The invention relates to the production and use of Cas-encoding sequences and vectors comprising these. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas-encoding sequences in bacterial or archaeal cells.

Methods for treating a cell, tissue, or organ and for treating an age-related disease or condition are provided, where the cell, tissue or organ is contacted with a synthetic, persistent RNA vector comprising one or more heterologous polynucleotide sequences, each of the one or more heterologous polynucleotide sequences encoding for a reprogramming factor. Contacting achieves expression of the one or more reprogramming factors in the cell, tissue, or organ to treat the age-related disease or condition. In an embodiment, the method is used to obtain a rejuvenated cell, tissue, or organ with retention of cellular identity.

The present invention relates generally to a population of cells genetically modified to produce insulin in a glucose responsive manner and uses thereof. More particularly, the present invention relates to a population of cells genetically modified to produce insulin in response to physiologically relevant levels of glucose and uses thereof. The cells of the present invention are useful in a wide variety of applications, in particular in the context of therapeutic and prophylactic regimes directed to the treatment of diabetes and/or the amelioration of symptoms associated with diabetes, based on the transplantation of the cells of the present invention into mammals requiring treatment. Also facilitated is the design of in vitro based screening systems for testing the therapeutic effectiveness and/or toxicity of potential adjunctive treatment regimes.

The present invention relates to nucleic acid molecules comprising a nucleic acid sequence encoding a membrane-bound biotin mimetic peptide (BMP) or biotin acceptor peptide (BAP). The invention also relates to a method for selection of high producer cells secreting a protein of interest.

Herein is reported a nucleic acid comprising in 5′ to 3′ direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5′ splice donor site of an immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the 3′ splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a third nucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane domain, wherein the second nucleic acid fragment has at its 3′ terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

The present invention relates to adeno-associated viral (AAV) particles modulatory polynucleotides encoding at least one siRNA molecules and methods of use thereof.

The present invention relates to a nucleic acid expression cassette, in particular for the expression of a human liver-specific and/or liver-expressed protein and/or preferably physiologically active domains and/or fragments thereof in a patient suffering from a monogenetic disorder caused by a mutation in the gene coding for the liver-specific and/or liver-expressed protein.

The invention relates to the production and use of Cas-encoding sequences and vectors comprising these. Aspects of the invention provide products, vectors, delivery vehicles, uses and methods for producing Cas-encoding sequences in bacterial or archaeal cells.

The present disclosure provides methods and compositions for genetically modifying lymphocytes, for example T cells and/or NK cells. In some embodiments, the methods include reaction mixtures, and resulting cell formulations, that are created using whole blood, or a component thereof that is not a PBMC, and additionally comprise T cells and recombinant retroviral particles having polynucleotides that encode a CAR. In some embodiments, modified lymphocytes are reintroduced into a subject subcutaneously. In some embodiments, polynucleotides that provide T cells the ability to regulate cell survival and proliferation in response to binding to a CAR, are provided.

The invention concerns a multicistronic nucleic acid, in particular an isolated multicistronic nucleic acid, comprising: A) a sequence comprising successively: A1) a sequence encoding the light chain variable domain of an antibody of interest, fused in the frame with A2) a sequence encoding the constant region of the light chain of an immunoglobulin Ig; and B) a sequence comprising successively: B1) a sequence encoding the heavy chain variable domain of said antibody of interest, fused in the frame with B2) a sequence encoding the constant regions of the heavy chain of an immunoglobulin Ig′ in secretory form; B3) an intronic sequence of the gene of the heavy chain of said immunoglobulin Ig′, said intronic sequence comprising an internal 5′ splice site enabling the splicing of said intronic sequence B3) and a secretory-specific poly(A) (p AS) signal from the 3′ terminal exon of said gene; B4) a sequence, in frame with sequence B1), encoding the transmembrane and cytoplasmic domains M1 and M2 of the immunoglobulin Ig′ BCR, wherein said sequence B4) comprises, between the coding sequences of the M1 and M2 domains, an intronic sequence containing a splice site enabling the splicing of said intronic sequence between the M1 and M2 domains coding sequences; and B5) a membrane-anchored specific poly(A) signal (p AM), after the stop codon of the M2 domain, wherein the multicistronic nucleic acid enables the co-expression of the sequences A and B into separate proteins.