Means and methods for the enzymatic production of L-methionine from O-phospho-L-homoserine and methanethiol

Abstract

Provided is a method for producing L-methionine in which O-phospho-L-homoserine and methanethiol are enzymatically converted into L-methionine and H3PO4. Such a conversion is achieved by an enzyme called O-phospho-L-homoserine (OHPS) dependent methionine synthase. Also described are O-phospho-L-homoserine (OHPS) dependent methionine synthases, i.e. proteins which are able to enzymatically convert O-phospho-L-homoserine and methanethiol into L-methionine and H3PO4 as well as microorganisms which have been genetically modified so as to be able to produce L-methionine from O-phospho-L-homoserine and methanethiol. Furthermore described are methods to screen for enzymes that catalyze the conversion of O-phospho-L-homoserine and methanethiol into L-methionine and H.sub.3PO.sub.4.

Claims

1. A method for producing L-methionine, comprising enzymatically converting O-phospho-L-homoserine (OPHS) and methanethiol into L-methionine and H.sub.3PO.sub.4 according to the following reaction scheme:
O-phospho-L-homoserine+CH.sub.3.SH<=>L-methionine+H.sub.3PO.sub.4; wherein the enzymatic conversion is achieved by a OPHS dependent methionine synthase that is a protein derived from a cystathionine gamma synthase (EC 2.5.1.48) by mutation; and the OPHS dependent methionine synthase is a protein selected from the group consisting of: (a) a protein comprising the amino acid sequence as shown in any one of SEQ ID NOs: 6 to 29; and (b) a protein having a sequence identity of at least 90% to any one of SEQ ID NOs: 6 to 29 and having the enzymatic activity of converting O-phospho-L-homoserine and methanethiol into L-methionine and H.sub.3PO.sub.4.

2. The method of claim 1, which is carried out in vitro.

3. The method of claim 1, wherein the method is carried out by making use of a microorganism producing the OPHS dependent methionine synthase.

4. A method comprising enzymatically converting O-phospho-L-homoserine and methanethiol into L-methionine and H.sub.3PO.sub.4 via a protein that is: (I) a cystathionine γ synthase having the amino acid sequence shown in SEQ ID NO: 3 by substitution or deletion of at least one amino acid residue in SEQ ID NO: 3 selected from the group consisting of: (a) proline 10; (b) asparagine 11; (c) glutamine 15; (d) isoleucine 27; (e) alanine 30; (f) leucine 45; (g) serine 47; (h) valine 60; (i) alanine 68; (j) phenylalanine 150; (k) threonine 178; (l) aspartate 183; (m) isoleucine 185; (n) threonine 220; (o) methionine 232; (p) valine 245; (q) alanine 257; (r) asparagine 259; (s) phenylalanine 261; (t) phenylalanine 275; (u) isoleucine 287; (v) histidine 289; (w) tyrosine 324; (x) glycine 326; (y) proline 356; (z) threonine 371; (aa) valine 396; (bb) proline 405; (cc) aspartate 431; (dd) isoleucine 436; (ee) isoleucine 457; (ff) aspartate 459; (gg) proline 470; (hh) glutamate 472; (ii) alanine 506; and (jj) isoleucine 507; or (II) a cystathionine gamma synthase, the amino acid sequence of which has at least 90% sequence identity to the amino acid sequence shown in SEQ ID NO: 3, by substitution or deletion of at least one amino acid residue corresponding to any one of (a) to (jj) listed above in SEQ ID NO: 3; or (III) the cystathionine gamma synthase of (I) or (II) by deletion of one or more N-terminal amino acids corresponding to amino acids 1 to 103 of the amino acid sequence as shown in SEQ ID NO: 3, wherein substitution or deletion of at least one amino acid residue is present.

5. The method of claim 4, wherein said protein is selected from the group consisting of: (a) a protein comprising the amino acid sequence as shown in any one of SEQ ID NOs: 6 to 29; and (b) a protein having a sequence identity of at least 90% to any one of SEQ ID NOs: 6 to 29 and having the enzymatic activity of converting O-phospho-L-homoserine and methanethiol into L-methionine and H.sub.3PO.sub.4.

6. The method of claim 5, wherein said protein has a sequence identity of at least 90% to any one of SEQ ID NOs: 6 to 29 and has the enzymatic activity of converting O-phospho-L-homoserine and methanethiol into L-methionine and H.sub.3PO.sub.4.

7. A protein having the enzymatic activity of converting O-phospho-L-homoserine and methanethiol into L-methionine and H.sub.3PO.sub.4, wherein the protein is (I) a cystathionine gamma synthase having the amino acid sequence shown in SEQ ID NO: 3 by substitution or deletion of at least one amino acid residue in SEQ ID NO: 3 selected from the group consisting of: (a) proline 10; (b) asparagine 11; (c) glutamine 15; (d) isoleucine 27; (e) alanine 30; (f) leucine 45; (g) serine 47; (h) valine 60; (i) alanine 68; (j) phenylalanine 150; (k) threonine 178; (I) aspartate 183; (m) isoleucine 185; (n) threonine 220; (o) methionine 232; (p) valine 245; (q) alanine 257; (r) asparagine 259; (s) phenylalanine 261; (t) phenylalanine 275; (u) isoleucine 287; (v) histidine 289; (w) tyrosine 324; (x) glycine 326; (y) proline 356; (z) threonine 371; (aa) valine 396; (bb) proline 405; (cc) aspartate 431; (dd) isoleucine 436; (ee) isoleucine 457; (ff) aspartate 459; (gg) proline 470; (hh) glutamate 472; (ii) alanine 506; and (jj) isoleucine 507; or (II) a cystathionine gamma synthase, the amino acid sequence of which has at least 90% sequence identity to the amino acid sequence shown in SEQ ID NO: 3, by substitution or deletion of at least one amino acid residue corresponding to any one of (a) to (jj) listed above in SEQ ID NO: 3; or (III) the cystathionine gamma synthase of (i) or (ii) by deletion of one or more N-terminal amino acids corresponding to amino acids 1 to 103 of the amino acid sequence as shown in SEQ ID NO: 3, wherein substitution or deletion of at least one amino acid residue is present.

8. The protein of claim 7, which also shows the enzymatic activity of converting O-phospho-L-homoserine and sulfide into L-homocysteine+H.sub.3PO.sub.4.

9. A method for the production of S-adenosyl methionine comprising producing L-methionine according to the method of claim 1 and converting the L-methionine into S-adenosyl methionine.

10. A method for the production of cysteine comprising producing L-methionine according to the method of claim 1 and converting the L-methionine into cysteine.

11. A method for the production of glutathione comprising producing L-methionine according to the method of claim 1 and converting the L-methionine into glutathione.

12. A method for the production of 2-oxo-4-methylthiobutanoate comprising producing L-methionine according to the method of claim 1 and converting the L-methionine into 2-oxo-4-methylthio butanoate.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows a simplified view of the methionine biosynthesis pathway in S. cerevisiae (taken from: Thomas D. and Y. Surdin-Kerjan; Microbiological and Molecular Reviews 61 (1997); Metabolism of sulfur amino-acids in Saccharomyces cerevisiae., page 503-532).

(2) FIG. 2 shows a chemical pathway for the synthesis of O-phospho-L-homoserine.

(3) FIG. 3 shows a schematic representation of the truncated forms of CGS1 used as starting material for creating mutated versions of the enzyme.

(4) FIG. 4 shows growth of strains YA246-4A expressing either the AD242 or the AD328 CGS1 variant or carrying the control vector pAL06 in medium A supplemented with methionine 0.05 mM

(5) FIG. 5 shows the growth of strains based on YA246-4A expressing CGS1-4 (A), CGS1-5 (B) and CGS1-1 (C) mutant families respectively, in medium A supplemented with 0.1 mM of methanethiol. The CGS1-4 (G84S) and negative controls with pAL06 empty vector are shown in all graphs.

(6) FIG. 6 shows the growth of strains based on YA247-5A expressing CGS1-4 mutants family AD242, AD328, MUT24, and MUT27 in medium A supplemented with 1 mM (A) or 0.1 mM (B) of methanethiol. The CGS1-4 (G84S) and negative controls with pAL06 are shown in all graphs.

(7) FIGS. 7A-7D show an alignment of the identified mutants of CGS1.

DESCRIPTION OF SEQUENCES

(8) SEQ ID NO: 1 shows the amino acid sequence of the cystathionine gamma synthase (EC 2.5.1.48) CGS1 from Arabidopsis thaliana (AAC25687.1). SEQ ID NO: 2 shows the amino acid sequence of the cystathionine gamma synthase (EC 2.5.1.48) CGS1 from Arabidopsis thaliana (AAC25687.1) in which glycine 84 is replaced by serine. This sequence is also referred to as CGS1 G84S or CGS1-0. SEQ ID NO: 3 shows the amino acid sequence of the cystathionine gamma synthase (EC 2.5.1.48) CGS1 from Arabidopsis thaliana (AAC25687.1) in which glycine 84 is replaced by serine and in which the N-terminal 57 amino acids have been removed and a methionine residue is added at the N-terminus. This sequence is also referred to as CGS1 1-4 G84S. SEQ ID NO: 4 shows a truncated form the amino acid sequence of the cystathionine gamma synthase (EC 2.5.1.48) CGS1 from Arabidopsis thaliana (AAC25687.1) in which the N-terminal 88 amino acids have been removed and a methionine residue is added at the N-terminus. This sequence is also referred to as CGS1 1-5 G84S. SEQ ID NO: 5 shows a truncated form the amino acid sequence of the cystathionine gamma synthase (EC 2.5.1.48) CGS1 from Arabidopsis thaliana (AAC25687.1) in which the N-terminal 160 amino acids have been removed and a methionine residue is added at the N-terminus. This sequence is also referred to as CGS1 1-1 G84S. SEQ ID NO: 6 shows the sequence of the mutant MUT02. SEQ ID NO: 7 shows the sequence of the mutant MUT04. SEQ ID NO: 8 shows the sequence of the mutant MUT13. SEQ ID NO: 9 shows the sequence of the mutant MUT18. SEQ ID NO: 10 shows the sequence of the mutant MUT19. SEQ ID NO: 11 shows the sequence of the mutant AD309. SEQ ID NO: 12 shows the sequence of the mutant AD310. SEQ ID NO: 13 shows the sequence of the mutant AD311. SEQ ID NO: 14 shows the sequence of the mutant AD312. SEQ ID NO: 15 shows the sequence of the mutant AD313. SEQ ID NO: 16 shows the sequence of the mutant AD242. SEQ ID NO: 17 shows the sequence of the mutant AD328. SEQ ID NO: 18 shows the sequence of the mutant AD329. SEQ ID NO: 19 shows the sequence of the mutant MUT24. SEQ ID NO: 20 shows the sequence of the mutant MUT27. SEQ ID NO: 21 shows the sequence of the mutant MUT67. SEQ ID NO: 22 shows the sequence of the mutant MUT68. SEQ ID NO: 23 shows the sequence of the mutant MUT70. SEQ ID NO: 24 shows the sequence of the mutant MUT71. SEQ ID NO: 25 shows the sequence of the mutant MUT72. SEQ ID NO: 26 shows the sequence of the mutant MUT74. SEQ ID NO: 27 shows the sequence of the mutant MUT75. SEQ ID NO: 28 shows the sequence of the mutant MUT78. SEQ ID NO: 29 shows the sequence of the mutant MUT79.

(9) The content of documents cited herein is herewith incorporated by reference in its entirety.

(10) Other aspects and advantages of the invention will be described in the following examples, which are given for purposes of illustration and not by way of limitation.

EXAMPLES

Example 1: Preparation of Truncated Forms of CGS1 Used as Starting Material for Preparing Mutants

(11) The CGS1-4 gene is a synthetic gene. The synthesis was performed by Eurofins MWG Operon, (Ebersberg) using the GENEius algorithm in order to optimize the codon usage for improving its expression in S. cerevisiae. The S. cerevisiae codon usage table used was taken from the Kazusa Codon Usage Database (http://www.kazusa.or.jp/codon). The truncated forms CGS1-5 and CGS1-1 have been prepared by PCR using CGS1-4 as a matrix, with forward oligonucleotides GTACCGCTCGAGATGGTTGCTGGTAAGTGGTCTAACAATC for CGS1-5 and GTACCGCTCGAGATGTCTGTTCAATTGACCGATTCTAAG for CGS1-1. For both the CGS1-5 and CGS1-1 forms, an identical reverse oligonucleotide AGTACGGGATCCTCAAATGGCTTCCA was used.

(12) The described truncated modified forms of CGS1 are schematically shown in FIG. 3.

Example 2: Preparation of Mutants of the Truncated Forms of CGS1

(13) Truncated forms of the CGS1 genes were cloned into the pAL06 plasmid, a yeast replicative vector derived from the pRS316 vector (Sikorski R S & Hieter P., Genetics. 1989, 122:19-27). The pAL06 plasmid allows the expression of the cloned gene under the control of the strong yeast promoter TEF1. The CGS1 libraries were generated by hypermutagenic PCR with biased deoxynucleotide triphosphate (dNTP) concentrations using the protocol described by Vartanian J P et al., (Nucleic Acids Res. 1996 24:2627-2631). Both a [dTTP]>[dCTP] and a [dGTP]>[dATP] biases were used during the mutagenic PCRs. Either [dTTP]/[dCTP]=[dGTP]/[dATP]=1000 μM/200 μM or [dTTP]/[dCTP]=[dGTP]/[dATP]=1000 μM/150 μM were used in the presence of 0.5 mM MnCl.sub.2.

Example 3: Screening for Mutants which can Produce L-Methionine from O-Phospho-L-Homoserine and Methanethiol

(14) CGS1 libraries were transformed in yeast strains YA247-5A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3, trp1, ura3) or YA246-4A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3, thr4::loxP, trp1, ura3) in minimal medium supplemented with methionine but lacking uracil to select for the plasmid marker. After 48 hours of grow, cells were collected, washed and re-suspended in minimal liquid medium with methylmercaptan as a source of sulphur. After 7 days, cultures were collected and diluted within the same liquid medium, to an OD.sub.600nm of about 0.2. Three successive dilutions cycles were performed.

(15) The plasmids present within the resulting growing yeast cells were then extracted, amplified into E. coli and the resulting DNA was used to re-transformed the strains YA247-5A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3, trp1, ura3) or YA246-4A (MAT-a, ade2, his3, leu2, met2::loxP, met6::HIS3, thr4::loxP, trp1, ura3). The transformed yeasts were then selected on solid minimal medium containing methionine but lacking uracil. The capacity of each individual colony to grow with methylmercaptan as a sulphur source was then evaluated by growing individual clones in liquid medium containing methanethiol as a sulfur source. At each evolution cycle, plasmids contained within the yeast colonies displaying the best growth rates in the presence of methanethiol were extracted and sequenced. The selected mutants were transformed in YA247-5A strain for in vitro analysis and used as a starting materials for a new hypermutagenic PCR.

(16) Using the above described screening procedure a large number of mutants of CSG1 have been identified which were able to grow on methanethiol as the sole sulfur source and which are therefore assumed to be able to convert O-phospho-L-homoserine and methanethiol into L-methionine. Of these mutants the sequences have been determined and the mutants are summarized in the following Table 1A wherein the positions of the mutations are indicated with reference to the sequence provided in SEQ ID NO: 3 (CGS 1-4). The mutants are also summarized in FIG. 7 in which they are aligned.

(17) TABLE-US-00001 TABLE 1A Amino acid Position Mutation(s) P 10 L N 11 D Q 15 R I 27 S A 30 T L 45 S S 47 T V 60 D A 68 T F 150 L T 178 I D 183 E I 185 V T 220 S M 232 L V 245 A A 257 T N 259 D, S F 261 S F 275 L I 287 V, F H 289 Y, R Y 324 F G 326 S P 356 T T 371 A V 396 A P 405 S D 431 G I 436 T I 457 L D 459 N P 470 S E 472 G A 506 G I 507 V

(18) The following Table 1B lists all the mutants analysed and indicated the positions of the found mutations with respect to the full length sequence of SEQ ID NO:1 (CGS1). The position with respect to the corresponding starting sequence is indicated in parenthesis.

(19) TABLE-US-00002 TABLE 1B Starting Mutant Mutations sequence MUT02 P412(356)T 1-4 MUT04 P66(10)L, I83(27)S, V116(60)D, 1-4 Y380(324)F, I513(457)L MUT13 M57(1)K, I88(32)M, I343(287)V, 1-4 H345(289)R, P412(356)T, stop564(508)W MUT18 P66(10)L, M288(232)L, V301(245)A, 1-4 N315(259)D, P412(356)T, D487(431)G, I492(436)T MUT19 N67(11)D, Q71(15)R, A86(30)T, 1-4 L101(45)S, S103(47)T, A124(68)T, T234(178)I, P412(356)T, T427(371)A, D515(459)N AD309 I88(1)M, P412(325)T 1-5 AD310 I88(1)M, V116(29)D, Y380(293)F, 1-5 I513(426)L AD311 I88(1)M, I343(256)V, H345(258)R, 1-5 P412(325)T AD312 I88(1)M, M288(201)L, V301(214)A, 1-5 N315(228)D, P412(325)T, D487(400)G, I492(405)T AD313 I88(1)M, L101(14)S, S103(16)T, 1-5 A124(37)T, T234(147)I, P412(325)T, T427(340)A, D515(428)N AD242 G160(1)M, P412(325)T 1-1 AD328 G160(1)M, M288(129)L, V301(142)A, 1-1 N315(156)D, P412(253)T, D487(328)G, I492(333)T AD329 G160(1)M, T234(75)I, P412(253)T, 1-1 T427(268)A, D515(356)N MUT24 G160(1)M, F206(47)L, A313(154)T, 1-1 N315(156)S, F317(158)S, F331(172)L, H345(186)Y, P412(253)T, A562(403)G MUT27 G160(1)M, I241(82)V, P412(253)T, 1-1 P461(302)S MUT67 G160(1)M, F331(172)L, P412(253)T, 1-1 V452(293)A, E528(369)G MUT68 G160(1)M, F331(172)L, G382(223)S, 1-1 P412(253)T, V452(293)A MUT70 G160(1)M, T276(117)S, F331(172)L, 1-1 P412(253)T, V452(293)A MUT71 G160(1)M, D239(80)E, F331(172)L, 1-1 P412(253)T, V452(293)A, I563(404)V MUT72 G160(1)M, F331(172)L, I343(184)F, 1-1 P412(253)T, V452(293)A, I563(404)V MUT74 G160(1)M, F331(172)L, P412(253)T, 1-1 V452(293)A, P526(367)S MUT75 G160(1)M, F331(172)L, P412(253)T, 1-1 I563(404)V MUT78 G160(1)M, F331(172)L, P412(253)T, 1-1 V452(293)A MUT79 G160(1)M, F331(172)L, I343(184)F, 1-1 P412(253)T

(20) Starting sequence 1-4 corresponds to SEQ ID NO: 3

(21) Starting sequence 1-5 corresponds to SEQ ID NO: 4

(22) Starting sequence 1-1 corresponds to SEQ ID NO: 5

(23) The following Table 1C lists all the mutants analysed and indicates the positions of the found mutations with respect to the sequence of SEQ ID NO:3 (CGS1-4). The position with respect to the corresponding starting sequence is indicated in parenthesis.

(24) TABLE-US-00003 TABLE 1C Starting Mutant Mutations sequence MUT02 P356T 1-4 MUT04 P10L, I27S, V60D, Y324F, I457L 1-4 MUT13 M1K, I32M, I287V, H289R, P356T, stop508W 1-4 MUT18 P10L, M232L, V245A, N259D, P356T, D431G, 1-4 I436T MUT19 N11D, Q15R, A30T, L45S, S47T, A68T, T178I, 1-4 P356T, T371A, D459N AD309 I32(1)M, P356(325)T 1-5 AD310 I32(1)M, V60(29)D, Y324(293)F, I457(426)L 1-5 AD311 I32(1)M, I287(256)V, H289(258)R, P356(325)T 1-5 AD312 I32(1)M, M232(201)L, V245(214)A, N259(228)D, 1-5 P356(325)T, D431(400)G, I436(405)T AD313 I32(1)M, L45(14)S, S47(16)T, A68(37)T, 1-5 T178(147)I, P356(325)T, T371(340)A, D459(428)N AD242 G104(1)M, P356(253)T 1-1 AD328 G104(1)M, M232(129)L, V245(142)A, 1-1 N259(156)D, P356(253)T, D431(328)G, I436(333)T AD329 G104(1)M, T178(75)I, P356(253)T, 1-1 T371(268)A, D459(356)N MUT24 G104(1)M, F150(47)L, A257(154)T, 1-1 N259(156)D, F261(158)S, F275(172)L, H289(186)Y, P356(253)T, A506(403)G MUT27 G104(1)M, I185(82)V, P356(253)T, P405(302)S 1-1 MUT67 G104(1)M, F275(172)L, P356(253)T, 1-1 V396(293)A, E472(369)G MUT68 G104(1)M, F275(172)L, G326(223)S, 1-1 P356(253)T, V396(293)A MUT70 G104(1)M, T220(117)S, F275(172)L, 1-1 P356(253)T, V396(293)A MUT71 G104(1)M, D183(80)E, F275(172)L, 1-1 P356(253)T, V396(293)A, I507(404)V MUT72 G104(1)M, F275(172)L, I287(184)F, 1-1 P356(253)T, V396(293)A, I507(404)V MUT74 G104(1)M, F275(172)L, P356(253)T, 1-1 V396(293)A, P470(367)S MUT75 G104(1)M, F275(172)L, P356(253)T, I507(404)V 1-1 MUT78 G104(1)M, F275(172)L, P356(253)T, V396(293)A 1-1 MUT79 G104(1)M, F275(172)L, I287(184)F, P356(253)T 1-1

Example 4: Test of the Enzymatic Activity in Yeast Saccharomyces cerevisiae

(25) Expression of any of the above described mutants in Saccharomyces cerevisiae strains YA247-5A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3, trp1, ura3) and YA246-4A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3, thr4::loxP, trp1, ura3) relieve the strains from their methionine auxotrophy.

(26) In other words upon expression of any of the above mutants, yeast strain YA247-5A and YA246-4A defective for methionine synthesis grow on a minimal medium supplemented with adenine, histidine, leucine, tryptophane and uracil.

(27) Experimental Design of the Test:

(28) Mutant nucleotide sequences were individually cloned into the replicative plasmide pAL06 (a derivative of pRS316) downstream of a transcription promoter (pTEF1) and upstream of a transcription terminator (tADH1).

(29) The twelve plasmids thus obtained were individually transformed in yeast strains YA247-5A and YA246-4A. Transformants were grown in medium A (Difco™ Yeast Nitrogen Base 6.7%, glucose 2%, adenine 0.3 mM, leucine 0.75 mM, Histidine 1.3 mM, tryptophane 0.1 mM) supplemented with methionine 0.2 mM.

(30) Each of the transformant was then inoculated (OD.sub.590=0.015) in medium A supplemented with 0.05 mM methionine, or in medium A supplemented with methanethiol 0.1 or 1 mM.

(31) The growth was monitored by following the Optical Density at 590 nm (OD.sub.590). The respective growth of each clone in the two media was compared to the growth of the negative controls YA246-4A or YA247-5A transformed with an empty vector pAL06. In medium A with methionine, all strains tested have a generation time of about 4 h. For example, the growth of strains YA246-4A expressing the mutants CGS 1-4 (G84S), AD242 and AD328 and the control pAL06 vector is shown in FIG. 4.

(32) Growth in a Context of Accumulation of Phosphohomoserine:

(33) The growth of strains based on YA246-4A which accumulate phosphohomoserine and express CGS1 protein mutants in medium A supplemented with 0.1 mM methanethiol is shown in FIG. 5.

(34) In all cases, no growth was observed for the control CGS1-4 (G84S) and for the strains with pAL06 plasmid.

(35) For the CGS1-4 family (FIG. 5A), the generation time is comprised between 13 h for MUT19 and 42 h for MUT02. For the CGS1-5 family (FIG. 5B), the generation time is comprised between 9.5 h for AD312 and AD313 and 12.5 h for AD310. For the CGS1-1 family (FIG. 5C), the generation time is about 9.5 h for AD242, AD328 and AD329.

(36) Growth in a Context without Accumulation of Phosphohomoserine:

(37) The growth of strains based on YA247-5A which do not accumulate phosphohomoserine and express CGS1 protein mutants in medium A supplemented with 1 mM methanethiol or 0.1 mM methanethiol is shown in FIGS. 6A and 6B, respectively.

(38) With 1 mM of methanethiol no growth is observed for the CGS1-1 and the negative control transformed with the pAL06 empty vector. The generation times are about 21 h for AD242 or AD328, 10.5 h for MUT27 and 8 h for MUT24. With 0.1 mM of methanethiol growth is observed only with MUT24 and MUT27 mutants. The generation times are respectively 19 h and 40 h.

Example 5: In Vitro Activity of OPHS Dependent Methionine Synthase

(39) In vitro activity of the enzyme expressed in yeast was tested in a crude lysate of yeast.

(40) The activity was followed by monitoring the synthesis of methionine in the lysate in the presence of O-phospho-L-homoserine (OPHS) and methanethiol (CH.sub.3SNa). Lysates from yeast cells YA246-5A, YA246-5A carrying an empty plasmid pAL06, YA246-5A expressing CGS1-4 and YA246-5A expressing mutants AD246, AD239, MUT24, MUT27, MUT67 or MUT79 were compared.

(41) Experimental Procedure:

(42) Lysate Preparation

(43) Yeast cells were first grown in a complete medium. This first culture was used to inoculate 100 ml of medium A (OD.sub.590nm=0.3) that was incubated at 28° C. under agitation for 16 hours.

(44) The total amount of protein was determined using a Bradford assay.

(45) To start the reaction, 0.03 to 0.06 mg of total protein was incubated at 37° C. in 100 mM Tris pH8, 0.2 mM pyridoxal phosphate, 5 mM CH3SNa and 25 mM OPHS in a total volume of 100 μl for 15 minutes. 10 μl aliquots of the reaction mixture were collected at 15 and 60 minutes and the reaction was stopped by addition of 90 μl perchloric acid. The amount of methionine in these aliquots was determined by LCMS using .sup.13CMet as internal standard. The amount of methionine formed was normalized by the amount of protein used in the assay.

(46) The results are shown in the following Table 2:

(47) TABLE-US-00004 TABLE 2 Activity (nmole .Math. min.sup.−1 .Math. mg.sup.−1) St-Dev CGS1-4 (G84S) undetectable — pAD242 142 ±13 pAD329 143 ±11 pMUT24 354 ±14 pMUT27 343 ±38 pMUT67 864 ±91 pMUT79 462 ±35

Example 6: In Vitro Assay for Measuring Homocysteine Synthase Activity

(48) The homocysteine synthase activity of the enzymes expressed in yeast was tested in an in vitro assay using a crude lysate of yeast.

(49) The activity was followed by monitoring the synthesis of methionine in the lysate in the presence of O-phospho-L-homoserine (OPHS) and methanethiol (CH.sub.3SNa). Lysates from yeast cells YA246-5A, YA246-5A carrying an empty plasmid pAL06, YA246-5A expressing CGS1-4 and YA246-5A expressing mutants AD242, AD328, MUT24, MUT27, MUT67 or MUT79 were compared.

(50) Experimental Procedure:

(51) Lysate Preparation

(52) Yeast cells were first grown in a complete medium. This first culture was used to inoculate 100 ml of medium A (OD.sub.590nm=0.3) that was incubated at 28° C. under agitation for 16 hours. The total amount of protein was determined using a Bradford assay. The amount of homocysteine formed is determined by a colorimetric assay.

(53) To start the reaction, 0.03 to 0.06 mg of total protein was incubated in 0.1M Tris ph8, 0.2 mM pyridoxal phosphate, 10 mM Na.sub.2S, 12.5 mM OPHS in 100 μl. incubate 15 minutes at 30° C. Add 500 μl of 1% NaNO.sub.2 (dissolved in H.sub.2SO.sub.4 0.4 N) incubate for 5 minutes Add 100 μl of NH.sub.4SO.sub.3NH.sub.2 incubate for 2 minutes Add 750 μl of 1 volume de HgCl.sub.2 Add 4 volumes of sulfanilamide Add 2 volumes of N-(1-Naphthyl)ethylenediamine dihydrochloride

(54) incubate for 15 minutes

(55) read the OD at 450 nm (increase proportionally with the quantity of homocysteine—the amount is determined by comparison with the results obtained with a known range of homocysteine).

(56) The results are shown in Table 3.

(57) TABLE-US-00005 TABLE 3 Activity (nmole .Math. min.sup.−1 .Math. mg.sup.−1) St. Dev CGS1-4 (G84S) undetectable — pAD242 18 ±4 pAD328 21 ±2 pMUT24 59 ±9 pMUT27 47 ±2 pMUT67 239 ±32 pMUT79 215 ±29