AGERITIN AS BIOINSECTICIDE AND METHODS OF GENERATING AND USING IT
20220056499 · 2022-02-24
Inventors
- FLORIAN HENNICKE (FRANKFURT, DE)
- MARKUS KUENZLER (EHRENDINGEN, CH)
- ANNAGELDI TAYYROV (ZUERICH, CH)
- PETER LUETHY (FELDMEILEN, CH)
Cpc classification
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P21/02
CHEMISTRY; METALLURGY
A01N63/00
HUMAN NECESSITIES
International classification
C12P21/02
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the fungal protein ageritin, a nucleic acid molecule encoding said protein, host cells expressing the protein and/or the nucleic acid molecule and a plant or fungus expressing the protein and/or the nucleic acid molecule and/or comprising such host cells. The present invention further relates to using the fungal protein ageritin, the nucleic acid molecule encoding it, the host cell expressing it and/or the plant as bioinsecticide(s). The present invention further relates to a bioinsecticide composition.
Claims
1-17. (canceled)
18. A protein selected from a protein comprising an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 60% sequence identity to the amino acid sequence of SEQ ID NO: 1, and/or a protein encoded by a nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence having at least 60% sequence identity to the nucleotide sequence of SEQ ID NO: 2.
19. The protein of claim 18, comprising an amino acid substitution in position Y57, D91 and/or K110.
20. A nucleic acid molecule, comprising a nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence having at least 60% sequence identity to the nucleotide sequence of SEQ ID NO: 2.
21. The nucleic acid molecule of claim 20, further comprising vector nucleic acid sequences, and/or comprising promoter nucleic acid sequences and terminator nucleic acid sequences, and/or comprising other regulatory nucleic acid sequences, and/or wherein the nucleic acid molecule comprises dsDNA, ssDNA, cDNA, LNA, PNA, CNA, RNA or mRNA or combinations thereof.
22. A host cell, containing a nucleic acid molecule according to claim 20.
23. The host cell of claim 22, which is a bacterial cell a plant cell, or a fungal cell.
24. A recombinant protein of claim 18 obtained from a host cell containing a nucleic acid molecule encoding the protein of claim 18.
25. A plant or fungus, containing a nucleic acid molecule according to claim 20.
26. The plant or fungus of claim 25, which is an agricultural crop and/or an ornamental plant selected from Zea mays, Gossypium spp., Capsicum spp., Solanum tuberosum, Solanum lycopersicum, Nicotiana tabacum, Phaseolus lunatus, Pisum sativum var. macrocarpon, Glycine max, Arachis hypogaea, Triticum aestivum, Avena sativa, Hordeum vulgare, Secale cereale, Malus domestica, Pyrus communis, Prunus spp., Ribes spp., and Vitis vinifera, or an edible, medicinal or ornamental mushroom selected from Agaricus bisporus, Pleurotus ostreatus, P. eryngii, Lentinula edodes, Hericium spp., Volvariella volvacea, Grifola frondosa, Ganoderma spp., Trametes spp, Auricularia polytricha, Flammulina velutipes, Lentinus sajor-caju, and Hypsizygus tessellatus, or an entomopathogenic or mite-pathogenic fungus selected from Beauveria bassiana, Hirsutella thompsonii, Isaria spp., Lecanicillium spp., Metarhizium spp., and Nomuraea spp.
27. The plant of claim 25, furthermore comprising Bacillus thuringiensis or Bacillus thuringiensis subspecies israelensis (Bti).
28. A method for pest control comprising contacting the pest with the protein of claim 18 as (bio)insecticide.
29. The method according to claim 28 used to control mosquitoes.
30. The method according to claim 28 used against insect pests attacking crop plants and/or ornamental plants.
31. The method according to claim 28 used to control mites, fungus gnats and fungus pests, storage pests, hygiene pests, and/or in crop protection.
32. A (bio)insecticide or (bio)pesticide composition comprising: (a) a protein of claim 18, a nucleic acid molecule of claim 18, and (b) excipient(s) and/or carrier.
33. The composition of claim 32, furthermore comprising one or more of the following: methionine temephos Bacillus thuringiensis subspecies israelensis toxins (Bti toxins), Lysinibacillus sphaericus powder SPH88, chitin synthesis inhibitors, e.g. diflubenzuron, novaluron, pyriproxyfen, methoprene, anethole, cinnamaldehyde, cinnamyl acetate, Bacillus thuringiensis toxins (Bt toxins), azadirachtin, tebufenozide, and malathion.
34. The composition of claim 32, which is formulated as a solution, a powder, granules, or a bait.
35. The nucleic acid molecule of claim 20, which encodes a protein selected from a protein comprising an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 60% sequence identity to the amino acid sequence of SEQ ID NO: 1.
36. The host cell of claim 23, wherein the cell is a bacterial cell that is Escherichia coli, a plant cell that is Zea mays, Gossypium spp., Capsicum spp., Solanum tuberosum, Solanum lycopersicum, Nicotiana tabacum, Phaseolus lunatus, Pisum sativum var. macrocarpon, Glycine max, Arachis hypogaea, Triticum aestivum, Avena sativa, Hordeum vulgare, Secale cereale, Malus domestica, Pyrus communis, Prunus spp., Ribes spp., or Vitis vinifera, or a fungal cell that is an edible, medicinal or ornamental mushroom or a yeast cell or an entomopathogenic or mite-pathogenic fungus that Agaricus bisporus, Pleurotus ostreatus, P. eryngii, Lentinula edodes, Hericium spp., Volvariella volvacea, Grifola frondosa, Ganoderma spp., Trametes spp, Auricularia polytricha, Flammulina velutipes, Lentinus sajor-caju, Hypsizygus tessellatus, Ustilago spp., Microbotryum spp., Xanthophyllomyces dendrorhous, Rhodotorula spp., Sporobolomyces spp., Mrakia spp., Beauveria bassiana, Hirsutella thompsonii, Isaria spp., Lecanicillium spp., Metarhizium spp., or Nomuraea spp.
37. The method of claim 31 used to control Brennandania lambi, Tyrophagus putrescentiae, Panonychus ulmi, Tetranychus urticae, Sciaridae, Camptomyia corticalis, C. heterobia, Bruchids, Caryedon serratus, Plodia interpunctella; Sitophilus spp. Curculionidae; Cephalonomia tarsalis, Bethylidae, Anisopteromalus calandrae, cockroaches, ants, termites, bed bugs, slugs, blossom beetle, rape stem beetle, Aphids, Drosophila susukii, raspberry weevil, caterpillars, fungus gnats, European grape vine moth, stem borers, or European red mite.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0235]
[0236] A) Amino acid sequences of ageritin and its paralog were aligned using the ClustalW algorithm (v2.1).
[0237] B) Expression level for the ageritin-encoding gene AaeAGT1 and the paralog AaeAGT2 at different stages of fruiting body development relative to that of vegetative mycelium (developmental stage I). The dotted horizontal line represents the mycelial expression level of both AaeAGT1 and AaeAGT2 and is used as a base-line value (developmental stage I), in comparison with other developmental stages of A. aegerita AAE-3: II, fruiting-primed mycelium 24 h to 48 h before emergence of visible fruiting body (FB) initials; III, FB initials; IV, entire FB primordia; Vs, young FB stipe; Vc, young FB cap. The error bars represent the standard deviation of three biological replicates.
[0238] C) Ribonucleolytic activity of ageritin assayed with 400 nM of purified ageritin against ribosomes of rabbit reticulocyte lysate. Ribotoxin α-Sarcin and reaction buffer were used as positive and negative control, respectively. Ribosomal RNAs and classical ribotoxin cleavage product, α-fragment, were indicated.
[0239]
[0240] Entomotoxicity of ageritin and its tagged version was tested against Aedes aegypti larvae by recording the mortality (A) and by measuring the consumption of E. coli by determination of the reduction of the OD.sub.600 of a respective E. coli suspension (B). Mosquito larvae were fed for 96 h on IPTG-induced E. coli BL21 expressing proteins Cgl2, ageritin and His.sub.8-ageritin. E. coli BL21 cells expressing either previously characterized insecticidal protein Cgl2 or carrying ‘empty’ vector (EV) were used as positive and negative control, respectively. Statistical analysis was done using Dunnett's multiple comparisons test. The error bars represent the standard deviation of five biological replicates. ****p<0.0001 vs. EV.
[0241] C) Ageritin entomotoxicity was tested against the insect cell line S. frugiperda Sf21. Different concentrations of purified ageritin were incubated with Sf21 cells for 72 h. The number of viable cells was counted for each sample. DMSO and ribotoxin α-Sarcin were used as positive controls, and PBS buffer was used as a negative control. Dunnett's multiple comparisons test was used for statistical analysis. The error bars represent the standard deviation of six biological replicates. Symbols/abbreviations: ns: not significant, ***p<0.001, ****p<0.0001 vs. PBS.
[0242]
[0243] A) The amino acid sequence of ageritin was used as a query sequence for a BLAST search against the JGI MycoCosm fungal database. The hit regions of the top 10 sequences with highest homology were aligned using the ClustalW algorithm (v2.1). Individually mutated conserved regions are indicated by boxes and asterisks.
[0244] B)-D) The entomotoxic activity of of the wild-type (wt) and mutated ageritin versions was monitored by feeding Ae. aegypti larvae with E. coli BL21 cells expressing the respective protein of interest. Wild type and mutated ageritin toxicity was assessed by counting the number of surviving larvae (B), measuring OD.sub.600-based bacteria consumption (C) every day for four days and counting number of larvae that reached the adult stage (D) by the end of day 7 of the larvae feeding on bacteria expressing one of the corresponding proteins. E. coli BL21 expressing either previously characterized insecticidal protein Cgl2 or carrying ‘empty’ vector (EV) were used as positive and negative controls, respectively. Statistical analysis was done using Dunnett's multiple comparisons test. The error bars represent the standard deviation of five biological replicates. ****p<0.0001 vs. EV
[0245] E) The ribonucleolytic activity of the ageritin wild-type and mutated ageritin proteins was assessed by exposing ribosomes of rabbit reticulocyte lysate to 400 nM the respective purified His.sub.8-tagged protein. α-Sarcin and PBS buffer were used as positive and negative control, respectively. Ribosomal RNAs and ribotoxin cleavage product, α-fragment, were indicated.
[0246]
[0247] A) Heterologous expression and solubility of ageritin paralog in E. coli BL21. 20 μl of either bacterial whole cell extract (WCE), supernatants of WCE after low speed spin (LS; 5 min at 5000× g) or high speed spin (HS; 30 min at 16000× g) were loaded on a SDS-PAGE and stained with Coomassie brilliant blue.
[0248] B) Insecticidal activity of the ageritin paralog was tested against Ae. aegypti larvae by feeding the L3 staged mosquito larvae with E. coli BL21 expressing proteins of interests. Entomotoxic activity of the ageritin paralog against Ae. aegypti larvae. L3 mosquito larvae were fed E. coli BL21 bacteria expressing untagged and His.sub.8-tagged versions of the ageritin paralog. Bacteria either expressing the previously characterized entomotoxic protein Cgl2 or carrying the ‘empty’ vector (EV) were used as positive and negative controls, respectively. The error bars represent the standard deviation from three biological replicates.
[0249]
[0250] The amino acid sequence of ageritin was used as a query sequence for a BLAST search against the database of the Gene Catalog Proteins (GCP) at the JGI MycoCosm fungal database. The complete amino acid sequence of top 30 hits were aligned using the ClustalW (v2.1), and phylogenetic relationships among the sequences were depicted via a circular cladogram. The hit with the lowest homology to ageritin among those 30 hits had an E-value of 7.2E.sup.−16, an identity of 44.8%, and a subject coverage of 64.8%. The branch lengths are relative and not to scale. Maximum likelihood bootstrap support values are indicated next to each node, if the bootstrap support values exceeded 50%. Different potential ageritin homologs in the genome of a given species are labeled by numbers.
[0251]
[0252] AaeIMP1 (gene ID AAE3_02268), AaeTIF1 (gene ID AAE3_07769) and AaeARP1 (gene ID AAE3_11594) from the genome sequence of the dikaryon A. aegerita AAE-3 (Gupta et al., 2018), showing their transcription level by means of their Cq-values derived from quantitative real-time PCR analysis in a box-and-whisker-plot diagram. Whiskers indicate the variability outside the upper and lower quartile, respectively.
[0253]
[0254] A) Heterologous expression and solubility of ageritin and its His.sub.8-tagged version in E. coli BL21 cells. 20 μl of whole cell extract (WCE), supernatants of low speed spin (LS; 5 min. at 5000× g) and high speed spin (HS; 30 min. at 16000× g) of bacterial lysate were loaded on SDS-PAGE gel and stained with Coomassie brilliant blue. Cgl2 was used as a positive control for IPTG-induced expression and solubility analysis.
[0255] B) His.sub.8-ageritin was produced in E. coli BL21 and 20 μl of Ni-NTA purified protein loaded onto the SDS-PAGE along with 20 μl of WCE and stained with Coomassie brilliant blue.
[0256] C) Ageritin single-site mutant constructs were produced in E. coli BL21, 20 μL, of WCE, LS and HS of each bacterial lysate were loaded onto an SDS-PAGE and stained with Coomassie brilliant blue. D) 5 μl of purified protein (P) of each mutant ageritin version were loaded on a SDS-PAGE along with 20 μl of its WCE and stained with Coomassie brilliant blue.
[0257]
[0258] Potential nematotoxicity of ageritin was tested against five different bacterivorous nematodes species: Caenorhadbitis elegans, C. briggsae, C. tropicalis, Distolabrellus veechi and Pristionchus pacificus. IPTG-induced E. coli BL21 expressing previously characterized nematotoxic protein Cgl2 or carrying ‘empty’ vector (EV) were used as positive and negative control, respectively. Dunnett's multiple comparisons test was used for statistical analysis. The error bars represent the standard deviation of three biological replicates. Symbols/abbreviations: ns: not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. EV
EXAMPLES
Example
Materials and Methods
1. Strains and Cultivation Conditions
[0259] Cultivation and strain maintenance of A. aegerita AAE-3 was performed as described previously (Herzog et al., 2016). Escherichia coli strains DH5α and E. coli BL21 (DE3) were used for cloning and protein expression, respectively. Other organisms including microorganisms used in this study are listed in Table 4.
TABLE-US-00007 TABLE 4 Organisms used in this study. Name Strain Source/Reference Caenorhabditis AF16 Caenorhabditis Genetics Center (CGC) briggsae Caenorhabditis N2 Caenorhabditis Genetics Center (CGC) elegans Caenorhabditis JU1373 Caenorhabditis Genetics Center (CGC) tropicalis Distolabrellus environ- Luis Lugones, Utrecht University, veechi mental Netherlands isolate Pristionchus PS312 Iain Wilson, BOKU, Vienna, Austria pacificus Aedes aegypti Rockefeller Pie Müller, Swiss Tropical and Public Health Institute, Basel, Switzerland Agrocybe aegerita AAE-3 Florian Hennicke, Senckenberg BiK-F, Frankfurt a.M., Germany; genome- sequenced (Gupta et al., 2018) Escherichia coli DH5α Escherichia coli BL21(DE3) Novagen
2. Isolation of Total RNA from A. aegerita for Assessing Expression of AaeAGT1 and AaeAGT2
[0260] Fruiting induction for the sake of sampling different stages of fruiting body development of A. aegerita AAE-3 was performed as described by Herzog et al. (2016). In brief, 1.5% w/v malt extract agar (MEA) plates were inoculated centrally with a 0.5 cm diameter agar plug originating from the growing edge of an A. aegerita AAE-3 culture. Before fruiting induction (20° C., 12 h/12 h light/dark cycle, saturated humidity, aeration, local injury of the mycelium by punching out a 0.5 cm diameter mycelium-overgrown MEA plug), fungal plates were incubated for ten days at 25° C. in the dark.
[0261] Samples, consisting of at least three independent replicates, were retrieved from the following developmental stages: I) vegetative mycelium prior to fruiting induction at day ten post inoculation; II) fruiting-primed mycelium 24 h to 48 h before emergence of fruiting body initials at day 14 post inoculation; III) fruiting body initials at day 15 to 16 post inoculation; IV) fruiting body primordia at day 17 to the morning of day 19 post inoculation; Vs-Vc) young fruiting bodies separated into stipe (Vs) and cap (Vc) plectenchyme at day 19 to the morning of day 21 post inoculation. Mature fruiting bodies exhibiting full cap expansion and a spore print emerging by morning of day 22 post inoculation were not sampled. Sample I) and II) were obtained by gently scraping off the outermost 1 cm of mycelium from three replicate agar plates by gently scraping with a sterile spatula. Samples were transferred immediately to a 2 mL microcentrifuge tube containing 1 mL of RNAlater® (product ID: R0901, Sigma Aldrich GmbH, Munich, Germany) which was transferred to 4° C. for a maximum of 3 days before freezing at −80° C. until total RNA extraction.
[0262] For total RNA extraction, NucleoSpin® RNA Plant kit (product ID: 740949, Macherey-Nagel GmbH & Co. KG, Düren, Germany) was used whereby cell homogenization and lysis were modified. First, the RNAlater® was removed from each pooled sample and an appropriate amount of lysis Buffer RA1 added (350 μl per 100 mg fungal biomass). One 4 mm- and about ten 1 mm-diameter acetone-cleaned stainless-steel beads (product IDs: G40 and G10, respectively, KRS-Trading GmbH, Barchfeld-Immelborn, Germany) were then added to each tube. Homogenization was achieved using a mixer mill MM 200 (Retsch, Haan, Germany) set to 8 min at 25 Hz. Then, the protocol followed the recommendations of the manufacturer for RNA-extraction from filamentous fungi, including a DNA digestion step with the kit's rDNase, beginning with the “filtrate lysate” step.
[0263] Total RNA was eluted in nuclease-free water (product ID: T143, Carl Roth GmbH & Co. KG, Karlsruhe, Germany) and the RNA concentration was measured spectrophotometrically with a NanoDrop 2000 c (Thermo Fisher Scientific, Waltham, USA). RNA quality was visually assessed by checking the integrity of the major rRNA bands in a denaturing polyacrylamide gel (Urea-PAGE). Per lane, 1 μg of total RNA was loaded onto pre-cast Tris-borate-EDTA (TBE)-urea 6% polyacrylamide gels (product ID: EC68652BOX, Thermo Fischer Scientific, Waltham, USA) and separated for 1 h at a constant voltage of 180V. For detection, SYBR™ Gold (product ID: S11494, Thermo Fisher Scientific) was used to stain the gel following the manufacturer's recommendations. Only if no degradation of the RNA was observed, with major rRNA bands intact, the respective sample was further processed. Total RNAs were routinely stored at −80° C.
3. Determination of Suitable Reference Genes for Quantitative Real-Time Reverse Transcription-PCR
[0264] Primer pairs for A. aegerita AAE-3 genes AaeIMP1 (gene ID AAE3_02268), AaeTIF1 (gene ID AAE3_07769) and AaeARP1 (gene ID AAE3_11594) have been designed manually on the basis of their genomic DNA (Gupta et al., 2018). In each case, the gene name was assigned in accordance with the name of the putative encoded protein according to the UniProt database (www.uniprot.org). Each primer pair (Table 5, see below) spans a cDNA nucleotide region of 150 bp. Twelve reference samples were taken from vegetative mycelia grown for 10, 14, 18, 20, 22, 24 and 27 days on agar plates, from a primordia source of 18 day old cultures, and from fruiting bodies before (two samplings on different days from young fruiting bodies), during (one sampling) and after sporulation (one sampling). The samples were stored in RNAlater® (product ID: 76104, Qiagen, Venlo, Netherlands). Total RNA was extracted using TRIzol (Thermo Fischer Scientific) by the method of Chomczynski and Sacchi (1987). The RNA concentration was determined by the absorbance at 260 nm using a Pearl Nanophotometer (Implen, Munich, Germany). 2 μg total RNA of each sample was reverse transcribed applying the M-MLV reverse transcriptase kit according to the manufacturer's protocol (Thermo Fischer Scientific) using oligo-(dT).sub.30-Primer. The resulting cDNA sample was incubated for 20 min at 37° C. with 1 μL AMRESCO RNase A (VWR International, Radnor, Pa., USA) instead of the RNase H described in the M-MLV reverse transcriptase kit protocol. Quantitative real-time polymerase chain reaction was conducted in triplicates using the KAPA SYBR® FAST Universal Kit (Sigma Aldrich GmbH) according to the manufacturer's protocol with an annealing step at 60° C. for 30 sec, an elongation step at 72° C. for 10 sec in a total volume of 25 μL with a final concentration of 0.9 μM for each primer and 7 μL of cDNA template on a CFX connect Real-Time Detection System (Bio-Rad, Hercules, Calif., USA).
[0265] To test primer efficiency, equal aliquots from each cDNA template were combined. Six logarithmic dilution steps of the cDNA master mix were used for qPCR (see above). Cq-values of the dilutions were blotted versus the dilution factor and linear regression as well as the corresponding determination coefficient was calculated for each reference gene. The primer efficiency was calculated according to Pfaffl (2001). For validation of the reference genes, all 12 cDNA samples were used separately for a quantitative real-time PCR analysis with all three primer pairs. Cq-values were used for validation using the NormFinder (Andersen et al., 2004) and geNorm (Vandesompele et al., 2002) algorithm.
4. One-Step Quantitative Real-Time Reverse Transcription-PCR (qRT-PCR) Using Total RNA Samples
[0266] Primers and qRT-PCR conditions were designed according to the general recommendations of the MIQE guidelines (Bustin et al., 2009). The software Geneious R11 (https://www.geneious.com, Kearse et al. (2012) was applied to design the primers for the genes encoding ageritin (AaeAGT1, gene ID AAE3_01767) and its paralog (AaeAGT2, gene ID AAE3_01768) as well as the two reference genes AaeTIF1 (gene ID AAE3_07669) and AaeIMP1 (gene ID AAE3_02268) from the A. aegerita AAE-3 genome sequence (Gupta et al., 2018; see also www.thines-lab.senckenberg.de/agrocybe_genome). Primers for these genes are also listed in Table 5.
[0267] All qRT-PCRs were performed on an AriaMX Real-Time PCR System (Agilent Technologies, La Jolla, Calif., USA) in optically clear 96-well plates with 8-cap strips using the Brilliant Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent Technologies). This one-step master mix included the reverse transcriptase (RT), the reaction buffer, the DNA polymerase and SYBR green. The RT-reaction was performed in each well prior to the start of the qRT-PCR program. All samples were run in three biological replicates with 25 ng total RNA per reaction mixture. The final concentration per primer was 250 nM. A melting curve analysis was done for each reaction at the end of the qRT-PCR to determine amplicon purity. See Table 6 for the qRT-PCR program.
TABLE-US-00008 TABLE 5 Primers used in this study. SEQ Primer.sup.a Sequence 5′-3′.sup.b ID NO. pAGT1-Nd ggcgcatATGTCCGAGTCCTCTACCTTCACCACTGC 5 pAGT1-N gtgcggccgcTCACGCCGGAGCCTTGCCC 6 pF_8His-Ag CACCACCACCACGAGTCCTCTACCTTCACCACTG 7 pR_8His-Ag ATGATGATGATGGGACATATGTATATCTCCTTCT 8 HAgP-FW ggggggcatATGAGCCATCATCATCATCACCACCACC 33 ACGACCCGAGCGCGCCGGG AgP-RV ggggggctcgagtgcggccgcTTACGCCGGCGCTTTG 34 pF_8His-Ag(Y57A) AAGTTGGTCACGGCCACCAGCCGCC 9 pR_8His-Ag(Y57A) GGTcrrATcAATTTTGTccrrccccG 10 pF_8His-Ag(R87A) GTCGCGCTCGACATGGACAACACC 11 pR_8His-Ag(R87A) GTAGGGCACGATGGAGCCCGCGGC 12 pF_8His-Ag(D89A) TGCCCTACGTCCGGCTCGCCATGG 13 pR_8His-Ag(D89A) CGATGGAGCCCGCGGCCGTTTTGA 14 pF_8His-Ag(D91A) GTCCGGCTCGACATGGCCAACACC 15 pR_8His-Ag(D91A) GTAGGGCACGATGGAGCCCGCGGC 16 pF_8His-Ag(H98A) GGCAAGGGCATCGCTTTCAA 17 pR_8His-Ag(H98A) GGTGTTGTCCATGTCGAGCC 18 pF_8His-Ag(K110A) AGTTCCGCCGCGCTCGCCG 19 pR_8His-Ag(K110A) GTCGGAGAGTTTAGTCGCGTTGAAA 20 cds017674 TTCTTTTCGCTACTCAGAATCGTTG 21 cds01767-r CAGAGCTCTCCCAACCACAG 22 02268_f AGATGCGTATTCTGATGGTTGGTC 23 02268_r CCCACACTGTGAATGAGATGTTC 24 07769_f ATTCCTACGATCCTTTTGCCG 25 07769_r GATcATATTGrrTcGGGAGTccT 26 11594_f TCTGATCTGACTGTCGGCCAA 27 11594_r ATCCTCGTCCTTATGCTCCTC 28 01767_f AAGCCCCGCATATCAGAAG 29 01767_r CTGTCGGAGAGTTTAGTCGC 30 01768_f GAAAGACCCAGATTGACCCAG 31 01768_f GTGAATTTTAGGCCGACGC 32 .sup.aPrimers used for quantitative real-time PCR procedures are labelled with forward (f) and reverse (r), respectively. Primers for cDNA generation start by coding sequence (cds) and end by forward (fw) or reverse (rv). .sup.bLowercase letters are primer extensions to create the underlined restriction sites.
TABLE-US-00009 TABLE 6 qRT-PCR program for measuring AaeAGT1 and AaeAGT2 expression in this study. Programme step Temperature Time Reverse transcription 50° C. 10 min Initial denaturation (hot start) 95° C. 3 min 40 cycles Denaturation 95° C. 5 sec Annealing 58° C. 10 sec Extension 72° C. 10 sec Melting curve 65° C. to 95° C. 5 min (resolution 0.5° C.)
5. Relative Differential Expression Analysis
[0268] Data analysis was based on Cq values calculated from raw fluorescence intensities. The baseline correction and determination of the quantification cycle (Cq) and mean PCR efficiency (E) per amplicon was done according to Ruijter et al. (2009) using the LinRegPCR program in version 2017.1.
[0269] Relative expression ratios were calculated using the software REST, version REST2009 (Pfaffl et al. 2002). It employs the ‘Pfaffl method’ (Pfaffl, 2001) to calculate the E corrected relative gene expressions ratios, allowing for the simultaneous use of multiple reference genes for normalization based on Vandesompele et al. (2002). 95% confidence intervals around the mean relative expression ratios were calculated on the basis of 2,000 iterations. Vegetative mycelium that was not induced for fruiting (developmental stage I) was chosen as calibration sample.
6. cDNA Generation from A. aegerita RNA
[0270] The cDNA was synthetized from total RNA of fruiting-primed mycelium using the RevertAid first strand cDNA synthesis kit (product ID: K1621, Thermo Fisher Scientific) and an oligo(dT).sub.18 primers. First strand total-cDNA was then directly used as a template to produce the specific cDNA of the ageritin-encoding gene AaeAGT1 (gene ID AAE3_01767) with primer pair cds01767-f and cds01767-r (see Table 5) in a standard 3-step PCR using Phusion polymerase (product ID: F530, Thermo Fischer Scientific) with a annealing temperature of 62° C. DNA sequence information for primer design was obtained from the genome sequence of A. aegerita AAE-3 (Gupta et al., 2018).
TABLE-US-00010 verified cDNA sequence of gene AaeAGT1, gene ID AAE3_01767: SEQ ID NO. 2 atgtccgagtcctctaccttcaccactgcggtagtacctgaaggcgaa ggagttgctccaatggcagagaccgtgcagtattacaactcctactct gacgcatccatcgcgtcttgcgcatttgtagactcggggaaggacaaa attgataagaccaagttggtcacgtacaccagccgcctcgccgcaagc cccgcatatcagaaggtcgtcggcgtcggcctcaaaacggccgcgggc tccatcgtgccctacgtccggctcgacatggacaacaccggcaagggc atccatttcaacgcgactaaactctccgacagttccgccaagctcgcc gcggtgctcaagacgacggtgtccatgaccgaggcacagcgaactcaa ctctacatggagtatatcaagggcatcgagaatcggagtgcgcagttt atttgggactggtggaggacgggcaaggctccggcgtga
7. Construction of Ageritin Expression Vectors
[0271] The coding sequence of ageritin was identified by BLAST analysis using the published 25 N-terminal residues of ageritin against the predicted proteome of Agrocybe aegerita (Gupta et al., 2018). The sequence was amplified with the primer pair pAGT1-Nd and pAGT1-N (see Table 5) from the AaeAGT1-cDNA and cloned into a pET-24b (+) expression vector. The sequence of the cloned cDNA was confirmed by DNA sequencing. The plasmid was transformed into E. coli BL21 cells. For expression of ageritin, E. coli BL21-transformants were pre-cultivated in Luria-Bertani (LB) medium supplemented with 50 mg/1 kanamycin at 37° C. At an OD.sub.600 of around 0.5, the cells were induced with 0.5 mM isopropyl ↑-D-1-thiogalactopyranoside (IPTG) (product ID: I8000, BioSynth AG, Switzerland) and cultivated over night at 16° C. Expression and solubility of ageritin was checked as previously described (Künzler et al., 2010).
8. Toxicity Against Mosquito Larvae and Nematodes
[0272] Egg masses of the yellow fever mosquito, Aedes aegypti, were harvested on filter papers from the Rockefeller laboratory colony reared at the Swiss Tropical and Public Health Institute (Basel, Switzerland). For the experiments, mosquito larvae were reared by placing 2- to 5-cm.sup.2 small pieces of the egg paper, depending on the density of the eggs, into glass petri dishes containing tap water at 28° C. The larvae hatched within a few hours. They were fed with finely ground commercially available food for ornamental fish.
[0273] The toxicity assays against the mosquito larvae were performed as described previously (Künzler et al., 2010). In brief, larvae in their third stage (L3) were used for the toxicity assays. The food source was changed from fish food to E. coli, adjusted in all the bioassays to an OD.sub.600 of 0.4. The mosquito larvae fed readily on E. coli and were able to develop to the adult stage. The consumption of E. coli bacteria carrying the empty vector by the mosquito larvae could be tracked by the reduction in the optical density. The bioassay was performed by transferring ten L3 larvae to Schott bottles containing 99 mL of tap water and 1 ml of E. coli cells expressing the desired protein. The mosquito larvae were kept in the dark at 28° C. and the toxicity was assessed by the larval mortality over the first four days and by the reduction in optical density. In addition, the number of adult mosquitoes, which were able to develop from the larvae, was counted after 7 days. The previously characterized entomo- and nematotoxic lectin Cgl2 was used as a positive control in all toxicity assays (Bleuler-Martinez et al., 2011). Starvation controls were used to check whether the death of the larvae is due to toxicity or refrainment of the larvae from consuming the bacteria. Nematotoxicity assays against five different species of nematodes were performed as described before (Künzler et al., 2010; Plaza et al., 2016). Dunnett's multiple comparisons test was used to calculate the statistical differences between mean values of treatment and control groups.
9. Tagging and Purification of Ageritin
[0274] For the purification of recombinant ageritin over Ni-NTA columns (Macherey-Nagel), the protein was tagged with a polyhistidine(His.sub.8)-tag at its N-terminus. A plasmid was constructed by PCR using pF_8His-Ag and pR_8His-Ag primer pair listed in Table 5. His.sub.8-ageritin was expressed as described for untagged ageritin. Protein purification was performed as described previously (Bleuler-Martinez et al., 2011) but by using Tris-HCl, pH 7.5, as the lysis, purification, and storage buffer.
10. In Vitro rRNA Cleavage Assay
[0275] To detect the rRNA cleavage activity, 20 μL of untreated rabbit reticulate lysate (product ID: L4151, Promega, Wis., USA) was mixed with a final concentration of 400 nM ageritin or with the mutant versions in the reaction buffer (15 mM Tris-HCl, 15 mM NaCl, 50 mM KCl, 2.5 mM EDTA. pH 7.6) to a final volume of 30 μL (Kao et al., 2001). The reaction mixture was incubated for one hour at 30° C., and stopped by adding 3 μL of 10% SDS. RNA was isolated from the reaction mixture by chloroform-phenol extraction. The RNAs were mixed with 2× RNA loading dye (Thermo Fisher Scientific) and denatured for 5 minutes at 65° C., cooled on wet ice and run on 2% native agarose gel in cold TBE Buffer (Tris-borate-EDTA) for 30 minutes at 100 V. α-Sarcin (product ID: BCO-5005-1, Axxora, USA) and phosphate-buffered saline (PBS) buffer were used as positive and negative control, respectively.
11. Toxicity Towards Insect Cells
[0276] Cytotoxicity of ageritin was tested against the insect cell line of Spodoptera frugiperda Sf21 (IPLB-Sf21-AE). The insect cells were pre-cultivated in Sf-900TM II serum-free medium (SFM; Invitrogen, Calif., USA) supplemented with streptomycin (100 μg/mL) and penicillin (100 μg/mL). Cells were diluted to a final density of 0.29×10.sup.6/mL and 500 μL of per well were dispensed in 24-well plates. The insect cells were challenged with different concentrations of ageritin (0.1 μM, 1 μM and 10 μM) dissolved in PBS. The well plates were incubated for three days at 27° C. The liquid medium was removed, and the cells were stained with 15 μl of 0.4% trypan blue solution. The number of alive and thus unstained cells was determined under a microscope. α-Sarcin (Axxora) and 5% DMSO were used as positive controls whereas the PBS buffer served as a negative control. Dunnett's multiple comparisons test was used to test whether the observed differences between the mean values of the treatment and control groups are statistically significant.
12. Alignment and Phylogenetic Tree
[0277] The complete amino acid sequence of ageritin was used as a query in a BLAST search against the database of the Gene Catalog Proteins (GCP) at JGI MycoCosm (Grigoriev et al., 2014). The hit regions of the top ten sequences with highest homology were aligned using the ClustalW algorithm (v2.1) at CLC Genomics Workbench (Chenna et al., 2003).
[0278] For the analysis of the phylogenetic relationship among the top homologs of ageritin, the complete amino acid sequences of 30 hits were aligned using ClustalW (v2.1). A phylogenetic tree was constructed employing the Maximum Likelihood algorithm (Aldrich, 1997). The tree was designed as a rooted circular cladogram. The hit with the lowest homology to ageritin among the 30 hits had an E-value of 7.2E-16.
13. Creation and Expression of Mutant Versions
[0279] Based on the alignment, six of the completely conserved residues (Y57, R87, D89, D91, H98 and K110) of ageritin were mutated individually to alanine using the site-specific primers listed in Table 5. The plasmid encoding His.sub.8-ageritin was used as template for construction of single-site mutants. Expression and purification of the mutant ageritin variants were done as for wild type His.sub.8-ageritin.
14. Expression and Purification of Ageritin Paralog
[0280] The predicted coding sequence for the paralog of ageritin (63% sequence identity) was ordered in a codon-optimized version (for E. coli) from GenScript (Piscataway, N.J., USA). Expression and purification of the paralogous protein was done as described above for for wild-type His.sub.8-ageritin.
[0281] The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.
REFERENCES
[0282] Aldrich J: R. A. Fisher and the making of maximum likelihood 1912-1922. Stat Sci 1997, 12(3):162-176.
[0283] Andersen C L, Jensen J L, Orntoft T F: Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004, 64(15):5245-5250.
[0284] Barzon L. Ongoing and emerging arbovirus threats in Europe. J Clin Virol. 2018 October; 107:38-47. doi: 10.1016/j.jcv.2018.08.007.
[0285] Berry et al. Complete sequence and organization of pBtoxis, the toxin-coding plasmid of Bacillus thuringiensis subsp. israelensis. Appl Environ Microbiol. 2002; 68:5082-95.
[0286] Bleuler-Martinez S, Butschi A, Garbani M, Walti M A, Wohlschlager T, Potthoff E, Sabotic J, Pohleven J, Luthy P, Hengartner M O et al: A lectin-mediated resistance of higher fungi against predators and parasites. Mol Ecol 2011, 20(14):3056-3070.
[0287] Bolognesi A, Bortolotti M, Maiello S, Battelli M G, Polito L: Ribosome-Inactivating Proteins from Plants: A Historical Overview. Molecules 2016, 21(12).
[0288] Bustin S A, Benes V, Garson J A, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl M W, Shipley G L et al: The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin Chem 2009, 55(4):611-622.
[0289] Cantón P E, Zanicthe Reyes E Z, Ruiz de Escudero I, Bravo A, Soberón M. Binding of Bacillus thuringiensis subsp. israelensis Cry4Ba to Cyt1Aa has an important role in synergism. Peptides. 2011 March; 32(3):595-600. doi: 10.1016/j.peptides.2010.06.005. Epub 2010 Jun. 15.
[0290] Cadavid-Restrepo G, Sahaza J, Orduz S. Treatment of an Aedes aegypti colony with the Cry11Aa toxin for 54 generations results in the development of resistance. Mem Inst Oswaldo Cruz. 2012 February; 107(1):74-9.
[0291] Chan Y L, Endo Y, Wool I G: The Sequence of the Nucleotides at the Alpha-Sarcin Cleavage Site in Rat 28-S Ribosomal Ribonucleic-Acid. J Biol Chem 1983, 258(21):2768-2770.
[0292] Cheng et al., 2004, Chemical composition and mosquito larvicidal activity of essential oils from leaves of different Cinnamomum osmophloeum provenances. J Agric Food Chem 52:4395-4400.
[0293] Cheng et al., 2009, Insecticidal activities of leaf essential oils from Cinnamomum osmophloeum against three mosquito species. Bioresour Technol. 100:457-464.
[0294] Chenna R, Sugawara H, Koike T, Lopez R, Gibson T J, Higgins D G, Thompson J D: Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Research 2003, 31(13):3497-3500.
[0295] Chomczynski P, Sacchi N: Single-Step Method of Rna Isolation by Acid Guanidinium Thiocyanate Phenol Chloroform Extraction. Anal Biochem 1987, 162(1):156-159.
[0296] Cloonan K R, Andreadis S S, Chen H, Jenkins N E, Baker T C. Attraction, Oviposition and Larval Survival of the Fungus Gnat, Lycoriella ingenua, on Fungal Species Isolated from Adults, Larvae, and Mushroom Compost. PLoS One. 2016 Dec. 9; 11(12):e0167074. doi: 10.1371/journal.pone.0167074. eCollection 2016.
[0297] Correll C C, Munishkin A, Chan Y L, Ren Z, Wool I G, Steitz T A: Crystal structure of the ribosomal RNA domain essential for binding elongation factors. P Natl Acad Sci USA 1998, 95(23): 13436-13441.
[0298] Endo Y, Tsurugi K, Yutsudo T, Takeda Y, Ogasawara T, Igarashi K: Site of action of a Vero toxin (VT2) from Escherichia coli 0157:H7 and of Shiga toxin on eukaryotic ribosomes. RNA N-glycosidase activity of the toxins. Eur J Biochem 1988, 171(1-2):45-50.
[0299] Gupta D K, Rühl M, Mishra B, Kleofas V, Hofrichter M, Herzog R, Pecyna M J, Sharma R, Kellner H, Hennicke F et al: The genome sequence of the commercially cultivated mushroom Agrocybe aegerita reveals a conserved repertoire of fruiting-related genes and a versatile suite of biopolymer-degrading enzymes. Bmc Genomics 2018, 19.
[0300] Grigoriev I V, Nikitin R, Haridas S, Kuo A, Ohm R, Otillar R, Riley R, Salamov A, Zhao X L, Korzeniewski F et al: MycoCosm portal: gearing up for 1000 fungal genomes. Nucleic Acids Research 2014, 42(D1):D699-D704.
[0301] Herrero-Galan E, Lacadena J, del Pozo A M, Boucias D G, Olmo N, Onaderra M, Gavilanes J G: The insecticidal protein hirsutellin A from the mite fungal pathogen Hirsutella thompsonii is a ribotoxin. Proteins 2008, 72(1):217-228.
[0302] Herrero-Galán E, Álvarez-García E, Carreras-Sangrà N, Lacadena J, Alegre-Cebollada J, Martínez del Pozo Á, Oñaderra M, Gavilanes J G: Fungal ribotoxins: structure, function and evolution. In: Microbial Toxins: Current Research and Future Trends. 2009: 167-187.
[0303] Herrero-Galán E, García-Ortega L, Lacadena J, Martínez-Del-Pozo Á, Olmo N, Gavilanes J G, Oñaderra M: Implication of an Asp residue in the ribonucleolytic activity of hirsutellin A reveals new electrostatic interactions at the active site of ribotoxins. Biochimie 2012, 94:427-433.
[0304] Herrero-Galán E, García-Ortega L, Olombrada M, Lacadena J, Del Pozo Á M, Gavilanes J G, Oñaderra M: Hirsutellin A: A Paradigmatic Example of the Insecticidal Function of Fungal Ribotoxins. Insects 2013, 4:339-356.
[0305] Herzog R, Solovyeva I, Ruhl M, Thines M, Hennicke F: Dikaryotic fruiting body development in a single dikaryon of Agrocybe aegerita and the spectrum of monokaryotic fruiting types in its monokaryotic progeny. Mycol Prog 2016, 15(9):947-957.
[0306] Kampen H, Schuhbauer A, Walther D: Emerging mosquito species in Germany-a synopsis after 6 years of mosquito monitoring (2011-2016). Parasitol Res 2017, 116(12):3253-3263.
[0307] Kao R, Martínez-Ruiz A, Del Pozo A M, Crameri R, Davies J: Mitogillin and related fungal ribotoxins. Methods in Enzymology 2001, 341:324-335.
[0308] Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C et al: Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28(12): 1647-1649.
[0309] Künzler M, Bleuler-Martinez S, Butschi A, Garbani M, Lüthy P, Hengartner M O, Aebi M: Biotoxicity assays for fruiting body lectins and other cytoplasmic proteins. 2010, 480:141-150.
[0310] Lacadena J, del Pozo A M, Martinez-Ruiz A, Perez-Canadillas J M, Bruix M, Mancheno J M, Onaderra M, Gavilanes C G: Role of histidine-50, glutamic acid-96, and histidine-137 in the ribonucleolytic mechanism of the ribotoxin alpha-sarcin. Proteins-Structure Function and Genetics 1999, 37(3):474-484.
[0311] Lacadena J, Alvarez-Garcia E, Carreras-Sangra N, Herrero-Galan E, Alegre-Cebollada J, Garcia-Ortega L, Onaderra M, Gavilanes J G, del Pozo A M: Fungal ribotoxins: molecular dissection of a family of natural killers. Fems Microbiol Rev 2007, 31(2):212-237.
[0312] Landi N, Pacifico S, Ragucci S, Iglesias R, Piccolella S, Amici A, Di Giuseppe A M A, Di Maro A: Purification, characterization and cytotoxicity assessment of Ageritin: The first ribotoxin from the basidiomycete mushroom Agrocybe aegerita. Biochimica et Biophysica Acta-General Subjects 2017, 1861:1113-1121.
[0313] Olombrada M, Herrero-Galán E, Tello D, Oñaderra M, Gavilanes J G, Martínez-Del-Pozo Á, García-Ortega L: Fungal extracellular ribotoxins as insecticidal agents. Insect Biochem Mol Biol 2013, 43 39-46.
[0314] Olombrada M, Martínez-Del-Pozo Á, Medina P, Budia F, Gavilanes J G, García-Ortega L: Fungal ribotoxins: Natural protein-based weapons against insects. Toxicon 2014, 83:69-74.
[0315] Olombrada M, Medina P, Budia F, Gavilanes J G, Martinez-Del-Pozo A, Garcia-Ortega L: Characterization of a new toxin from the entomopathogenic fungus Metarhizium anisopliae: the ribotoxin anisoplin. Biol Chem 2017, 398(1):135-142.
[0316] Olombrada M, Lázaro-Gorines R, López-Rodríguez J, Martínez-del-Pozo Á, Oñaderra M, Maestro-López M, Lacadena J, Gavilanes J, García-Ortega L: Fungal Ribotoxins: A Review of Potential Biotechnological Applications. Toxins 2017, 9:71.
[0317] Plaza D F, Schmieder S S, Lipzen A, Lindquist E, Künzler M: Identification of a Novel Nematotoxic Protein by Challenging the Model Mushroom Coprinopsis cinerea with a Fungivorous Nematode. Genes|Genomes|Genetics 2016, 6:87-98.
[0318] Perez-Canadillas J M, Santoro J, Campos-Olivas R, Lacadena J, del Pozo A M, Gavilanes J G, Rico M, Bruix M: The highly refined solution structure of the cytotoxic ribonuclease alpha-sarcin reveals the structural requirements for substrate recognition and ribonucleolytic activity. Journal of Molecular Biology 2000, 299(4):1061-1073.
[0319] Pfaffl M W: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 2001, 29(9).
[0320] Pfaffl M W, Horgan G W, Dempfle L: Relative expression software tool (REST (c)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research 2002, 30(9).
[0321] Ruijter J M, Ramakers C, Hoogaars W M H, Karlen Y, Bakker O, van den Hoff M J B, Moorman A F M: Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Research 2009, 37(6).
[0322] Sawa T, Hamaoka S, Kinoshita M, Kainuma A, Naito Y, Akiyama K, Kato H: Pseudomonas aeruginosa Type III Secretory Toxin ExoU and Its Predicted Homologs. Toxins 2016, 8(11).
[0323] Suter T, Crespo M M, de Oliveira M F, Alves de Oliveira M A, Varjal de Melo-Santos C M, Fontes de Oliveira C M, Junqueira Ayres C F, Rodrigues Barbosa R M, Araújo A P, Regis L N, Flacio E, Engeler L, Müller P, Neves Lobo Silva-Filha M H: Insecticide susceptibility of Aedes albopictus and Ae. aegypti from Brazil and the Swiss-Italian border region. Parasites & Vectors 2017, 10:431.
[0324] Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biology 2002, 3(7).
[0325] Weeks E N, Baniszewski J, Gezan S A, Allan S A, Cuda J P, Stevens B R. Methionine as a safe and effective novel biorational mosquito larvicide. Pest Manag Sci. 2018 Jun. 11. doi: 10.1002/ps.5118.
[0326] Yang X J, Moffat K: Insights into specificity of cleavage and mechanism of cell entry from the crystal structure of the highly specific Aspergillus ribotoxin, restrictocin. Structure 1996, 4(7):837-852.
[0327] Yao Q Z, Yu M M, Ooi L S M, Ng T B, Chang S T, Sun S S M, Ooi V E C: Isolation and characterization of a type 1 ribosome-inactivating protein from fruiting bodies of the edible mushroom (Volvariella volvacea). J Agr Food Chem 1998, 46(2):788-792.