A compound, represented by formula (I):

##STR00001##

wherein R, R.sub.1, R.sub.2 and R.sub.4 are independently of one another a hydrogen atom or a C.sub.1-C.sub.6 linear or branched alkyl, or a C.sub.1-C.sub.6 linear or branched alkenyl, or a C.sub.1-C.sub.6 linear or branched alkynyl; R.sub.3 is a hydrogen atom, OR.sub.4 or a C.sub.1-C.sub.6 linear or branched alkyl, or a C.sub.1-C.sub.6 linear or branched alkenyl, or a C.sub.1-C.sub.6 linear or branched alkynyl; and n=4 to 11; its functions and isolation process thereof.

The present invention relates to a yeast cell producing at least one secreted protein of interest, wherein said cell comprises at least one additional fungal gene showing increased expression and/or overexpression, showing reduced expression and/or inactivation, wherein said gene improves the production of the at least one secreted protein of interest. The present invention further relates to respective methods for production and uses of the yeast cell.

Methods of production of edible filamentous fungal biomat formulations are provided as standalone protein sources and/or protein ingredients in foodstuffs as well as a one-time use or repeated use self-contained biofilm-biomat reactor comprising a container with at least one compartment and placed within the compartment(s), a feedstock, a fungal inoculum, a gas-permeable membrane, and optionally a liquid nutrient medium.

An endophytic fungus of Ophiopogon japonicus and use thereof provided. The endophytic fungus is isolated from the living Ophiopogon japonicus plants, an Ophiopogon plant of Liliaceae, by a traditional tissue block separation method, with a category name of Fusarium falciforme OJ106, and a deposit number of CGMCC No. 40703. The methylophiopogonanone B is prepared through the PDB liquid fermentation of endophytic fungus strains. The endophytic fungus of Ophiopogon japonicus is an important microorganism for searching for new resources of the methylophiopogonanone B, and has a high application value.

Sequence Listing

TABLE-US-00001 SEQIDNO.1 cgactttggtgtgcgggagggacattaccgagttatacaactcatc aaccctgtgaacatacctataacgttgcctcggcgggaacagacg gccccgtaacacgggccgcccccgccagaagaccccctaactctg tttctataatgtttcttctgagtaaacaagcaaataaattaaaac tttcaacaacggatctcttggctctggcatcgatgaaaaacgcag cgaaatgcgataagtaatgtgaattgcaaaattcagtgaatcatc gaatctttgaacgcacattgccccgacagtattctggcgggcatg cctgttcaagcgtcattacaaccctcaggcccccgggcctggcgt tggggatcggeggaagccccctgcgggcacaacgccgtcccccaa atacagtggcggtcccgccgcagcttccattgcgtagtagctaac acctcgcaactggagagcggcgcggccacgccgtaaaacacccaa cttctgaatgttgacctcgaatcaggtaggaatacccgctgaact taagcatatcaataagcggtagtta

A method of producing an active composition including (i) selecting a fermentation broth including a filamentous fungus, for example Fusarium venenatum; and (ii) removing water from said broth or a part thereof to produce a solid product, wherein said solid product is an active composition which may function as a viscosifier, gellator, foamer, foam stabiliser or emulsifier.

Methods of production of edible filamentous fungal biomat formulations are provided as standalone protein sources and/or protein ingredients in foodstuffs as well as a one-time use or repeated use self-contained biofilm-biomat reactor comprising a container with at least one compartment and placed within the compartment(s), a feedstock, a fungal inoculum, a gas-permeable membrane, and optionally a liquid nutrient medium.

Use of Fusarium brachygibbosum in the production of mycelial protein is provided, belonging to the technical field of microbial fermentation. It is proposed for the first time that the Fusarium brachygibbosum shows the characteristic of a high production yield of the mycelial protein that is significantly higher than that of other types of Fusarium reported so far. The mycelial protein produced by the Fusarium brachygibbosum is filamentous, flesh-colored, elastic, and toxin-free, serving as an ideal alternative protein. Therefore, the use provides a new means for industrial production of alternative proteins and a basis for the development of safe food. Moreover, the fermentation method in the use may greatly improve the production efficiency of the mycelial protein while reducing carbon emissions to protect the environment.

A novel method of growing fungi is disclosed which uses an engineered artificial media and produces high density filamentous fungi biomats that can be harvested with a minimum of processing and from which fungal products such as antibiotics, proteins, and lipids can be isolated, the method resulting in lowered fungus cultivation costs for energy usage, oxygenation, water usage and waste stream production.

The purpose of the present invention is to provide a method for producing selenoneine that allows production of selenoneine at higher yields, even if an inorganic selenium compound is used as a selenium compound. This purpose can be achieved by a method for producing selenoneine, comprising the step of applying histidine and a selenium compound to a transformant to obtain selenoneine, wherein the transformant has at least one gene selected from the group consisting of a SatA gene, a CysB gene and a MetR gene, and an EgtA gene inserted therein and can overexpress the inserted genes.

The invention relates to the field of fungal production of dyes and pigments and applying said fungal production of dyes for dyeing substrates. More specifically, the invention relates to an isolated fungus belonging to the species Fusarium solani deposited under the number DSM 34187, a dye produced by said fungus, a method for dyeing a substrate using said fungus, a method for dyeing a substrate using the dye produced by said fungus, a production method of said dye, and also further applications of said dye as an antimicrobial substance.