Re-trafficking of herg reverses long QT syndrome 2 phenotype in human iPS-derived cardiomyocytes
09797883 · 2017-10-24
Assignee
Inventors
- Winston Se Ngie Shim (Singapore, SG)
- Ashish Mehta (Singapore, SG)
- Chrishan Julian Alles Ramachandra (Singapore, SG)
- Philip En Hou Wong (Singapore, SG)
Cpc classification
A61K31/443
HUMAN NECESSITIES
International classification
G01N33/50
PHYSICS
A61K31/443
HUMAN NECESSITIES
Abstract
The present invention relates to generating hiPSC-derived cardiomyocytes and embryoid bodies that recapitulate the disease phenotype of Long QT Syndrome and their use in developing pharmacological treatments thereof. The present invention also includes the use of a compound which inhibits the ubiquitin-proteasome pathway for the preparation of a medicament for the prophylaxis or treatment of a disease associated with prolonged ventricular repolarization (cardiac arrhythmia) caused by one or more mutations in the amino acid sequence of the hERG potassium channel.
Claims
1. A method of testing compounds for activity in ameliorating long QT syndrome 2 (LQTS2) phenotype, comprising the steps; (a) contacting LQTS2-specific cardiomyocytes or embryoid bodies (EBs) with a test compound, (b) quantifying the level of human ether-a-go-go related gene (hERG) protein in the endoplasmic reticulum (ER) and in the sarcolemma, and comparing the relative level of hERG in the ER and sarcolemma with untreated cardiomyocytes or EBs, wherein an increase in sarcolemma level and a decrease in ER level of hERG in the treated cells indicates re-trafficking of hERG and the compound has LQTS2-ameliorating activity, (c) quantifying the level of glycosylated (mature) hERG protein and comparing with untreated cardiomyocytes or EBs, wherein increased glycosylation indicates the compound has LQTS2-ameliorating activity, (d) measuring the local field potential duration (FPD), correcting for the beating rate of contracting areas (cFPD), and comparing with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has LQTS2-ameliorating activity, and (e) measuring the action potential duration (APD), and comparing with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD, indicates the compound has LQTS2-ameliorating activity.
2. The method according to claim 1, further comprising the step; culture LQTS2-specific cardiomyocytes or EBs until spontaneously contracting or induced to contract.
3. The method according to claim 1, wherein the phenotype is cardiac rhythm disturbance, comprising the steps; (a) culturing LQTS2-specific cardiomyocytes or embryoid bodies (EBs) until spontaneously contracting or induced to contract, (b) contacting the cardiomyocytes or EBs with the test compound, and (i) an agent that triggers arrhythmia, and/or (ii) an agent that increases cardiomyocyte or EB beating rate, (c) measuring the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has rhythm normalizing activity, and/or (d) measuring the action potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has repolarization normalizing activity.
4. The method according to claim 1, comprising the steps; (a) culturing LQTS2-specific cardiomyocytes or embryoid bodies (EBs) until spontaneously contracting or induced to contract, (b) contacting the cardiomyocytes or EBs with the test compound, and (i) an agent that modulates any one or more of calpain, calpastatin, and ubiquitin expression, and/or (ii) an agent that modulates any one or more of HSP70, HSP90 and CAV3 expression, (c) measuring the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has LQTS2-ameliorating activity, and/or (d) measuring the action potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has LQTS2-ameliorating activity, and/or (e) measuring the hERG channel kinetic and compare with the untreated cardiomyocytes or EBs, wherein a normalizing channel kinetic indicates the compound has LQTS2-ameliorating activity.
5. The method according to claim 4, wherein the HSP70 modulator is any one or more selected from the group consisting of 2 Phenylethynesulfonamide, Pifithrin-μ, 2,5′-thiodipyrimidines, 5-(phenylthio)pyrimidines, 2-(pyridin-3-ylthio)pyrimidines, 3-(phenylthio)pyridines, MKT-077, rapamycin and VER155008.
6. The method according to claim 4, wherein the ubiquitin modulator is any one or more selected from the group consisting of rapamycin, N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine, PYR-41, MLN4924, SMER3, BAY11-7082 and Nutlin-3.
7. The method according to claim 4, wherein the calpain modulator is any one or more selected from the group consisting of 4PBA, N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine, MG-132, 3-[6-[[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropanecarbonyl]amino]-3-methylpyridin-2-yl]benzoic acid, AK275, MDL28170, PD150606, SJA6017, ABT-705253 and SNJ-1945.
8. The method according to claim 4, wherein the CAV3 modulator is SB203580.
9. The method according to claim 4, wherein the HSP90 modulator is any one or more selected from the group consisting of 4 hydroxytamoxifen, tomoxifen, activator of Hsp90 ATPase homolog1 (AHA1).
10. The method according to claim 1, wherein the phenotype is cardiac rhythm instability, comprising the steps; (a) culturing LQTS2-specific cardiomyocytes or embryoid bodies (EBs) until spontaneously contracting with normal rhythm, (b) contacting the cardiomyocytes or EBs with the test compound, and (i) an agent that increases cardiomyocyte or EB beating rate, and/or (ii) an agent that triggers abnormal cardiac rhythm, (c) measuring the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has rhythm normalizing activity, and/or (d) measuring the action potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has repolarization normalizing activity, and/or (e) measuring the presence of early after-depolarizations (EADs) and compare to untreated cardiomyocytes or EBs, wherein the suppression of EADs indicates the compound has arrhythmia suppressing activity.
11. The method according to claim 10, wherein the agent that increases cardiomyocyte or EB beating rate is any one or more selected from the group consisting of isoprenaline, dobutamine, epinephrine, norepinephrine and xamoterol.
12. The method according to claim 10, wherein the agent that triggers abnormal cardiac rhythm is any one or more selected from the group consisting of E-4031, terfenadine, roxithromycin, fluconazole, cisapride and astemizole.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DEFINITIONS
(23) The terms “hERG”, “KCNH2” and “K.sub.v11.1” may be used interchangeably in the context of the invention. Moreover, the terms “redirects” and “re-traffics” are used interchangeably in the context of the invention.
(24) An “embryoid body” (EB) refers to an aggregate of cells derived from pluripotent cells, where cell aggregation can be initiated by any method that prevents the cells from adhering to a surface to form typical colony growth.
(25) The term “induced pluripotent stem cell” (iPSC) refers to a pluripotent stem cell derived from a non-pluripotent cell (e.g. an adult somatic cell). Induced pluripotent stem cells are identical to embryonic stem cells in the ability to form any adult cell, but are not derived from an embryo.
(26) As used herein, the term “pluripotent” refers to the potential of a stem cell to make any differentiated cell of an organism. Pluripotent stem cells can give rise to any fetal or adult cell type. However, alone they cannot develop into a fetal or adult organism because they lack the potential to contribute to extra-embryonic tissue, such as the placenta.
(27) As used herein, the term “modulates” refers to up-regulation or down regulation of the amount or expression of a substance. The term “up-regulation” refers to a situation where one or more compounds act to increase the expression level of a substance, whether it is a protein or the mRNA encoding the protein, compared to an untreated or control state.
(28) As used herein, the term “modulates single allele of hERG gene” is in the context of the following. The clinical heterozygous mutation of the hERG gene (1 paternal and 1 maternal allele), i.e. 1 allele is normal and another allele is abnormal/mutant is the norm in clinical LQTS2. The disease is only manifesting itself if the mutant allele is expressing highly and/or is dominating over the normal allele. Any agent that is able to suppress the expression or effect of the mutant allele or promote the normal allele will likely restore the hERG function and therefore treat the LQTS2. This is where we believe ALLN, for example (used in this study), exerts its effect, by reducing the burden of the mutant allele by correcting the balance between the expression and/or the effect of the normal vs. mutant allele. This is the first time being shown in any literature that such allelic dominance is only manifesting itself in cardiomyocytes, but not in other unrelated cells in the same patient.
(29) As used herein, the term “mutation” refers to an alteration in the nucleotide sequence of DNA. For example, a missense mutation is when the change of a single base pair causes the substitution of a different amino acid in the resulting protein. This amino acid substitution may have no effect, or it may render the protein nonfunctional. In reference to the A561V missense mutation in the hERG gene, the change in amino acid at position 561 causes incorrect processing and translocation of the channel protein.
(30) As used herein, the term “an”, such as used in “an agent” may include within its scope one or more of said agents. For example, an agent that modulates at least one of calpain, calpastatin, and ubiquitin expression encompasses more than one agent when the expression of more than one of calpain, calpastatin and ubiquitin are to be modulated. Further, one or more of said agents may be used to modulate a single protein such as, for example, calpain.
DETAILED DESCRIPTION OF THE INVENTION
(31) The present invention, in one aspect, provides a method for testing compounds for activity in ameliorating an LQTS2 phenotype in a cell or animal, comprising the steps;
(32) (a) contact LQTS2-specific cardiomyocytes or embryoid bodies (EBs) with the compound, and
(33) (b) quantitate the level of hERG protein in the endoplasmic reticulum (ER) and in the sarcolemma, and compare the relative level of hERG in the ER and sarcolemma with untreated cardiomyocytes or EBs, wherein an increase in sarcolemma level and a decrease in ER level of hERG in the treated cardiomyocytes or EBs indicates re-trafficking of hERG and the compound has LQTS2-ameliorating activity and/or
(34) (c) quantitate the level of glycosylated (mature) hERG protein and compare with untreated cardiomyocytes or EBs, wherein increased glycosylation indicates the compound has LQTS2-ameliorating activity, and/or
(35) (d) measure the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has LQTS2-ameliorating activity, and/or
(36) (e) measure the action potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has LQTS2-ameliorating activity.
(37) The LQTS2-specific cardiomyocytes and EBs may or may not spontaneously contract or be induced to contract. For example, the cells do not necessarily need to be in a contracting state in order to determine the cellular location of the hERG protein, or the protein's degree of glycosylation.
(38) In a preferred embodiment, the method comprises a further step of culturing the LQTS2-specific cardiomyocytes or EBs until they are spontaneously contracting or induced to contract.
(39) In a preferred embodiment, in step (i) the level of hERG protein is determined by immunostaining.
(40) In another preferred embodiment, in step (ii) the level of glycosylated (mature) hERG protein is determined by western blot.
(41) The FPD may, for example, be measured using a microelectrode array recording system, and the APD may be measured using whole cell patch-clamp recording methods as described herein.
(42) Another preferred embodiment of the method is directed towards when the phenotype is cardiac rhythm disturbance, comprising the steps;
(43) (a) culture LQTS2-specific cardiomyocytes or embryoid bodies (EBs) until spontaneously contracting or induced to contract,
(44) (b) contact the cardiomyocytes or EBs with the test compound, and
(45) (i) an agent that triggers arrhythmia and/or
(46) (ii) an agent that increases cardiomyocyte or EB beating rate,
(47) (c) measure the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has rhythm normalizing activity, and/or
(48) (d) measure the action potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has repolarization normalizing activity.
(49) In another preferred embodiment, the method according to the invention comprises the steps;
(50) (a) culture LQTS2-specific cardiomyocytes or embryoid bodies (EBs) until spontaneously contracting or induced to contract,
(51) (b) contact the cardiomyocytes or EBs with the test compound, and
(52) (i) an agent that modulates single allele of hERG gene in cardiomyocytes or EBs, and/or
(53) (ii) an agent that modulates any one or more of calpain, calpastatin, and ubiquitin expression, and/or
(54) (iii) an agent that modulates any one or more of HSP70, HSP90 and CAV3 expression,
(55) (c) measure the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has LQTS2-ameliorating activity, and/or
(56) (d) measure the action-potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has LQTS2-ameliorating activity, and/or
(57) (e) measure the hERG channel kinetic and compare with the untreated cardiomyocytes or EBs, wherein a normalizing channel kinetic indicates the compound has LQTS2-ameliorating activity.
(58) In a preferred embodiment of the method, in step (i) the hERG gene modulator is hERG gene-specific siRNA. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA molecules, 20-25 base pairs in length. siRNA can be used to interfere with the expression of specific genes with complementary nucleotide sequence. Any method known in the art suitable for introducing siRNA into the cardiomyocytes or EBs to inhibit activity of a hERG gene allele is intended to fall within the scope of the invention. For example, siRNAs can be introduced by transfection. The publication by Elbashir S M, et al., (Methods 2002; 26(2):199-213), provides suitable methods and is herein incorporated by reference.
(59) In another preferred embodiment of the method, in step (ii) the ubiquitin modulator is selected from the group comprising rapamycin, N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine, PYR-41, MLN4924, SMER3, BAY11-7082 and Nutlin-3.
(60) In another preferred embodiment of the method, in step (ii) the calpastatin modulator is an introduced expression system for calpastatin, such as an introduced plasmid/vector construct that comprises the nucleotide sequence of calpastatin, or the calpastatin is introduced via gene therapy. Any method known in the art suitable for introducing a system for expressing exogenous calpastatin in the cardiomyocytes or EBs is intended to fall within the scope of the invention. Publications such as Molecular Cloning: A Laboratory Manual (Fourth Edition) (Joe Sambrook and Michael Green, Cold Spring Harbor Laboratory Press), and WO 2001032901 A1; WO 2000078119 A2 provide suitable methods and are herein incorporated by reference. Up-regulated expression of calpastatin to suppress calpain activity is a potential way to rescue LQTS2.
(61) In another preferred embodiment of the method, in step (ii) the calpain modulator is selected from the group comprising 4PBA, N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine, MG-132, 3-[6-[[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropanecarbonyl]amino]-3-methylpyridin-2-yl]benzoic acid, AK275, MDL28170, PD150606, SJA6017, ABT-705253 and SNJ-1945.
(62) In a preferred embodiment of the method, in step (iii) the HSP70 modulator is any one or more selected from the group comprising 2-Phenylethynesulfonamide, Pifithrin-μ, 2,5′-thiodipyrimidines, 5-(phenylthio)pyrimidines, 2-(pyridin-3-ylthio)pyrimidines, 3-(phenylthio)pyridines, MKT-077, rapamycin and VER155008.
(63) In another preferred embodiment of the method, in step (iii) the CAV3 modulator is SB203580.
(64) In another preferred embodiment of the method, in step (iii) the HSP90 modulator is any one or more selected from the group comprising 4-hydroxytamoxifen, tomoxifen, activator of Hsp90 ATPase homolog1 (AHA1).
(65) Another preferred embodiment of the method provides when the phenotype is cardiac rhythm stability, comprising the steps;
(66) (a) culture LQTS2-specific cardiomyocytes or embryoid bodies (EBs) until spontaneously contracting with normal rhythm,
(67) (b) contact the cardiomyocytes or EBs with the test compound, and
(68) (i) an agent that increases cardiomyocyte or EB beating rate, and/or
(69) (ii) an agent that triggers abnormal cardiac rhythm,
(70) (c) measure the local field potential duration (FPD), correct for the beating rate of contracting areas (cFPD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in cFPD indicates the compound has rhythm normalizing activity, and/or
(71) (d) measure the action potential duration (APD), and compare with untreated cardiomyocytes or EBs, wherein a time-dependent reduction in APD indicates the compound has repolarization normalizing activity, and/or
(72) (e) measure the presence of early after-depolarizations (EADs) and compare to untreated cardiomyocytes or EBs, wherein the suppression of EADs indicates the compound has arrhythmia suppressing activity.
(73) It is preferred that the agent that increases cardiomyocyte beating rate is any one or more selected from the group comprising isoprenaline, dobutamine, epinephrine, norepinephrine and xamoterol.
(74) It is preferred that the agent that triggers abnormal cardiac rhythm is any one or more selected from the group comprising hERG blocking activity such as E-4031, terfenadine, roxithromycin, fluconazole, cisapride, astemizole.
(75) Another aspect of the invention provides a composition comprising at least one compound which inhibits the ubiquitin-proteasome pathway for use in inducing redirection (re-trafficking) of mutant hERG potassium channel towards the sarcolemma.
(76) According to a further aspect, the invention provides the use of a compound which inhibits the ubiquitin-proteasome pathway for the preparation of a medicament for the prophylaxis or treatment of a disease associated with prolonged ventricular repolarization (cardiac arrhythmia) caused by one or more missense mutations in the amino acid sequence of the hERG potassium channel.
(77) In a preferred embodiment the disease is hereditary long QT syndrome 2 (LQTS2).
(78) In another preferred embodiment, the at least one compound redirects hERG towards the sarcolemma, reduces repolarization, increases I.sub.Kr currents and/or reduces arrhythmogenic events.
(79) Another embodiment of the invention provides a method of prophylaxis or treatment of a disease associated with prolonged ventricular repolarization (cardiac arrhythmia), caused by one or more mutations in the amino acid sequence of the hERG potassium channel, comprising administering to a subject in need of such prophylaxis or treatment an efficacious amount of a compound which redirects (re-trafficks) hERG from the endoplasmic reticulum to the sarcolemma.
(80) In accordance with the various embodiments of the invention described supra, the at least one compound is preferably an ubiquitin-proteasome inhibitor.
(81) Preferably, the compound is any one or more selected from the group comprising N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine (ALLN); 3-[6-[[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropanecarbonyl]amino]-3-methylpyridin-2-yl]benzoic acid (VX-809). More preferably the compound is N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine.
(82) LQTS2-specific cardiomyocytes (A561V missense mutation in KCNH2) were generated from induced pluripotent stem cells using virus-free reprogramming method. These cardiomyocytes recapitulate dysfunction of hERG potassium channel with diminished I.sub.Kr currents, prolonged repolarization durations and elevated arrhythmogenesis due to reduced membrane localization of glycosylated/mature hERG. Dysregulated expression of folding chaperones and processing proteasomes coupled with sequestered hERG in the endoplasmic reticulum confirmed trafficking-induced disease manifestation. Treatment with ALLN (N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine), not only increased membrane localization of mature hERG but also reduced repolarization, increased I.sub.Kr currents and reduced arrhythmogenic events. Diverged from biophysical interference of hERG channel, our results show that modulation of chaperones proteins could be therapeutic in LQTS2 treatment.
(83) This in vitro study shows an alternative approach to rescue diseased LQTS2 phenotype via corrective re-trafficking therapy using a small chemical molecule such as ALLN. This approach may have ramifications in other clinically relevant trafficking disorders. The methods of the invention allow the testing of compounds on LQTS2-specific cardiomyocytes or EBs, for their ability to effect normalization of various aspects of the LQTS2 phenotype, via the ubiquitin-proteasome pathway.
(84) Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.
EXAMPLES
(85) Generation of Human iPSCs.
(86) Reprogramming of patient-derived skin fibroblasts was performed with episomal plasmids as reported previously. Briefly, the patient-derived skin fibroblasts were co-transfected with two oriP/EBNA1-based episomal plasmids (EO2S CK2M EN2L, pEP4 EO2S ET2K from Addgene Inc, MA, USA) via nucleofection (NHDF-VPD-1001 with U-20 program, Amaxa, Walkersville, Md.) was performed. Transfected fibroblasts (1.0×10.sup.6 cells per nucleofection) were directly plated to 10-cm mitomycin-C inactivated MEF-seeded dishes with fibroblast culture medium. Culture medium was exchanged every other day. On day 4 post-transfection, the foreskin fibroblast culture medium was replaced with human ES cell culture medium (Mehta A, et al., 2008; Mehta A, et al., 2010) with 100 ng/ml of bFGF (R and D Systems, USA). Colonies with morphology similar to hESC colonies were readily visible between day 21-25 post-transfection. Individual colonies were picked manually and plated on 1% matrigel coated dishes and maintained in mTeSR1 medium (Stem Cell Technologies, VA, Canada). Enzymatic passaging with 1 mg/ml dispase was employed for expansion, characterization and differentiation (Mehta A, et al., 2011).
(87) Embryoid Body Formation and Cardiomyocyte Differentiation.
(88) Pluripotent stem cell colonies were dispersed into small clumps with dispase (1 mg/ml) and, placed in low adhesion culture dishes in EB medium (Mehta A, et al., 2010) along with or without 5 μM of SB203580 (Calbiochem, USA) for 8 days (Mehta A, et al., 2011). Subsequently, EBs were plated on 0.1% gelatin-coated dishes in EB media without SB203580. Beating areas were typically observed around day 11-14 from EB formation. Beating areas were manually cut after day 21 of differentiation and utilized for experiments.
(89) Immunfluorescence.
(90) Colonies of iPSC and single cells generated from beating clusters were seeded on matrigel- and gelatin-coated glass slides respectively. Both cell types were fixed with 4% paraformaldehyde, permeabilized with 1% Triton X-100 (Sigma-Alrich, MO, USA) and blocked with 5% bovine serum albumin (Sigma-Alrich, MO, USA). Human iPS colonies were stained for 1 hour with primary antibodies targeting pluripotency markers, Oct-4, SSEA4, Tra-1-60 and Tra-1-80 (all Millipore, MA, USA), whereas cardiomyocytes (CMs) were stained with primary antibodies, α-actinin (Sigma-Alrich, MO, USA), MLC (USBiologicals, MA, USA), titin (DHSB, Iowa, USA), SERCA (Sigma-Alrich, MO, USA), hERG (Abcam, MA, USA) and calpastatin (Millipore, MA, USA). Samples were washed and incubated with respective secondary antibodies (Invitrogen, CA, USA) for 1 hour and subsequently counterstained with DAPI. Slides were examined under Zeiss LSM710 NLO multi-photon confocal microscope (Carl Zeiss Inc, USA).
(91) All human studies performed conform to the declaration of Helsinki and all experimental protocols and studies were approved by the Institutional Review Board (IRB) of the host institute.
(92) Teratoma Formation
(93) Animal experiments were conducted following experimental protocols approved by the Institutional Ethics Committee on Experimental Animals, in full compliance with Singapore laws and regulations and followed the guidelines by US National Institutes of Health Guide for the Care and Use of Laboratory Animals. SCID mice, 6-week old, weighing 20-23 g, were obtained from SingHealth Experimental Medicine Centre and were anesthetized with 2% isofluorane initially followed by 1% isofluorane during surgery. Approximately 1×10.sup.6 hiPS cells, were injected into the kidney capsule as previously described. Mice were euthanized with carbon dioxide asphyxiation at 8-week after injections and tumors collected, fixed and processed for standard H&E staining.
(94) Karyotype Analysis.
(95) Karyotype analysis was performed using standard G-banding chromosome analysis by the K.K. Hospital's cytogenetic laboratory (Singapore) according to standard procedures.
(96) DNA Sequencing.
(97) Genomic DNA was isolated from the patient fibroblasts, patient- and control-hiPSCs using QIAamp DNA kit (Qiagen GmbH, Hilden, Germany). The relevant DNA fragment of the KCNH2 gene was amplified by PCR reaction using 100 ng genomic DNA (primer sequences in Table 1) and the PCR products were sequenced.
(98) TABLE-US-00001 TABLE 1 SEQ SEQ ID Gene ID NO. name Forward primer NO. Reverse primer 1 KCNH2 ATGACGCAGATGGAGAAGA — (Seq) 2 KCNH2 CTGATCGGGCTGCTGAAGAC 3 AGCCAATGAGCATGACGCA (RE) 4 KCNH2 TGCACCTTTGCGCTCATCCC 5 GCGCCGTCACATACTTGTCCTTG (AS)-Wt 6 KCNH2 TGCACCTTTGCGCTCATCCT 7 GCGCCGTCACATACTTGTCCTTG (AS)-Mt 8 KCNH2 CGTGCTGCCTGAGTACAAGCT 9 TGTGAAGACAGCCGTGTAGATGA (AS)-Total 10 GAPDH GTGGACCTGACCTGCCGTCT 11 GGAGGAGTGGGTGTCGCTGT 12 Oct-4 AGTTTGTGCCAGGGTTTTTG 13 ACTTCACCTTCCCTCCAACC 14 Sox-2 AAAAATCCCATCACCCACAG 15 GCGGTTTTTGCGTGAGTGT 16 Nanog CTCCATGAACATGCAACCTG 17 GAGGAAGGATTCAGCCAGTG 18 hTert TGGCAGGTGTACGGCTTCGT 19 CAGCTCCTGCAGCGAGAGCT 20 Nestin CAGGAGAAACAGGGCCTACA 21 TAAGAAAGGCTGGCACAGGT 22 Pax 6 CCGGCAGAAGATTGTAGAGC 23 CTAGCCAGGTTGCGAAGAAC 24 AFP CCGAACTTTCCAAGCCATAA 25 TGGCATTCAAGAGGGTTTTC 26 HNF4 α CAGGCTCAAGAAATGCTTCC 27 GTGCCGAGGGACAATGTAGT 28 Isl11 AAGGACAAGAAGAGAAGCAT 29 CATGGGAGTTCCTGTCATCC 30 GATA4 TCCAAACCAGAAAACGGAAG 31 AAGGCTCTCACTGCCTGAAG 32 Nkx2.5 CTAAACCTGGAACAGCAGCA 33 GTAGGCCTCTGGCTTGAAGG 34 cTnl CCAACTACCGCGCTTATGC 35 CTCGCTCCAGCTCTTGCTTT 36 MLC2v CCTTGGGCGAGTGAACGT 37 GGGTCCGCTCCCTTAAGTTT 38 MYH7 GGCAAGACAGTGACCGTGAAG 39 CGTAGCGATCCTTGAGGTTGTA 40 CACNA1D GGGCAATGGGACCTCATAAATAA 41 TTACCTGGTTGCGAGTGCATTA 42 HCN4 GACCGCATTGGCAAGAAGAAC 43 GGGCCATCTCCCGGTCAT 44 CAPN1 CCAAGCAGGTGAACTACCGA 45 GGTCCACGTTGTTCCACTCT 46 CAPN2 GCAGGAACTACCCGAACACA 47 TGCTTCTGAATGAGCCCCAC 48 CAPN3 GTCAACGACGCAGGATTCCA 49 GAACATGCCCTCCAGCCTAA 50 CAST CTGCAATATCTGGCAAGCCG 51 ATCCATGCCTGACTTTCCCG 52 CAV3 CTTTGACGGCGTGTGGAAGGT 53 ACCGCCCAGATGTGGCAGA 54 HSP70 GGTATAAGAGGCAGGGTGGC 55 GACATGGTTGCTGGGGTGTA 56 HSP90 ATGATTGGCCAGTTCGGTGT 57 GGTTCACCTGTGTCTGTCCT 58 UBB ATTTAGGGGCGGTTGGCTTT 59 TGCATTTTGACCTGTTAGCGG Genomic 60 Oct-4 AGTGAGAGGCAACCTGGAGA 61 AGGAACTGCTTCCTTCACGA 62 Nanog CAGAAGGCCTCAGCACCTAC 63 AGGAACTGCTTCCTTCACGA 64 c-Myc TCAAGAGGCGAACACACAAC 65 AGGAACTGCTTCCTTCACGA 66 Sox-2 ACCAGCTCGCAGACCTACAT 67 CCCCCTGAACCTGAAACATA 68 KLF4 CCCACACAGGTGAGAAACCT 69 CCCCCTGAACCTGAAACATA 70 EBNA-1 ATCGTCAAAGCTGCACACAG 71 CCCAGGAGTCCCAGTAGTCA
(99) Abbreviations: KCNH2: potassium voltage-gated channel subfamily H member 2; Oct-4: Octamer-4; SOX2: SRY (sex determining region Y)-box 2; Nanog: Nanog homeobox; Nestin: Nestin; Pax 6: paired box 6; AFP: alpha-fetoprotein; HNF4a: hepatocyte nuclear factor 4, alpha; Isl1: Islet-1; GATA4: GATA binding protein 4; NKX2.5: NK2 transcription factor related, locus 5 (Drosophila); cTnI: cardiac troponins I; MLC2v: Myosin light chain 2, ventricular; MYH7: Myosin heavy chain 7; CACNA1D: voltage-gated calcium channel alpha subunit Cav1.3; HCN4: hyperpolarization activated cyclic nucleotide-gated potassium channel 4; GADPH: glyceraldehyde-3-phosphate dehydrogenase; CAPN1/2/3: calpain 1/2/3; CAST: calpastatin; CAV3: caveolin-3; HSP70/90: heat shock protein 70/90; UBB: ubiquitin B; c-Myc: myelocytomatosis viral oncogene homolog; KLF-4: Kruppel-like factor 4; EBNA1: Epstein-Barr virus nuclear antigen 1.
(100) Real-Time PCR.
(101) For real-time reverse-transcription polymerase chain reaction (qRT-PCR) analysis, RNA was isolated with the RNeasy kit (Qiagen GmbH, Hilden, Germany). One μg of total RNA was converted to complementary DNA by Superscript III first-strand synthesis system (Invitrogen, CA, USA). cDNA template (5 ng) was used from each sample and SYBR green real-time PCR studies were performed using Quantifast kit (Qiagen GmbH, Hilden, Germany) and primer (Supplementary table 1) as per the kit instructions. Samples were cycled with RotorGene Q (Qiagen GmbH, Hilden, Germany) as follows: 5 minutes at 95° C., followed by 40 cycles of 10 seconds at 95° C. and 30 second extension at 60° C. All experiments were performed in triplicates. Relative quantification was calculated according to the ΔΔCt method for quantitative real-time PCR (using an endogenous control gene, GAPDH). For each gene, the expression at a specific day was then normalized by its baseline values. For genomic DNA PCR, genomic DNA was extracted using QIAamp DNA kit (Qiagen GmbH, Hilden, Germany) as per the manufacturer's instructions. One hundred nanograms genomic DNA was used for PCR and 30 cycles of 95° C. for 15 sec, 60° C. for 30 sec and 72° C. for 30 sec, with initial deactivation at 95° C. for 5 min and final extension at 72° C. for 7 min was performed in GeneAmp PCR system 2700 (Applied Biosystems, USA). PCR products were electrophoresed in 1.5% agarose gel with ethidium bromide (Sigma-Alrich, MO, USA) and bands were visualized and recorded using Geldoc XR (Bio-Rad, USA).
(102) Restriction Enzyme Digestion
(103) PCR amplification for KCNH2 gene was performed as mentioned above from cDNA and the product was cleaned using Qiagen PCR clean-up kit (Qiagen GmbH, Hilden, Germany) and overnight digestion with ApaL1 (Fermentas, USA) performed as per manufacturer's instruction. The digested PCR products were electrophoresed in 3% agarose gel with ethidium bromide (Sigma-Alrich, MO, USA) and bands were visualized and recorded using Geldoc XR (Bio-Rad, USA).
(104) Pyrosequencing
(105) Pyrosequencing was performed using PSQ 96HS system (Qiagen GmbH, Hilden, Germany) by EpigenDX (EpigenDX Inc, MA, USA), and analysis was performed as per manufacturer's recommended protocol.
(106) Western Blots and Co-Immunoprecipitation (IP)
(107) Contracting cardiomyocyte clusters from all groups were collected and lysed in RIPA buffer (Thermo Scientific, USA). Protein concentration was estimated using Pierce BCA protein Assay kit as per the manufacturer's instruction (Thermo Scientific, USA). Equal amounts of protein (15 μg) were loaded on a gradient 4-12% Bis-Tris NuPage Gel (Life Technologies, USA) and run at 200V for 35 min and dry transferred to nitrocellulose (NC) membrane using iBlot (Life Technologies, USA) as per manufacturer's instruction. NC membranes were blocked with 5% BSA for 1 hour and probed overnight with respective primary antibodies, mouse monoclonal anti-Hsp70 (1:5000; Abcam, USA), mouse monoclonal anti-Hsp90 (1:1000; Abcam, USA), calpastatin (1:500; Millipore, MA, USA), rabbit polyclonal Anti-hERG (1:200; Abcam, USA), mouse monoclonal Anti-cardiac troponin T (1:5000; US Biologicals, USA), mouse monoclonal Anti-β-actin (1:10000; Abcam, USA), mouse monoclonal anti-Calpain 3 (1:500; Abcam, USA). Post-probing, the NC membranes were washed with 0.1% PBST (Phosphate buffered saline with tween 20) and NC membranes were probed with respective mouse or rabbit secondary antibody conjugated with HRP (Amersham, USA) for 1 hour. Membranes were washed with PBST and developed using Amersham ECL kit (Amersham, USA) as per manufacturers' instruction. Images were captured using CCD camera. Denstitometric analysis was performed using ImageJ software and values were normalized with loading control (β-actin). Data presented is a mean of 3 independent experiments.
(108) Co-Immunoprecipitation was performed using Dynabead Co-IP kit (Life Technologies, USA) as per the manufacturers' instructions. Briefly, Dynabeads were conjugated with hERG antibody overnight, washed and incubated with cell lysate for 1 h and subsequently hERG protein complexes were eluted. This complex was run on conventional 4-12% Bis-Tris NuPage Gel (Life Technologies, USA), transferred on NC membrane, blocked and immunoblotted (IB) with hsp70 antibody followed by secondary conjugated HRP antibody. The membranes were developed using Amersham ECL kit as per manufacturers' instruction. Images were captured using C-digit blot-scanner (LI-COR, USA).
(109) Live Labelling of CMs with Smartflare™ RNA Probes
(110) Single CMs were plated on 0.1% gelatin coated dishes in normal EB2 medium and incubated overnight with MLC2v Smartflare™ RNA probes at per the manufacturer's instruction (Merk Millipore, USA). Next day, cells were washed with PBS to remove excess of the probes and replaced with fresh EB2 medium. Slides were examined under Fluorescence microscope.
(111) Contracting cells that were Cy3 positive were considered to be MLC2v positive (Ventricular) and other contracting cells were considered to be a mixture of atrial and nodal populations. These ventricular cells were used for patch clamp studies.
(112) Microelectrode Array (MEA) Recordings
(113) To characterize the electrophysiological properties of the hiPS-CMs, a microelectrode array (MEA) recording system (Multichannel Systems, Reutlingen, Germany) was used as described previously. Briefly, contracting areas were micro-dissected and plated on MEA plates, allowed to adjust for 72 hrs before recording. All clusters were monitored for their beating abilities (beats/min) under the microscope during the 72 hr period. Clusters that maintained relatively uniform beating rates were then subjected to drugs. The MEA system allows simultaneous recordings from 60 titanium nitride-coated gold electrodes (30 μm) at high spatial (200 μm) and temporal (15 kHz) resolutions. All stock drugs were diluted in medium (2 mL) to assess the effects on the electrophysiological properties. The stock drugs were diluted in medium (2 mL). MEA clip along with the beating clusters was maintained on 37° C. throughout the duration of experiments. Care was also taken that all buffers including the medium utilized during all experimentation were pre-warmed to 37° C. All tested drugs were procured from Sigma-Aldrich, MO, USA. All extracellular recordings were performed for 180 seconds at baseline and at 5 minutes after drug application at 37° C. Data were recorded using MC Rack software (Multichannel System) and the recordings were used to determine the local field potential duration (FPD). FPD measurements were normalized (corrected FPD [cFPD]) to the beating rate of the contracting areas with the Bazzet correction formula: cFPD=FPD/√(RR interval).
(114) Whole Cell Patch-Clamp Recordings
(115) Spontaneously contracting embryoid bodies were enzymatically dissociated into single cells with 1 mg/ml collagenase IV and attached on glass bottom dishes. Action potentials were recorded in the current clamp mode, and triggered with just-threshold 4 ms current steps at a stimulation rate of 1 Hz until a steady-state was reached with external buffer at 37° C. The external solution contained 138 mM NaCl; 4 mM KCl; 1 mM MgCl.sub.2; 2 mM CaCl.sub.2; 0.33 mM NaH2PO.sub.4; 10 mM glucose, and 10 mM HEPES (pH 7.4 with NaOH). The pipette solution consisted of 120 mM potassium glutamate; 25 mM KCl; 1 mM MgCl.sub.2; 1 mM CaCl.sub.2 and 10 mM HEPES (pH 7.4 with KOH). Whole patch clamp recording were performed with an Axopatch 700B amplifier (Axon Instrument, Foster City, Calif., USA). Data was acquired and analyzed using pClamp software (Version 10.0; Axon Instrument). For voltage-clamp studies of I.sub.Kr, the external solution contained 132 mM NaCl; 4 mM KCl; 1.8 mM CaCl.sub.2; 1.2 mM MgCl.sub.2; 5 mM glucose, and 10 mM HEPES (pH 7.4 with NaOH). The pipette solution contained 140 mM KCl; 4 mM Mg-ATP; 1 mM MgCl.sub.2; 5 mM EGTA, and 10 mM HEPES (pH 7.2 with KOH). Nimodipine (1 mM) was added to the external solution to block the L-type Ca.sup.2+ current. Na.sup.+ and T-type Ca.sup.2+ currents were inactivated by holding potential of −40 mV. I.sub.Kr was defined as the E-4031-sensitive (1 μM) current. The holding potential was at −40 mV to +50 mV in 10 mV increments, lasting 5 seconds. Tail current was recorded after the test potential was backed to −40 mV.
(116) Statistical Analysis.
(117) Results were reported as mean±standard error of mean (SEM). Comparison between LQTS2 hiPSC-CMs and healthy control hiPSC-CMs groups was performed using the Student's t-test. One-way ANOVA followed by Tukey's post-hoc tests were used when comparing multiple groups. p<0.05 was considered statistically significant.
(118) Results
(119) Generation and Characterization of LQTS2 hiPSC
(120) Dermal fibroblasts were collected from a 13-year old male (only child of the family), who presented clinical episode of polymorphic ventricular tachycardia (
(121) Cardiac Characterization and Electrophysiology of LQTS2
(122) Cardiac differentiation in control- and LQTS2-hiPSCs via EBs towards cardiomyocytes (CM) was performed. Spontaneously contracting areas were visible 12-14 days post-differentiation via EB based protocol in control- and LQTS2-hiPSCs with similar efficiencies. Positive staining of dissociated contracting clusters with sarcomeric α-actinin, myosin light chain-2, titin and SERCA2a, confirmed cardiac morphology (
(123) We then performed cardiac electrophysiology in control- and LQTS2-CMs at single cell level using patch clamp technique and evaluating functional syncytium at multicellular levels by microelectrode array. MLC2v specific Smartflare™ RNA detection probes were utilized to identify ventricular myocytes (
(124) TABLE-US-00002 TABLE 2 Characterization of action potential of cardiomyocytes. n APD.sub.50 (ms) APD.sub.70 (ms) APD.sub.90 (ms) APA (mV) Vmax (V/s) RP (mV) Control Ventricular 7 332 ± 14.6 468 ± 21.8 600 ± 27.7 97.5 ± 2.2 24.9 ± 8.9 −53.3 ± 2.3 Atrial 5 175 ± 17.7 240 ± 22.6 306 ± 29.2 83.7 ± 1.5 25.4 ± 7.6 −51.7 + 2.6 LQTS2 Ventricular 7 633 ± 24.2* 890 ± 30.2* 1144 ± 38.8* 101.9 ± 1.6 23.6 ± 5.0 −52.8 ± 2.5 Atrial 5 331 ± 22.1* 460 ± 31.2* 599 ± 38.6* 84.3 ± 1.0 27.6 ± 6.8 −53.5 ± 2.3 LQTS2 + ALLN Ventricular 7 388 ± 16.2# 534 ± 20.5# 702 ± 29.6# 103.3 ± 1.6 25.3 ± 4.0 −52.7 ± 2.3 Atrial 5 228 ± 19.2# 320 ± 27.9# 406 ± 34.4# 84.9 ± 2.0 23.8 ± 4.0 −51.2 ± 2.6
(125) Action-potential recordings from the healthy control- and LQTS2 hiPSCs-derived cardiomyocytes following 1 Hz pacing. Results show APA (action potential amplitude); RP (resting membrane potential); APD-50/70/90 (action potential duration 50/70/90) and Vmax (upstroke velocity max). *p<0.001 compared to controls; #p<0.001 compared to LQTS2.
(126) Consistent with single cell patch-clamp studies, extracellular field potential recordings of the LQTS2-EBs (
(127) Furthermore, in single cell voltage-clamp studies, LQTS2 ventricular myocytes (detected using MLC2v Smartflare™ RNA detection probes, n=9) showed a substantially reduced E-4031 (a specific I.sub.Kr blocker)-sensitive currents (
(128) Consistent with single cell patch-clamp studies, extracellular field potential recordings of the LQTS2-EBs (n=20;
(129) Contracting EBs from control and LQTS2 were also evaluated with drugs that may ameliorate or aggravate the disease phenotype (Patel C, et al., Pharmacology & therapeutics 2008; 118:138-151). 100 nM E-4031, a methanesulfonanilide class III antiarrhythmic agent known to inhibit KV11.1 (hERG) channels, increased cFPDs significantly in both cell types, but LQTS2-contracting EBs demonstrated pronounced occurrence of early after-depolarizations (EADs; n=14/15;
(130) LQTS2 Myocytes Express More Mutant Allele and Non-Glycosylated hERG
(131) In order to correlate electrophysiological changes in LQTS2-CMs with dysfunctional hERG, we performed PCR and observed that the mutant KCNH2 allele was significantly overexpressed in comparison to wild-type allele in LQTS2-CMs (
(132) This allelic dominance was consistent with LQTS2-CMs hERG western blots that showed more non-glycosylated (immature) hERG as compared to controls (
(133) Chaperone and Trafficking Defects in LQTS2-CMs
(134) To confirm hERG trafficking dysfunction, we investigated key players in calpain and proteosomal systems that are integral in protein trafficking. Quantitative gene expression analysis of LQTS2-CMs showed a significant upregulation of Ca.sup.2+-activated cysteine protease family (Calpain) members, CAPN1 (2.5-folds), CAPN2 (2-folds) and CAPN3 (1.5-folds) compared to controls (
(135) Re-Trafficking of hERG by ALLN
(136) As trafficking was implicated in our results, the LQTS2-CMs were treated with 10 μM ALLN (N—[N—(N-Acetyl-L-leucyl)-L-leucyl]-L-norleucine; C.sub.20H.sub.37N.sub.3O.sub.4), a known Calpain 1/2 and proteasome inhibitor. Post-ALLN treatment (42 h), western blots showed a significant increase in glycosylated (mature) hERG in LQTS2-CMs as compared to untreated LQTS2-CMs (
(137) ALLN Rescued LQTS2-CM Show Phenotypic Correction of Repolarization
(138) Next, we evaluated if hERG re-trafficking induced by ALLN could reduce prolonged repolarization of LQTS2-CMs. MEA recordings of ALLN-treated LQTS2-EBs clearly demonstrated a time-dependent reduction in cFPDs as compared to untreated LQTS2-EBs (
(139) Single cell current-clamp recordings showed a marked reduction (1.5-fold) in APD.sub.70/90 in both ventricular as well as atrial myocytes (
(140) Discussion
(141) In this study, we isolated skin fibroblasts from a patient carrying an autosomal dominant missense KCNH2 mutation with C1682T (A561V) substitution in the S5 transmembrane domain (Ficker E, et al., Journal of molecular and cellular cardiology 2000; 32:2327-2337) that is implicated in trafficking defective LQTS2.
(142) Similar to other KCNH2 mutations, A561V has been associated with variable clinical penetrance ranging from 25 to 90% (Priori S G, et al., Circulation 1999; 99:529-533; Napolitano C, et al., Circulation 1997; 96(suppl I):I-212; Priori S G, et al., Circulation 1999; 99:518-528). More interestingly, contrary to other known KCNH2 mutations (Anderson C L, et al., Circulation 2006; 113:365-373), A561V mutant has been reported to be not responsive to pharmacological rescue (Ficker E, et al., Journal of molecular and cellular cardiology 2000; 32:2327-2337; Ficker E, et al., Circulation research 2003; 92:e87-100) and insensitive to temperature-mediated functional recovery (Anderson C L, et al., Circulation 2006; 113:365-373). The amino acid at position 561 is a hot-spot for LQTS2 mutations (Schwartz P J, et al., Circulation, 1997: I-212; Dausse E, et al., Journal of molecular and cellular cardiology 1996; 28:1609-1615) where 2 other known mutations at A561P and A561T were similarly reported to lead to drastic reduction in I.sub.Kr currents (Ficker E, et al., Journal of molecular and cellular cardiology 2000; 32:2327-2337). Previous studies (Matsa E, et al., Eur Heart J 2011; 32:952-962) have demonstrated that KCNH2 mutants hiPSC-CMs treated with channel modulators could shorten action potential durations. Alternative approaches that target mutants with defective channel assembly that are insensitive to known pharmacological rescue (Ficker E, et al., Journal of molecular and cellular cardiology 2000; 32:2327-2337), such as A561V mutant in this study, would help to better understand diversity of LQTS2 manifestations.
(143) LQT2 hiPSC cardiomyocytes exhibited prolonged APD/cFPD and showed increased sensitivity to isoproterenol with frequent occurrence of EADs. Moreover, more than 75% of the beating clusters demonstrated spontaneous arrhythmogenic contractions. This high spontaneous arrhythmogenicity could be attributed to 90% reduction in I.sub.Kr currents as shown by our voltage-clamp studies. Similarly, hiPSC derived cardiomyocytes with A614V (in the pore region, transmembrane domain) (Itzhaki I, et al., Nature 2011; 471:225-229) and R176W mutations (N-terminal mutation, non-transmembrane domain) (Lahti A L, et al., Dis Model Mech. 2012; 5:220-230) demonstrated 72% and 43% reduction in I.sub.Kr currents, which corroborated with their reported arrhythmogenic frequencies of 66% and 5% respectively.
(144) Reduced amplitude of I.sub.Kr currents in LQTS2-CMs may be due to impaired channel conductance as well as decreased presence of sarcolemmal hERG channels. The observed reduced membrane hERG by immunostaining and western blots corroborate well with these drastically reduced I.sub.Kr currents (80-90%). Such reduction of functional hERG would translate to prolonged APD/cFPD and arrhythmogenesis (75%). Similar to our observations, studies with A614V and R176W mutations showed 72% and 43% I.sub.Kr currents reduction that corroborated their arrhythmogenic frequencies of 66% and 5% respectively.
(145) Heterologous expression systems (Ficker E, et al., Journal of molecular and cellular cardiology 2000; 32:2327-2337; Kagan A, et al., J Biol Chem 2000; 275:11241-11248) have implicated that ER-sequestering of hERG (Thomas D, et al., Cardiovascular research 2003; 60:235-241; Ficker E, et al., Journal of molecular and cellular cardiology 2000; 32:2327-2337) as a probable cause of LQTS2 manifestation, though the mechanistic pathways in cardiomyocytes remained unclear. Our results support the observations that in healthy CMs, hERG in ER is tagged with HSP70, folded by HSP90 and routed to the sarcolemma via the Golgi complex (Thomas D, et al., Cardiovascular research 2003; 60:235-241). To maintain healthy sarcolemmal hERG turnover, CAV3 works along Nedd4-2 (Guo J, et al., J Biol Chem 2012; 287:33132-33141) in concert with reduced levels of CAPN1 and CAPN2. However, in LQTS2-CMs, CAPN1 and CAPN2 (well-known in cardiovascular diseases (Sorimachi H, et al., Cardiovascular research 2012; 96:11-22) and linked to cell death (Goncalves I, et al., BMC cardiovascular disorders 2009; 9:26; Gill C, et al., FASEB journal: official publication of the Federation of American Societies for Experimental Biology 2002; 16:135-146)) were upregulated, though their inhibitor, calpastatin (Smith M A, et al., Cardiovascular research 2012; 96:32-37), suppresses activation of calpains and prevents cell death. Furthermore, heightened expression of HSPs, UBB and CAV3 indicates elevated proteasomal activity as a result of misprocessed/sequestered hERG due to A561V mutation.
(146) Unlike LQTS2-CMs, such changes were not observed in undifferentiated LQTS2-hiPSCs or patient fibroblasts, suggesting expression of hERG channels and their defective trafficking is primarily manifested in cardiomyocytes, but not necessarily in other cell types. Comparing to cardiomyocytes, hERG expressed by heterologous systems is often present at supraphysiological levels that may skew its relationship with the normal trafficking machinery (Bellin M, et al., EMBO J 2013; 32:3161-3175). Such idiosyncratic responses in cardiomyocytes suggest that non-cardiac heterologous expression systems of hERG may not be ideal in representing bona fide cardiac channelopathies. Our results support that A561V mutant of LQTS2, similar to the majority of other known hERG mutations, may be manifesting through defective channel trafficking (Thomas D, et al., Cardiovascular research 2003; 60:235-241).
(147) To reverse the trafficking-induced defects, LQTS2-CMs treated with ALLN blocked calpain and proteosomal complex, reducing HSP70 and CAV3 expression levels, indicative of attenuated hERG tagging (Thomas D, et al., Cardiovascular research 2003; 60:235-241; Ficker E, et al., Circulation research 2003; 92:e87-100) and reduced turnover (Guo J, et al., J Biol Chem 2012; 287:33132-33141) respectively. This resulted in misfolded hERG escaping HSP70/90 checkpoints and being re-trafficked to the membrane. Indeed, changes in the HSP70/90 relationship and associated ubiquitination in channel maturation of hERG mutants have been previously demonstrated (Iwai C, et al., Cardiovascular research 2013; 100:520-528). This together with decreased CAV3-mediated hERG turnover resulted in an increased sarcolemmal hERG and may result in an increased retention of glycosylated hERG as shown by our western blots.
(148) In this study we, for the first time, demonstrate that functionality of the re-trafficked hERG channels by ALLN was able to increase I.sub.Kr currents and reduce cFPD in the LQTS2-CMs with alleviated spontaneous arrythymogenic episodes by voltage-clamp and MEA studies. While V.sub.1/2 activation did not change significantly, the slope factor of activation was significantly modified, demonstrating alterations of the hERG channel gating kinetics by A561V mutation and its reversal by ALLN treatment.
(149) The mechanism of differential KCNH2 allelic dominance observed in this study remains unclear. Selective expression of mutant allele in hiPSC-CMs, but not undifferentiated hiPSC, would likely accentuate the dominant-negative effect of this A561V mutant. It is uncertain if our observation of such cell-type specific activation pattern of allelic gene expression has a role in phenotypic heterogeneity of LQTS2. Nevertheless, previous studies had indicated that gene dosage as one of the important determinants of LQTS2 phenotype (Priori S G, et al., Circulation 1999; 99:518-528), which along with other unidentified modifiers, may contribute to differential clinical penetrance of the disease that warrants specific attention in future studies.
(150) Pharmacological re-trafficking of sequestered hERG by ALLN, as demonstrated in our study, could be useful clinically, as similar re-routing strategy against misfolded F508del-CFTR in cystic fibrosis has been promising and entered Phase 3 clinical trial recently. In summary, we demonstrate the ability of hiPSC technology to recapitulate LQTS2 phenotype in vitro. Ion channel modulators and pharmacological chaperones have proven ineffective in modulating disruption of hERG function by A561V mutation (altered pore stability (Bellocq C, et al., Mol Pharmacol 2004; 66:1093-1102)). Our results on re-trafficking of hERG demonstrate an alternative strategy that intervenes prolonged repolarization durations and suppresses arrhythmogenesis in LQTS2-CMs. ALLN as a broad-spectrum inhibitor of the ubiquitin-proteasome pathway may open a platform for developing specific cellular targets, such as HSP70 (Leu J I, et al., Mol Cell 2009; 36:15-27), along the trafficking pathway of hERG. This strategy may have an advantage in targeting re-trafficable KCNH2 missense mutations in non-pore forming regions of hERG channel that represent the majority of LQTS2 mutations (Thomas D, et al., Cardiovascular research 2003; 60:235-241), as well as other channelopathies that are attributable to similar trafficking defects.
(151) Throughout this specification, unless the context requires otherwise, the word “comprise” or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or method step or group of elements or integers or method steps but not the exclusion of any element or integer or method step or group of elements or integers or method steps. In this regard “comprises” includes within its scope “consists essentially of” and “consists of” the stated features.
(152) Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.
REFERENCES
(153) Anderson C L, Delisle B P, Anson B D, Kilby J A, Will M L, Tester D J, Gong Q, Zhou Z, Ackerman M J, January C T. Most LQT2 mutations reduce Kv11.1 (hERG) current by a class 2 (trafficking-deficient) mechanism. Circulation 2006; 113:365-373. Bellin M, Casini S, Davis R P, D'Aniello C, Haas J, Ward-van Oostwaard D, Tertoolen L G, Jung C B, Elliott D A, Welling A, Laugwitz K L, Moretti A, Mummery C L. Isogenic human pluripotent stem cell pairs reveal the role of a KCNH2 mutation in long-QT syndrome. EMBO J 2013; 32:3161-3175. Bellocq C, Wilders R, Schott J J, Louerat-Oriou B, Boisseau P, Le Marec H, Escande D, Baro I. A common antitussive drug, clobutinol, precipitates the long QT syndrome 2. Mol Pharmacol 2004; 66:1093-1102. Dausse E, Berthet M, Denjoy I, Andre-Fouet X, Cruaud C, Bennaceur M, Faure S, Coumel P, Schwartz K, Guicheney P. A mutation in HERG associated with notched T waves in long QT syndrome. Journal of molecular and cellular cardiology 1996; 28:1609-1615. Elbashir S M, Harborth J, Weber K, Tuschl T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 2002; 26(2):199-213. Ficker E, Dennis A T, Obejero-Paz C A, Castaldo P, Taglialatela M, Brown A M. Retention in the endoplasmic reticulum as a mechanism of dominant-negative current suppression in human long QT syndrome. Journal of molecular and cellular cardiology 2000; 32:2327-2337. Ficker E, Dennis A T, Wang L, Brown A M. Role of the cytosolic chaperones Hsp70 and Hsp90 in maturation of the cardiac potassium channel HERG. Circulation research 2003; 92:e87-100. Gill C, Mestril R, Samali A. Losing heart: the role of apoptosis in heart disease—a novel therapeutic target? FASEB journal: official publication of the Federation of American Societies for Experimental Biology 2002; 16:135-146. Goncalves I, Nitulescu M, Saido T C, Dias N, Pedro L M, J F E F, Ares M P, Porn-Ares I. Activation of calpain-1 in human carotid artery atherosclerotic lesions. BMC cardiovascular disorders 2009; 9:26. Guo J, Wang T, Li X, Shallow H, Yang T, Li W, Xu J, Fridman M D, Yang X, Zhang S. Cell Surface Expression of Human Ether-a-go-go-related Gene (hERG) Channels Is Regulated by Caveolin-3 Protein via the Ubiquitin Ligase Nedd4-2. J Biol Chem 2012; 287:33132-33141. Itzhaki I, Maizels L, Huber I, Zwi-Dantsis L, Caspi O, Winterstern A, Feldman O, Gepstein A, Arbel G, Hammerman H, Boulos M, Gepstein L. Modelling the long QT syndrome with induced pluripotent stem cells. Nature 2011; 471:225-229. Iwai C, Li P, Kurata Y, Hoshikawa Y, Morikawa K, Maharani N, Higaki K, Sasano T, Notsu T, Ishido Y, Miake J, Y. Y, Shirayoshi Y, Ninorniya H, Nakai A, Murata S, Yoshida A, Yamamoto K, Hiraoka M, Hisatome I. Hsp90 prevents interaction between CHIP and HERG proteins to facilitate maturation of wild-type and mutant HERG proteins. Cardiovascular research 2013; 100:520-528. Kagan A, Yu Z, Fishman G I, McDonald T V. The dominant negative LQT2 mutation A561V reduces wild-type HERG expression. J Biol Chem 2000; 275:11241-11248. Lahti A L, Kujala V J, Chapman H, Koivisto A P, Pekkanen-Mattila M, Kerkela E, Hyttinen J, Kontula K, Swan H, Conklin B R, Yamanaka S, Silvennoinen O, Aalto-Setala K. Model for long qt syndrome type 2 using human ips cells demonstrates arrhythmogenic characteristics in cell culture. Dis Model Mech. 2012; 5:220-230. Leu J I, Pimkina J, Frank A, Murphy M E, George D L. A small molecule inhibitor of inducible heat shock protein 70. Mol Cell 2009; 36:15-27. Matsa E, Rajamohan D, Dick E, Young L, Mellor I, Staniforth A, Denning C. Drug evaluation in cardiomyocytes derived from human induced pluripotent stem cells carrying a long QT syndrome type 2 mutation. Eur Heart J 2011; 32:952-962. Mehta A, Konala V B, Khanna A, Majumdar A S. Assessment of drug induced developmental toxicity using human embryonic stem cells. Cell Biol Int 2008; 32: 1412-1424. Mehta A, Mathew S, Viswanathan C, Sen Majumdar A. Intrinsic properties and external factors determine the differentiation bias of human embryonic stem cell lines. Cell Biol Int 2010; 34: 1021-1031. Mehta A, Chung Y Y, Ng A, Iskandar F, Atan S, Wel H, Dusting G, Sun W, Wong P, Shim W. Pharmacological response of human cardiomyocytes derived from virus-free induced pluripotent stem cells. Cardiovascular research 2011; 91:577-586. Napolitano C, Priori S G, Schwartz P J, Timothy K, Paganini V, Cantu F, Bloise R, De Fusco M, Spazzolini C, Casari G. Identification of a mutational hot spot in HERG-related long QT syndrome (LQT2): phenotypic implications. Circulation 1997; 96(suppl I):I-212. Patel C, Antzelevitch C. Pharmacological approach to the treatment of long and short QT syndromes. Pharmacology & therapeutics 2008; 118:138-151. Priori S G, Barhanin J, Hauer R N, Haverkamp W, Jongsma H J, Kleber A G, McKenna W J, Roden D M, Rudy Y, Schwartz K, Schwartz P J, Towbin J A, Wilde A M. Genetic and molecular basis of cardiac arrhythmias: impact on clinical management parts I and II. Circulation 1999; 99:518-528. Priori S G, Napolitano C, Schwartz P J. Low penetrance in the long-QT syndrome: clinical impact. Circulation 1999; 99:529-533. Sanguinetti M C, Tristani-Firouzi M. hERG potassium channels and cardiac arrhythmia. Nature 2006; 440:463-469. Schwartz P J, Moss A J, Priori S G, Wang Q, Lehmann M H, Timothy K, Denjoy I, Haverkamp W, Guicheney P, Paganini V, Scheinman M M, Karnes P S. Gene-specific influence on the triggers for cardiac arrest in the long QT syndrome. Circulation 1997: I-212. Shieh C C, Coghlan M, Sullivan J P, Gopalakrishnan M. Potassium channels: molecular defects, diseases, and therapeutic opportunities. Pharmacological reviews 2000; 52:557-594. Smith M A, Schnellmann R G. Calpains, mitochondria, and apoptosis. Cardiovascular research 2012; 96:32-37. Sorimachi H, Ono Y. Regulation and physiological roles of the calpain system in muscular disorders. Cardiovascular research 2012; 96:11-22. Thomas D, Kiehn J, Katus H A, Katie C A. Defective protein trafficking in hERG-associated hereditary long QT syndrome (LQT2): molecular mechanisms and restoration of intracellular protein processing. Cardiovascular research 2003; 60:235-241.