Disclosed is CD31.sup.shed for use as a molecular imaging target in the molecular imaging of an inflammatory condition. Administering the radiolabeled peptide P8RI as CD31.sup.shed ligand in different rat models of inflammation indeed showed that CD31.sup.shed is present on activated cells in a quantity allowing a detectable signal, whereas the noise signal corresponding to CD31.sup.shed present on activated circulating cells and on other organs or cells not involved in inflammation was little. Also disclosed is a labeled CD31.sup.shed ligand and the use thereof as a molecular imaging agent in the molecular imaging of an inflammatory condition. The molecular imaging of inflammatory sites particularly allows determining whether a subject suffers from or is at risk of having an inflammatory condition or is at risk of recurrence of an inflammatory condition after an anti-inflammatory treatment.

A container of pet food and an apparatus for preparing the pet food are disclosed. The apparatus includes a scanner for reading a pet food identifier on the container. The scanner is adapted to read the pet food identifier and provide it to a controller. The controller is adapted to obtain food preparation parameters from an external database and to cause the apparatus to then prepare the pet food according thereto. The containers has an identically-shaped periphery and the apparatus is adapted to receive that periphery such that each container is properly positioned regardless of the container's volume.

The present invention refers to a composition comprising a compound capable of reducing the expression of the Yin Yang-1 (Yy1) gene in cardiac cells of a human or animal subject with respect to the expression observed in the absence of the compound in said cells, wherein the compound is a RNA interference (RNAi) of the Yy1 gene, and wherein said composition is for use in a method of treatment of left ventricular (LV) dysfunction following myocardial infarction (AMI) in the subject, and wherein said composition is administered between 12 hours and 7 days after the onset of myocardial infarction (AMI) in the subject.

Compositions and methods for genetically modifying felines or feline cells are described. The compositions and methods are useful for knocking out all or a portion of a Fel d 1 gene from a feline genome. Feline cells and organisms in which all or a portion of the Fel d 1 gene is knocked out are also described. The compositions and methods may include reagents and procedures for CRISPR-Cas9-mediated genomic editing of Fel d 1.

The present invention provides a delivery technique for delivering a gene modification tool capable of providing a high gene modification efficiency in cells. The composition according to the present invention is a composition for inducing gene modification at a target gene locus in a cell, the composition containing 1) a compound represented by formula (I) or a salt thereof; 2) a structural lipid; and 3) a guide RNA or a DNA including a sequence encoding the guide RNA, and/or an RNA-guided nuclease or a nucleic acid including a sequence encoding the RNA-guided nuclease. In formula (I), n represents an integer of 2 to 5, R represents a linear C.sub.1-5 alkyl group, a linear C.sub.7-11 alkenyl group, or a linear C.sub.11 alkadienyl group, and wavy lines each independently represent a cis-type bond or a trans-type bond. ##STR00001##

The present disclosure provides dry and liquid compositions that include canine platelets and/or canine platelet-derived substances in dried form or rehydrated form from a dried form of canine platelets and/or canine platelet-derived substances, as well as processes for preparing such compositions. The disclosure also provides processes for making the compositions and methods of using the compositions for therapeutic, prophylactic, diagnostic, and research purposes, and kits comprising the compositions.

Disclosed herein are methods and compositions for genome editing of one or more loci in a rat, using fusion proteins comprising a zinc-finger protein and a cleavage domain or cleavage half-domain. Polynucleotides encoding said fusion proteins are also provided, as are cells comprising said polynucleotides and fusion proteins.

The present invention relates to a method for preparing a gene knock-out canine with use of somatic cell cloning technology, in particular relates to a method for preparing a gene knock-out canine with use of somatic cell cloning technology using a fusion liquid of low osmotic pressure together with autologous embryo transplanting.

A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

The present invention provides compositions and methods for the treatment or prevention of a neurological disease or disorder of the central nervous system (e.g., a storage disorder, lysosomal storage disorder, neurodegenerative disease, etc.) by reconstitution of brain myeloid cell and microglia upon transplantation of hematopoietic cells enriched in microglia reconstitution potential. The invention also provides compositions and methods for ablating and reconstituting microglia.