. coli strain (e3.16CON), and a selected addicted strain (e3.16#5) were then tested and compared for triacetic acid lactone-dependent growth by cultivation in a microtiter plate reader in liquid 2xYT medium supplemented with spectinomycin and kanamycin and a three-step gradient of triacetic acid lactone (0, 2 and 20 mM). As seen in
[0184] The addicted strain e3.16#5 was able to grow in the absence of triacetic acid lactone, indicating that under non-inducing conditions the basal expression of the essential folP-glmM operon in this strain was sufficient to support growth. Cell growth was however significantly reduced to a level matching the growth of the control strain under toxic condition of 20 mM triacetic acid lactone (
2.4. Salicylic Acid Addiction by Regulated Expression of an Essential Gene is Shown to Control Bacterial Cell Growth
[0185] The native single genomic copy of the essential gene operon folP-glmM in the E. coli XL1 host strain was modified to allow its transcriptional control by the salicylic acid-responsive promoter p.sub.SAL [SEQ ID No:118]. First, a gene encoding a salicylic acid biosensor (Pseudomonas putida nahR_Asn169 (Cebolla et al., 1997)) was introduced into the XL1 host strain on the plasmid pBANspec (Table 10). Then, replacement of the native folP-glmM promoter by the p.sub.SAL promoter was engineered by means of lambda red-mediated recombineering.
TABLE-US-00011 TABLE 10 Salicylic acid responsive e3.18#1 clone Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome (FRT-kanR- SEQ ID No: 101 Dihydropteroate SEQ ID No: 102 FRT)-p.sub.SAL- synthase folP* kanR** SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBANspec NahRAsn169 *** SEQ ID No: 97 Salicylic acid SEQ ID No: 100 biosensor protein specR Spectinomycin SEQ ID No: 98 resistance protein *The native promoter of the chromosomal folP - glmM operon is replaced by the p.sub.SAL promoter via the (FRT-KanR-FRT)-p.sub.BAD-folP cassette [SEQ ID No. 101]; which comprises p.sub.SAL promoter at position 1794-1929; a RBS at position 1930-1935, having the nucleotide sequence ACTTGT; and a portion of the folP gene (to direct homologous recombination). The nucleotide sequence of the complete folP gene in the e3.18#1 strain is SEQ ID No: 87. **kanR gene [SEQ ID No: 27] encoding Neomycin phosphotransferase II [SEQ ID No: 28] is located on the complementary strand to SEQ ID No: 91 at nucleotide positions 389-1183. *** nahRAsn169 gene [SEQ ID No: 99] encoding salicylic acid biosensor protein [SEQ ID No: 100] is located on the complementary strand to SEQ ID No: 97 at nucleotide positions: 102 - 1004.
[0186] Recombineering was performed as described in section 2.3 using well-described methods utilizing the pKD46 plasmid (Datsenko and Wanner, 2000). Instead of gene disruption, a specific set of knock-out DNA fragments was used to only replace the native essential folP-glmM operon promoter and folP RBS. This set of knockout DNA fragments contained a kanamycin resistance cassette and the p.sub.SAL promoter, as illustrated in the cartoon in
TABLE-US-00012 TABLE 11 Non-addicted control strain e3.18CON Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome kanR SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBANspec NahRAsn169 * SEQ ID No: 97 Salicylic acid SEQ ID No: 100 biosensor protein specR Spectinomycin SEQ ID No: 98 resistance protein * nahRAsn169 gene [SEQ ID No: 99] encoding salicylic biosensor protein [SEQ ID No: 100] is located on the complementary strand to SEQ ID No: 97 at nucleotide positions: 102-1004.
[0187] A selected addicted strain (e3.18#1) and the non-addicted control E. coli strain (e3.18CON) were then tested for salicylic acid dependent growth by cultivation in a microtiter plate reader in liquid 2xYT medium supplemented with spectinomycin and kanamycin and presence/absence of salicylic acid (0 or 5 mM). As seen in
2.5 Benzoic Acid Addiction by Regulated Expression of an Essential Gene is Shown to Control Bacterial Cell Growth
[0188] The native single genomic copy of the essential gene operon folP-glmM in the E. coli XL1 host strain was modified to allow its transcriptional control by the benzoic acid-responsive promoter p.sub.SAL [SEQ ID No:118]. First, a gene encoding a benzoic acid biosensor (Pseudomonas putida nahR) (Table 12) was introduced into the XL1 host strain on the plasmid pBABspec. Then, replacement of the native folP-glmM promoter by the p.sub.SAL promoter was engineered by means of lambda red-mediated recombineering.
TABLE-US-00013 TABLE 12 Benzoic acid addicted e3.22#4 clone Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No chromosome (FRT-kanR- SEQ ID No: 101 Dihydropteroate SEQ ID No: 102 FRT)-p.sub.SAL- synthase folP* kanR** SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBABspec NahR*** SEQ ID No: 103 Benzoic acid SEQ ID No: 106 sensor protein specR Spectinomycin SEQ ID No: 104 resistance protein *The native promoter of the chromosomal folP - glmM operon is replaced by the p.sub.SAL promoter via the (FRT-KanR-FRT)-p.sub.SAL-folp cassette [SEQ ID No. 101]; which comprises a p.sub.SAL promoter at position 1794-1929; a RBS at position 1930-1935, having the nucleotide sequence ACTTGC; and a portion of the folp gene. The nucleotide sequence of the complete folp gene in the e3.22#4 strain is SEQ ID No: 87. **kanR gene [SEQ ID No: 27] encoding Neomycin phosphotransferase II [SEQ ID No: 28] is located on the complementary strand to SEQ ID No: 91 at nucleotide positions 389-1183. ***nahR gene [SEQ ID No: 105] encoding benzoic biosensor protein [SEQ ID No: 106] is located on the complementary strand to SEQ ID No: 103 at nucleotide positions: 102-1004.
[0189] Recombineering was performed as described in section 2.3 using well-described methods utilizing the pKD46 plasmid (Datsenko and Wanner, 2000)). Instead of gene disruption, a specific set of knock-out DNA fragments was used to only replace the native essential folP-glmM operon promoter and folP RBS. This set of knockout DNA fragments contained a kanamycin resistance cassette and the p.sub.SAL promoter, as illustrated in the cartoon in
[0190] A non-addicted control E. coli strain (e3.22CON), also equipped with spectinomycin and kanamycin resistance genes, but wild-type control of folP-glmM expression (Table 13), was constructed in order to test the toxicity of benzoic acid.
TABLE-US-00014 TABLE 13 Benzoic acid non-addicted control e3.22CON Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No Chromosome kanR SEQ ID No: 27 Neomycin SEQ ID No: 28 phosphotransferase II pBABspec NahR SEQ ID No: 103 Benzoic acid SEQ ID No: 106 sensor protein specR Spectinomycin SEQ ID No: 104 resistance protein *kanR gene [SEQ ID No: 27] encoding Neomycin phosphotransferase II [SEQ ID No: 28]. ***nahR gene [SEQ ID No: 105] encoding benzoic biosensor protein [SEQ ID No: 106] is located on the complementary strand to SEQ ID No: 103 at nucleotide positions: 102-1004.
[0191] Finally, candidate recombineered cells were selected for by plating on LB agar plates supplemented with 5 mM benzoic acid and spectinomycin for maintenance of pBABspec and kanamycin for selection of inserted knockout fragment.
[0192] A selected addicted strain (e3.22#4) and the non-addicted control E. coli strain (e3.18CON) were then tested for benzoic acid dependent growth by cultivation in a microtiter plate reader in liquid 2xYT medium supplemented with spectinomycin and kanamycin and w/wo salicylic acid (0 or 5 mM). As seen in
[0193] The dependence of the addicted strain on a supply of benzoic acid for maximal growth (
2.6 General Scheme for Engineering and Optimization of Addiction to Effector Metabolite by Regulated Expression of an Essential Gene
[0194] As exemplified in the previous examples, biosensors can be engineered into cells to control growth by addiction to an effector metabolite produced by the cell. The degree of addiction, which results in a relative growth advantage for cells that produce and accumulate the effector metabolite, may be increased by reducing the growth of an addicted cell in which the cellular levels of effector metabolite are below a given threshold. The degree of addiction of the addicted cell can be controlled by regulating the basal expression of the biosensor and/or the regulated essential gene.
[0195] 2.6.1 The degree of growth reduction for a given host cell that fails to produce sufficient effector metabolite can be increased by providing the regulated essential gene with a weaker RBS sequence e.g. generated with the “RBS Calculator” (https://salislab.net/software/), thereby reducing its rate of translation. Alternatively, the basal transcription strength of the regulated essential gene can be reduced by providing a biosensor-regulated, but weaker, promoter to drive its expression. Inversely, the degree of addiction can be reduced, to minimize the growth reduction for non-producing cells, by employing a stronger RBS sequence or stronger promoter to enhance basal expression of the regulated essential gene.
[0196] 2.6.2 The biosensor gene, engineered into the cell, is expressed under the control of a constitutive promoter. A suitable promoter can be selected from the set of the exemplary constitutive promoters provided in SEQ ID: 47-65. A suitable promoter is one that drives expression of the biosensor in an amount that is responsive to the effector metabolite concentration, while avoiding constitutive saturation of the promoter of the essential gene. Preferably, the engineered addicted cell of the invention is one whose growth rate is not reduced (no fitness cost) so long as the cell produces the effector metabolite at or above a predetermined amount.
2.7 Method for Engineering Host Cell Addiction to its Metabolic Product Using Tailor-Made Biosensor:Promoter Pairs
[0197] A large number of biosensors are described in the literature, in particular in the RegPrecise and Genbank databases, each being characterized for its specific detection of one of a wide range of metabolic products of interest, and which are suitable for engineering host cell addiction to a particular effector metabolite of interest.
[0198] By way of example, a list of suitable biosensor and cognate promoter pairs is given in Table 13 for respective effector metabolites, that are suitable for engineering host cell addiction, and for regulating the expression of a gene in the host cell required for its growth and/or survival. A host cell addicted to one of the effector metabolites listed in Table 13 can be constructed using the corresponding biosensor:promoter pairs to regulate the expression of the essential gene folP-glmM, as follows. The native folP-glmM promoter in the selected host strain is replaced by the respective promoter listed in Table 13, by means of lambda red-mediated recombineering as described in section 2.3 for insertion of the p.sub.BAD promoter. Further, the gene encoding the respective biosensor listed in Table 13, is introduced into the selected host strain on a plasmid, as described for the introduction of the plasmid pBALspec comprising the triacetic acid lactone biosensor in Example 2.3. Standard molecular expression tuning may additionally be employed to optimize the degree of addiction as described above.
TABLE-US-00015 TABLE 13 Specific implementations of biosensors for diverse effectors Biosensor Biosensor Effector Effector Promoter Biosensor nucleotide protein metabolite metabolite Promoter name name sequence sequence conc. (μM) Phenol SEQ ID No: 107 dmpRKLM DmpR SEQ No: 108 SEQ No: 109 1000 2-Amino- SEQ No: 110 hbpC HbpR SEQ No: 111 SEQ No: 112 100 biphenol Catechol SEQ No: 107 dmpRKLM CapR SEQ No: 113 SEQ No: 114 100 D-glycerate SEQ No: 115 gudP CdaR SEQ No: 116 SEQ No: 117 750 triacetic acid SEQ ID No: 66 p.sub.BAD AraCtal SEQ ID No: 95 SEQ ID No: 96 lactone salicylic acid SEQ ID No: 118 p.sub.SAL NahR_Asn169 SEQ ID No: 99 SEQ ID No: 100 benzoic acid SEQ ID No: 118 p.sub.SAL NahR SEQ ID No: 105 SEQ ID No: 106
Example 3. Riboswitch Biosensors Extend the Range of Addiction Molecules for Regulating Cell Growth
3.1 Use of Thiamine Pyrophosphate (TPP)-Sensitive Riboswitch-Controlled TA System to Regulate Bacterial Cell Growth
[0199] A TPP-responsive riboswitch (ThiMN15#19) was engineered into the previously constructed L-arabinose-responsive TA-based correction system (pBAD-TA5 to yield pBAT-TA5). This TPP riboswitch functions as an “ON-type” when in the presence of its ligand TPP, and it is functional at the level of translation. The riboswitch was inserted into the DNA region of the pBAD-TA5 gene construct that encodes the 5′ untranslated region (UTR) of the antitoxin mRNA sequence (
[0200] Table 14 listing the genetic features of the TPP-addicted-TA-regulated E. coli strain based on the E. coli XL1 parent strain
TABLE-US-00016 TABLE 14 Plasmid/ chromosome Gene SEQ ID No: Protein SEQ ID No pBAT-TA5 araC* SEQ ID No: 31 AraC Thi-tet- Tet-YefM SEQ ID No: 32 yefM** yoeB YoeB SEQ ID No: 33 ampR Beta- SEQ ID No: 34 lactamase *araC gene [SEQ ID No: 5] encoding araC biosensor protein [SEQ ID No: 6] is located on the complementary strand to SEQ ID No: 31 at nucleotide positions: 96-974; **thi riboswitch is located at nucleotides 1291-1452 of SEQ ID No.: 31
[0201] A modified E. coli strain comprising the TPP responsive-riboswitch-regulated TA correction system (pBAT-TA5) showed enhanced growth in the presence of the inducer TPP, thereby demonstrating functionality of the TPP-addiction mediated via a riboswitch and TA system (
3.1 Use of a TPP-Sensitive Riboswitch-Regulated TA System to Enhance Small Molecule Production in Bacteria.
[0202] In order to demonstrate that modified E. coli strain comprising the TPP riboswitch (ThiMN15#19) TA system, was dependent on internal TPP overproduction, the cells were further genetically modified to biosynthesize higher concentrations of TPP, which were compared with a reference strain cells retaining the wild-type intracellular TPP accumulation level. Biosynthesis of elevated TPP concentration was engineered by translational deregulation of the chromosomal native E. coli thiC gene. This was achieved by introducing a point mutation (by substituting wild-type nucleotide residue A at position (−135), with nucleotide B (=any one of C, G and T) in the region of the native E. coli thiC gene [GeneID:948492], to give the following 142nt sequence located directly upstream of the thiC open reading frame, corresponding to the transcribed 5′-UTR:
[0203] ATTCGGGBTCCGCGGAACCTGATCAGGCTAATACCTGCGAAGGGAACAAGAGTTAATCTGCTA TCGCATCGCCCCTGCGGCGATCGTCTCTTGCTTCATCCGTCGTCTGACAAGCCACGTCCTTAA CTTTTTGGAATGAGCT [SEQ ID No: 90] which when transcribed yields a mutant E. coli riboswitch transcript, that is insensitive to TPP feedback regulation. Growth and TPP production by these E. coli strains comprising, or lacking, the TPP-sensitive riboswitch-regulated TA gene correction system in the modified and reference stains, are then compared.
Example 4 Improved Fermentation Productivity Through use of Product-Addicted Strain Based on Control of Essential Genes
[0204] A plasmid (pMEV7C), encoding the genes for the metabolic pathway to mevalonate, was inserted in E. coli XL1. The strain was further engineered to encompass a biosensor-based addiction module according to the invention e.g. by following the methods for construction of strain e3.9 comprising the plasmid (FRT-kana-FRT-p.sub.PAD-RBS1)-folP-glmM), where growth requires expression of an essential gene (see Example 2.2). As a control, the same pathway plasmid (pMEV7C) was inserted in an E. coli XL1 strain to generate pel only differing in way of genetic engineering from e3.9 (Table 3) by the fact that no genetic changes had been introduced on the chromosome (i.e. the expression of essential genes were not linked to presence of the metabolic pathway product).
[0205] The two strains e3.9 and pe1 were grown at 37 deg. C. with 250-300 rpm horizontal shaking in 2xYT medium (with 30 μg/mL chloramphenicol and 50 μg/mL spectinomycin) for 55 cell generations to simulate a fermentation of large industrial size. This generation number was obtained in 25 mL shake flask cultures by transferring ≥0.5 vol % culture to fresh 2xYT medium an appropriate number of times according to the cell densities measured when transferring the culture. Final productivity of the cell population was evaluated by taking a sample for HPLC analysis following culturing at 37 deg. C. for 72 hours after the final transferring. As seen in
[0206] A high generation number could be reached using a continuous chemostat fermentor, in which the cells are constantly dividing through inlet of new medium and outlet of culture. Optionally, the strains could also be cultured at another temperature such as 30 deg. C. The productivity of the cells could further be measured at various numbers of generations such as (but not limited to) 20, 30, 40, 50, 60, 70 and 150 generations. To evaluate the stability of the pathway over time (cell generations), the cells can be re-cultured from a stored sample of the generation of cells in a 25% glycerol stock at −80 degrees Celsius. This sample could be re-cultured in 15 mL 2xYT (with 30 μg/mL chloramphenicol and 50 μg/mL spectinomycin) under otherwise same culture conditions and measuring the productivity (according to method described in previous section). To evaluate whether genetic mutations were less predominant in the product pathway of the product-addicted strain, DNA sequencing of the strains could be performed.
[0207] The cultivations can be carried out in growth medium, which can direct higher mevalonate productivity, such as M9 minimal medium supplemented with 0.4-4 (w/v) % glucose.
[0208] Mevalonate production (in the culture medium) was detected by HPLC, following treatment of 300 μL sampled culture broth with 23 μL 20% sulfuric acid for conversion to the mevalonolactone form. The mixture was vortexed and cells separated from the medium by centrifugation at 17,000 g for 3 mins. 30 μL supernatant (medium) was injected in an Ultimate 3000 HPLC running with a 5 mM sulfuric acid mobile phase (0.6 mL/min) on an Aminex HPX-87H ion exclusion column (300 mm×7.8 mm, Bio-Rad Laboratories, Hercules, Calif., USA) at 50° C., with detection using refractive-index (RI) channel.
Example 5 Improved Fermentation Productivity Through use of Product-Addicted Strain Based on Control of Toxin-Antitoxin Systems
[0209] A plasmid (pMEV7C) encoding the genes for the metabolic pathway to mevalonate was inserted in E. coli XL1. The strain was further engineered to encompass a biosensor-based addiction module according to the invention e.g. by following the methods for construction of strain m29, which comprises (pBAM-TA5), where growth is controlled by expression of the anti-toxin and toxin pair (see Example 1.4). As a control, the exact same pathway plasmid was inserted in an E. coli XL1 strain, to create a strain only differing from m29 by the fact that a plasmid featuring the invented system had not been introduced (i.e. the expression of antitoxin was not linked to presence of the metabolic pathway product).
[0210] Pre-cultures in 2xYT were inoculated from single colonies of the two strains, and main cultures were inoculated from these when OD600 (measured on 200 μL sample in a BioTek SynergyH1 plate reader) was 0.1-0.5. From there, the two strains were grown at 30 deg. C. with 250-300 rpm horizontal shaking in 2xYT medium for 70 cell generations to simulate a fermentation of large industrial size. This generation number was obtained in 50 mL shake flask cultures by transferring 0.5 vol % culture to fresh medium an appropriate number of times according to the cell densities measured before transferring the culture. Optionally, the generation number could be reached using a continuous chemostat fermentor, in which the cells are constantly dividing through inlet of new medium and outlet of culture. The productivity of the cells was measured at various numbers of generations such as (but not limited to) 20, 30, 40, 50, 60 and 70 generations. This was done by recording a sample of the generation of cells in a 25% glycerol stock stored at −80 deg. C. and re-culturing them in tubes with 15 mL 2xYT under otherwise same culture conditions and measuring the productivity (according to method described in Example 4).
References
[0211] Cebolla, A., Sousa, C., De Lorenzo, V., 1997. Effector Specificity Mutants of the Transcriptional Activator NahR of Naphthalene Degrading Pseudomonas Define Protein Sites Involved in Binding of Aromatic Inducers. J. Biol. Chem. 272, 3986-3992. doi:10.1074/jbc.272.7.3986
[0212] Datsenko, K. a, Wanner, B. L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645. doi:10.1073/pnas.120163297
[0213] Guzman, L. M., Belin, D., Carson, M. J., & Beckwith, J. (1995): Tight regulation, modulation, and high-level expression by vectors containing the arabinose P BAD Promoter. Journal of Bacteriology, 177(14), 4121-4130.
[0214] Tang, S. Y., Qian, S., Akinterinwa, O., Frei, C. S., Gredell, J. A., Cirino, P. C., 2013. Screening for enhanced triacetic acid lactone production by recombinant Escherichia coli expressing a designed triacetic acid lactone reporter. J. Am. Chem. Soc. 135, 10099-10103. doi:10.1021/ja402654z