METHOD AND SYSTEM FOR THE PRODUCTION OF RECOMBINANT PROTEINS BY CELLS

Abstract

A cassette sequence for the transformation of a host cell includes at least: a first nucleotide sequence encoding a peptide or protein of interest to be produced by the host cell. The first sequence is linked to a second nucleotide sequence providing resistance to a toxin or encoding an antitoxin peptide to the toxin. The nucleotide sequences are organized in such a way that production of the peptide encoded by the second nucleotide sequence(s) is translationally coupled to production of the peptide encoded by the first nucleotide sequence.

Claims

1. A cassette sequence comprising: a first nucleotide sequence encoding a peptide of interest to be produced by a host cell, said nucleotide sequence being linked to a second nucleotide sequence either providing a resistance to a toxin that is toxic for said host cell or encoding an antitoxin peptide to a toxin, wherein said first nucleotide sequence and second nucleotide sequences are linked to encode their corresponding peptides as a fusion protein.

2. The cassette sequence according to claim 1, further comprising, between the first nucleotide sequence and the second nucleotide sequence, a third nucleotide sequence encoding a linker peptide having a length between about 2 amino acids and about 500 amino acids and wherein the first nucleotide sequence, the second nucleotide sequence and the third nucleotide sequence are organized in such a way that production of the antitoxin peptide encoded by the second nucleotide sequence is translationally coupled to production of the peptide of interest encoded by the first nucleotide sequence as a fusion protein.

3. The cassette sequence according to claim 2, wherein the linker peptide comprises a sequence cleavable by a protease.

4. The cassette sequence according to claim 3, wherein the Protease is the TEV protease.

5. The cassette sequence according to claim 2, wherein the linker peptide is an auto-cleavable peptide.

6. The cassette sequence according to claim 5, wherein the auto-cleavable peptide is an intein.

7. The cassette sequence according to claim 2, wherein the linker peptide induces ribosome skipping or STOPGO or STOP CARRY-ON leading to the production of two peptides.

8. The cassette sequence according to claim 7, wherein the linker peptide is a member of the peptides 2A family.

9. The cassette sequence according to claim 1, wherein the toxin is an antibiotic or a mixture of antibiotics and wherein the second nucleotide sequence encodes a peptide providing resistance to said antibiotic or said mixture of antibiotics.

10. The cassette sequence according to claim 1, wherein the toxin is a herbicide or fungicide and the second nucleotide sequence encodes a peptide providing resistance to said herbicide or said fungicide.

11. The cassette sequence according to claim 1, wherein the toxin/antitoxin peptides are selected from the group consisting of CcdB/CcdA, Kid/Kis (PemK/PemI), ParE/ParD, MazE/MazF, RelE/RelB, YafO/YafN, HipA/HipB, Doc/PhD, VapC/VapB, VapD/VapX, HicA/HicB, YoeB/YefN, YafQ/DinJ, Tse2/Tsi2 (PA2702/PA2703), Tse1(PA1844)/Tsi1, Tse3(PA3484)/Tsi3, C-terminal portions of Rhs (Rhs-CT) or CdiA (Cdi-CT) peptides/associated immune peptides RhsI or CdiI, or bacteriocins peptides being of plasmid origin or not.

12. The cassette sequence according to claim 11, wherein the toxin/antitoxin peptides are Kid/Kis peptides.

13. The cassette sequence according to claim 1, integrated into the genome of the host cell.

14. The cassette sequence according to the claim 13, wherein the host cell, further comprises in the host cell genome, the nucleotide sequence encoding the toxin.

15. The cassette sequence according to claim 13, wherein the nucleotide sequence encoding the toxin is under control of a first promoter and/or operator sequence.

16. A vector comprising the cassette sequence according to claim 1.

17. The vector according to the claim 16, wherein the cassette sequence is under control of a second promoter and/or operator sequence.

18. The vector according to claim 16, the vector being a plasmid.

19. A host cell comprising in the host cell genome, the cassette sequence or the vector according to claim 1 and one or more copies of a fourth nucleotide sequence encoding a toxin which is toxic to said host cell.

20. The cell according to the claim 19, being a bacterial cell.

21. The cell according to the claim 20, being E. coli.

22. The cell according to claim 19, being a Eukaryote cell.

23. A method for the transformation of a host cell and production of a peptide of interest encoded by a first nucleotide sequence, the method comprises the steps of: putting into contact the cassette sequence according to claim 1, with either the host cell comprising in the host cell genome, one or more copies of a fourth nucleotide sequence encoding a toxin which is toxic for said host cell and/or with said host cell being present in a culture medium comprising said toxin and/or comprising a cell different from the host cell secreting in said culture medium, said toxin, and recovering from said first cell medium, either the fusion protein or the peptide of interest.

24. The method of claim 23, wherein the nucleotide sequence encoding the toxin is present in the genome of the host cell.

25. The method of claim 23, wherein the fourth nucleotide sequence is under control of a first promoter and/or operator sequence.

26. The method according to claim 23, wherein the toxin is lethal for the host cell.

27. The method according to claim 23, wherein the host cell is a bacterial cell.

28. The method according to the claim 26, wherein the host cell is E. coli.

29. The method according to claim 23, wherein the host cell in a Eukaryote cell.

30. A method for controlling the survivability of a host cell, comprising in the host cell genome the nucleotide sequence of the cassette according to claim 1 and wherein said host cell further comprises in the host cell genome, one or more copies of a fourth nucleotide sequence encoding a toxin that is toxic to said host cell, and/or said host cell being present in a culture medium comprising said toxin and/or comprising a cell different from the host cell secreting in said culture medium, said toxin.

31. The method according to claim 30, wherein the nucleotide sequence encoding the toxin peptide is present in the chromosome of the host cell and wherein the nucleotide sequence of the cassette is present upon an extra-chromosomal replicon.

32. The method according to the claim 30, wherein the toxin is lethal for the host cell.

33. The method according to claim 30, wherein the host cell is a bacterial cell.

34. The method according to claim 30, wherein the host cell is E. coli.

35. The method according to claim 30, wherein the host cell is a Eukaryote cell.

36. A protein or peptide expression kit comprising the cassette according to claim 1 and a sufficient amount of the toxin to be added to a culture medium.

37. A protein or peptide expression kit comprising a nucleic acid construct with at least one restriction site for integration of a first nucleotide sequence encoding a peptide of interest to be produced by a cell, the first site being disposed upstream a second nucleotide sequence encoding an antitoxin peptide to a toxin toxic for the cell and wherein the first and second nucleotide (3, 5) are organized in such a way that production of the antitoxin peptide encoded by the second sequence is translationally coupled to production of the peptide of interest encoded by the first nucleotide sequence, as a fusion protein.

38. The kit according to the claim 37, wherein the nucleic acid construct further comprises a third nucleotide sequence encoding a linker peptide of a length between about 2 amino acids and about 500 amino acids, the third nucleotide sequence being disposed between the restriction site for the first nucleotide sequence and the second nucleotide sequence and wherein the first nucleotide sequence, the second nucleotide sequence and the third nucleotide sequence are organized in such a way that production of the antitoxin peptide encoded by the second sequence is translationally coupled to production of the peptide of interest encoded by the first nucleotide sequence as a fusion protein.

Description

SHORT DESCRIPTION OF THE DRAWINGS

[0036] FIG. 1 represents schematically the elements used in the method according to the invention.

[0037] FIG. 2 represents examples of sequences that can be present in the cassette sequence according to the invention.

DETAILED DESCRIPTION OF THE INVENTION

[0038] As shown in the enclosed FIG. 1, a host cell 1 is transformed by a nucleotide sequence 2, also named hereafter “cassette”, possibly incorporated into a transformation or cloning vector or nucleic acid construct.

[0039] This vector is preferably a plasmid that may comprise suitable elements for auto-replication into the host cell 1, such as an origin of replication sequence (ori) and an additional promoter/operator sequence(s).

[0040] The cassette sequence 2, or the vector incorporating said cassette sequence 2, is used for the transformation of cells, or the cloning of a nucleotide sequence 3 of interest into cells and production of a peptide or a protein of interest 7 by these cells, but also for controlling cells viability. These host cells being preferably selected from the group consisting of bacterial cells or other suitable host cells, such as yeast (preferably Pichia or Saccharomyces), mammalian, insect cells or plant cells, more preferably Escherichia coli (E. coli).

[0041] Preferably, the vector comprises, the cassette sequence 2 encoding a fusion protein 10 being made of peptides 7,8, and 9, or two separate peptides (peptide 7 with the N-terminal part of linker peptide 8 and C-terminal part of linker peptide 8 with peptide 9) being produced by ribosome skipping, under the control of a first, preferably strong, constitutive, or maybe inducible, promoter and/or operator sequence 6, at least two, preferably three, linked nucleotide sequences, more being preferably made of at least the first nucleotide sequence 3 and the second nucleotide sequence 5, coding for two translationally coupled peptides 7 and 9, as the fusion protein 10.

[0042] According to a preferred embodiment of the present invention, the cassette sequence 2 is made of at least: [0043] one or more copies of a first nucleotide sequence 3, or gene of interest encoding a (poly)peptide or protein of interest, such as the APOL-1 peptide or the GFP peptide described in the FIG. 2, this first nucleotide sequence 3 or gene of interest being linked to [0044] one or more copies of a second nucleotide sequence 5 coding for a second peptide 9.

[0045] The second nucleotide sequence 5 can either encode an antitoxin peptide or protein, providing resistance to the toxin peptide 11, 12 or 15, produced endogeneously by the host cell 1 (toxin peptide 12) or produced by the host cell 1 and secreted in the culture medium (toxin peptide 15) or added exogenously in the culture medium (toxin peptide 11), preferably an antidote 9 to a poison, or a mutated target sequence that provides for the host cell resistance to a specific toxin, such as a bacteriocin, an antibiotic, a herbicide or a fungicide.

[0046] Preferably, the cassette sequence 2 further comprises between the first nucleotide sequence 3 and the second nucleotide sequences 5 and linked to them, a third nucleotide sequence 4, encoding for a linker peptide 8 having a length comprised between about 2 and about 500 amino acids, preferably between about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55 or 60 and about 500, 450, 400, 350, 300, 250, 200, 150 and 100 amino acids.

[0047] Advantageously, the length of the linker peptide 8 is adequate to allow that the conformational properties or sequence of the peptide or protein of interest 7 do not affect the activity of the second peptide 9, especially its antitoxin activity and its capacity to interact with the exogenous or endogenous toxin 11, 12 or 15 and block its toxic activity against the host cell 1. Preferably, the length of the linker peptide 8 is also sufficient, preferably having more than seven amino acids, to be cleavable by a peptidase.

[0048] Preferably, this linker peptide 8 is able to produce two peptides after cleavage, preferably being cleavable by addition of proteases, more preferably a Tobacco Etch Virus (TEV) protease.

[0049] Furthermore, the linker peptide 8 or the peptide or protein of interest 7, may include one or more sequences or modifications that encode specific sequences that are recognized by site-specific proteases to allow removal of the remaining portion or fragment, preferably a portion or the total sequence of the linker peptide 8.

[0050] A TEV protease is the common name for the 27 kDa catalytic domain of the Nuclear Inclusion a (NIa) protein encoded by the tobacco etch virus (TEV). Because its sequence specificity is far more stringent than that of the factor Xa, thrombin or enterokinase, TEV protease is a useful reagent for cleaving fusion proteins. TEV protease recognizes a linear epitope of the form E-Xaa-Xaa-Y-Xaa-Q-G/S with cleavage between the amino acid Q and amino acid G or amino acid Q and amino acid S. The most commonly used sequence is ENLYFQG.

[0051] Preferably, the linker peptide 8 is an intein able to produce two peptides after auto-catalytic self-cleavage.

[0052] Inteins are segments of proteins that are able to excise themselves and join the remaining portions “exteins” with a specific bond in a process termed protein splicing. Inteins are also called “protein introns”. More particularly, an intein sequence that is located at the C-terminus of a protein of interest can excise itself spontaneously in the host cell, through a process known as “self-cleavage” (Cui et al. (2006) Prot. Expr. Purif. 50:74), resulting in two separate polypeptides: [0053] the expected full-length recombinant protein (located N-terminus to this intein) and [0054] the C-terminal part of the polypeptide, (the intein itself, being possibly fused to a peptide with antitoxin activity)

[0055] Preferably, the linker peptide 8 is also able to produce two separate peptides upon translation by ribosome skipping or by STOPGO or STOP CARRY-ON. Instead of a fusion protein 10, ribosome skipping generates a first peptide comprising the peptide or protein of interest 7 and the N-terminal part of the linker peptide 8, and a second peptide comprising the C-terminal part of the linker peptide 8 and the antidote protein 9. More preferably the linker peptide 8 is a peptide from the 2A family.

[0056] The present invention is also related to a cloning kit, comprising suitable elements, preferably included in different vials, for performing the transformation or cloning step according to the invention, in particular the cassette sequence 2, or a cassette that only comprises the second nucleotide sequence 5 (encoding the antidote protein 9) or the second nucleotide sequence 5 and the third nucleotide sequence 4 (encoding the linker peptide 8), possibly with suitable restriction sites for cloning the first nucleotide sequence 3 immediately upstream the second nucleotide sequence 5 or immediately upstream the third nucleotide sequence 4, or the vector according to the invention and possibly a sufficient amount of the exogenous toxin peptide 11, which can be added to the culture medium of a cell 1 as represented in FIG. 1.

[0057] The kit according to the invention may also comprise this host cell 1 and the culture medium of this host cell 1.

[0058] Preferably, the host cell 1 to be transformed by the cassette sequence 2, or comprising the cassette sequence 2, may comprise in its genome, preferably in its chromosome, preferably under the control of a first controllable, inducible and/or repressible, promoter and/or operator sequence 14, one or more copies of a fourth nucleotide sequence 13 encoding (coding for) the toxin 12 or 15, i.e. a cytotoxin or a toxic compound to the host cell 1, more preferably a poison peptide, that is toxic, preferably lethal for the host cell 1, preferably this nucleotide sequence 13 is encoding the endogenous poison 15 secreted by the cell in its culture medium or the endogenous toxin 12 present in the cytoplasm of the cell.

[0059] As an alternative of the invention, the host cell 1 will not comprise in its genome any nucleotide sequence encoding this toxin, and the selection of the transformation step or survival control of the host cell is done by addition to the host cell culture medium of a sufficient amount of this toxin peptide 11 and/or a sufficient amount of a cell (which can be the host cell or a cell which is not the host cell) secreting in the culture medium, the toxin 15.

[0060] Examples of such exogenous or endogenous toxins 11, 12 or 15 that are toxic for the cell 1 are peptides, or other active compounds, reducing the growth of the cell by at least 50%, 60%, 70%, 80%, 90%, or being lethal and killing the host cell. Such toxin can also be a non-peptide compound preferably selected from the group consisting of a bacteriocin, an antibiotic, a herbicide, a fungicide or a mixture of antibiotics, herbicides or fungicides.

[0061] Other examples of “antitoxin sequence” include also mutated target sequences that provide for the host cells resistance to the activity of such specific non-peptide toxins, such as bacteriocins, antibiotics, herbicides or fungicides.

[0062] The first promoter and/or operator sequence 14 is preferably an inducible, or controllable, promoter and/or operator sequence, controllable by means well known to person skilled in the art, i.e. through temperature shift or addition of compound in the host cell culture medium, because it advantageously defines the level of production yield of the endogenous toxin 12 or 15 by the transformed host cell 1.

[0063] Preferably, the second nucleotide sequence 5 is the Kis sequence, or any other sequence preferably encoding a peptide or protein modified Kis, able to interact with Kid nucleotide sequence 13 or protein Kid 11, 12, 15 and avoiding its toxic lethal activity upon the host cell 1.

[0064] Alternatively, the second nucleotide sequence 5 can be any sequence that confers, to the transformed host cell 1, resistance to the toxic activity of a sufficient amount of the added exogenous toxin 11, such as for example an antibiotic or mixture of antibiotics, or an herbicide, especially if the host cell is plant cell, in the host cell 1 culture medium.

[0065] Advantageously, the host cell 1 transformed by the vector of the invention will generate after transcription and translation of the cassette sequence 2 present in the vector, the fusion protein 10 or two separate peptides (peptide 7 with the N-terminal part of linker peptide 8 and C-terminal part of linker peptide 8 with peptide 9) being produced by ribosome skipping. Preferably, this fusion protein 10 may include in its amino acid sequence, a linker peptide sequence 8 having a sufficient length of at least 2 amino acids preferably up to 500 amino acids or more.

[0066] Preferably, the linker peptide 8 is a functional peptide 2A, or any sequence generating two peptides from the translation of one ORF either by ribosome skipping, auto-cleavage or cleavage by site-specific proteases.

[0067] In the case of the cassette sequence 2 comprising a linker sequence 4 encoding a peptide 2A generates the formation of two different peptides: [0068] the active antidote being antitoxin peptide or protein 9, covalently linked to its N-terminus to a first short peptide fragment or amino acid of the cleaved peptide 2A, or of a similar auto-cleavable peptide sequence, proline amino-acid from the cleaved portion or fragment of peptide 2A, or similar auto-cleavable protein, and, [0069] the peptide or protein of interest being the GFP protein 7, covalently linked to its C-terminus to the second portion of the cleaved peptide 2A, or of the cleavable portion of a similar auto-cleavable peptide.

[0070] Adequate means are also selected by the person skilled in the art for a purification of these two peptides, or proteins, and possibly a second specific cleaving of the remained portion of the linker peptide 8, preferably such as a portion of the peptide 2A sequence linked to the peptide or protein of interest 7.

[0071] This method compared to methods proposed in the state of the art will improved the production yield and quality of recombinant proteins, since this method and means require adequate production of protein fusion 10 or adequate production of antidote protein 9 by ribosome skipping, to counteract the toxic activity of the corresponding exogenous or endogenous toxin 11, 12 or 15, preferably the poison protein (Kid).

[0072] By the method and means of the invention, host cells possibly present in the bioreactor that do not produce the fusion protein 10 or the antidote protein 9 by ribosome skipping, will be killed by the activity of the corresponding exogenous or endogenous toxin 11, 12 or 15. This will avoid generation of heterogeneous host cell sub-populations producing non complete and possibly inactive proteins of interest or producing low amounts or no protein of interest 7. Therefore, with the method and means according to the invention, a high production and high qualitative yield of the recombinant peptide or protein of interest 7 as a fusion protein 10 (through a translational coupling) is obtained.

[0073] Indeed, any non-desired genetic modification, such as point mutation(s) (nucleotide(s) substitution(s)), deletion(s) or addition(s) of one or more nucleotide(s)), in the first sequence 3, the gene of interest, encoding the peptide or protein of interest 7, will result in altered production of the antidote protein 9 moiety of the fusion protein 10, quantitatively or qualitatively. Transcription errors (nucleotide(s) substitution(s), deletion(s) or addition(s) of one or more nucleotide(s), or premature arrest of transcription) resulting in altered expression of the peptide or protein of interest 7 moiety of the fusion protein 10, will also result in altered production of the antidote protein 9 moiety of the fusion protein 10, quantitatively or qualitatively. Translation errors (frameshifts, premature arrest of translation) resulting in altered expression of the peptide or protein of interest 7 moiety of the fusion protein 10, will also result in altered production of the antidote protein 9 moiety of the fusion protein 10, quantitatively or qualitatively. In addition, genetic mutations elsewhere in the genome of the host cell 1 (including chromosomal and extra-chromosomal elements) or transcriptional, post-transcriptional, translational, or post-translational errors during production of host cell constituents (proteins, RNAs, metabolites) can also directly or indirectly affect the transcription or translation of the peptide or protein of interest 7 moiety of the fusion protein 10, which will also result in altered production of the antidote protein 9 moiety of the fusion protein 10, quantitatively or qualitatively.

[0074] Consequently, any incorrect amino acid sequence of the antitoxin 9 present in the fusion protein is probably not able to antagonise to its corresponding exogenous or endogenous toxin 11, 12 or 15 and will result into the killing of the transformed cell 1 by the toxic activity of this toxin. Therefore, any host cell that is not producing correctly the peptide or protein of interest 7, but also any cell that is producing a modified peptide or protein of interest is advantageously and immediately killed from the host cell culture, preferably from the bioreactor comprising this host cell and therefore such cells will not consume the growth medium present in the bioreactor and will not produce the modified peptide or protein of interest. Consequently, only the host cells producing efficiently the unmodified protein of interest 7 included in the fusion protein 10 will be selected, will be able to grow and will remain in the bioreactor.

Example: Recombinant Protein Overexpression in Host Cells (Laboratory Protocol)

[0075] Saccharomyces cerevisiae cells contain plasmid A (pRS425-Met25 plasmid (Mumberg D, et al. Nucl. Acids Res. 22: 5767-5768, 1994) with the cassette integrated between XbaI and EcoRI restriction sites) and a second plasmid B (pRS416-GAL1 (Mumberg D, et al. Nucl. Acids Res. 22: 5767-5768, 1994) with the toxin sequence according to the invention and being integrated between XbaI and EcoRI restriction sites).

[0076] Media

Liquid Culture Medium a (1 Liter)

[0077] Difco Yeast Nitrogen Base w/o amino acids (ref. 291920) [0078] Glucose 3% (final concentration) [0079] Methionine 500 uM (final concentration) [0080] Addition of water to adjust to 1 liter

Liquid Culture Medium B (1 Liter)

[0081] Difco Yeast Nitrogen Base w/o amino acids (ref. 291920) [0082] Galactose 3% (final concentration) [0083] Addition of water to adjust to 1 liter

[0084] Procotol:

[0085] Day 0 [0086] A culture cells bearing both plasmid A and B are present in liquid culture medium A from glycerol or isolated colony [0087] The dilution factor (knowing lag time and growth rate) to reach OD660 nm of 0.2 at DAY1 was calculated. According to this dilution factor, a dilution of the previous culture in the pre-warmed liquid medium A (50 ml in 250 ml Erlenmeyer flask) incubated at 30° C.; 160 RPM was obtained.

[0088] Day 1

[0089] When OD.sub.660nm reached 0.2, the inventors have applied the following steps: [0090] Centrifugation of the culture at 3000 RPM for 2 minutes at 30° C. [0091] Removing of the supernatant [0092] Resuspension of the pellet in 50 ml of a pre-warmed culture medium B [0093] Centrifugation at 3000 RPM for 2 minutes at 30° C. [0094] Resuspension of the pellet in 50 ml of a pre-warmed culture medium B [0095] Incubation at 30° C.; before centrifugation at 160 RPM for 180 minutes (until OD.sub.660nm reaches 0.5). [0096] Centrifugation of the culture at 3000 RPM for 2 minutes at 4° C. [0097] Removing of the supernatant [0098] Finally the obtained pellet was subjected to high quality protein extraction.

TABLE-US-00001 Cassette sequence (composed of GFPmut2 sequence in the same ORF with P2A sequence in the same ORF with optimized kis antitoxin) ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGA ATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTG AAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACT GGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGCGTATGG TCTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTT TCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTC AAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGA TACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATG GAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTA TACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAAT TAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAAC AAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCA CATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACCCATGGTATGG ATGAATTGTACAAAGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAG GCTGGAGACGTGGAGGAGAACCCTGGACCTCACACTACTAGATTGAAGAG AGTTGGTGGTTCTGTTATGTTGACTGTTCCACCAGCTTTGTTGAACGCTT TGTCTTTGGGTACTGACAACGAAGTTGGTATGGTTATTGACAACGGTAGA TTGATTGTTGAACCATACAGAAGACCACAATACTCTTTGGCTGAATTGTT GGCTCAATGTGACCCAAACGCTGAAATTTCTGCTGAAGAAAGAGAATGGT TGGACGCTCCAGCTACTGGTCAAGAAGAAATTTAATAA Toxin sequence (Optimized kid toxin (from Kis/Kid toxin-antitoxin system)) ATGTTGAAGTACCAATTGAAGAACGAAAACGGTTGGATGCACAGAAGATT GGTTAGAAGAAAGTCTGACATGGAAAGAGGTGAAATTTGGTTGGTTTCTT TGGACCCAACTGCTGGTCACGAACAACAAGGTACTAGACCAGTTTTGATT GTTACTCCAGCTGCTTTCAACAGAGTTACTAGATTGCCAGTTGTTGTTCC AGTTACTTCTGGTGGTAACTTCGCTAGAACTGCTGGTTTCGCTGTTTCTT TGGACGGTGTTGGTATTAGAACTACTGGTGTTGTTAGATGTGACCAACCA AGAACTATTGACATGAAGGCTAGAGGTGGTAAGAGATTGGAAAGAGTTCC AGAAACTATTATGAACGAAGTTTTGGGTAGATTGTCTACTATTTTGACTT AATAA