Green fluorescent protein (GFP) peptides from Rhacostoma
09771401 · 2017-09-26
Inventors
Cpc classification
C07K2319/60
CHEMISTRY; METALLURGY
International classification
Abstract
The present technology is directed to the nucleic acid molecule encoding novel fluorescent proteins, in particular, green fluorescent proteins (GFPs), such as those that may be isolated from an organism of genus Rhacostoma, as well as compositions comprising the same and methods for analyzing a physiologically active substance in a cell wherein the fluorescent proteins are expressed in the cell.
Claims
1. A fusion protein comprising a fluorescent protein linked to a polypeptide, the fluorescent protein comprising an amino acid sequence with at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 2.
2. The fusion protein of claim 1, wherein the fluorescent protein is a green fluorescent protein (GFP).
3. The fusion protein of claim 1, wherein the fluorescent protein is isolated from an organism of genus Rhacostoma.
4. A composition comprising the fusion protein of claim 1.
5. A monomer, dimer or tetramer of the fusion protein of claim 1.
6. The fusion protein of claim 1, wherein the fluorescent protein is encoded by a nucleic acid molecule comprising a nucleotide sequence that exhibits at least 80% sequence identity to the sequence of nucleotides set forth in SEQ ID NO: 1.
7. The fusion protein of claim 6, wherein the nucleic acid is optimized for expression in human cells, animal cells, bacterial cells, yeast cells, fungal cells, plant cells or insect cells.
8. The fusion protein of claim 6, wherein the nucleic acid is DNA or RNA.
9. A diagnostic composition comprising the fusion protein of claim 1.
10. A method comprising: cleaving a fusion protein having a fluorescent protein linked to a polypeptide and having a protease cleavage site, the fluorescent protein including an amino acid sequence with at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 2; and expressing the fluorescent protein in a cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION
(14) The present technology generally relates to novel fluorescent proteins, such as green fluorescent proteins (GFPs), which have found to be useful markers for gene expression; as well as compounds comprising such green fluorescent proteins and methods of preparing and using the same. In particular, in certain embodiments, the present technology is directed to methods and processes for preparing monomers and dimers of such fluorescent proteins.
(15) Herein, the nucleic acid sequences and the corresponding amino acid sequences of novel fluorescent proteins have been discovered and isolated. The novel fluorescent proteins may be derived from a previously uncharacterized jellyfish of the genus Rhacostoma, including Rhacostoma atlantica. In the GFPs derived in certain embodiments herein, the sequences were identified by PCR using degenerate primers corresponding to conserved amino acid regions of GFPs from other Leptomedusae. In certain embodiments, a resulting amino acid sequence has only a 55% identity with its closest match from a BLAST search. Expression in E. coli confirmed that the nucleic acid sequence encodes for a fluorescent protein.
(16) Rhacostoma GFP has an amino acid scaffold that is different from any of its taxonomic relatives. While some GFPs differ from others by as few as 2 amino acids, the GFP in certain embodiments herein differs from its nearest neighbor by more than 100 amino acids (45% dissimilar in amino acid sequence). A sequence comparison is shown in
(17) In a non-limiting example, a specimen of Rhacostoma atlantica was collected off the coast of New Jersey. Total RNA was isolated with a MasterPure Complete DNA and RNA Purification Kit (Epicentre) and a cDNA library was synthesized and amplified with a SMARTer PCR cDNA synthesis kit (Clonetech). Degenerate PCR primers were designed based on conserved amino acid regions of GFPs from other Leptomedusae. PCR was performed on the cDNA library with the degenerate primers and a PCR primer incorporating a poly T sequence to prime on the 3′ end of the cDNA molecule. PCR products were ligated into a pGEM vector and transformed into E. coli. Plasmids were prepared from the E. coli, sequenced, and examined for GFP like sequences. The resulting 3′ fragment of the DNA corresponding to the novel fluorescent protein was then used to design a set of reverse primers. In order to provide an additional 5′ template, the cDNA library was ligated into a pGEM vector. PCR was performed on the ligation mixture using a primer from the 3′ end of the DNA corresponding to the novel fluorescent protein and a primer corresponding to vector sequence at the 5′ end of the incorporation site. The resulting 5′ fragment of the DNA corresponding to the novel fluorescent protein was then used to generate a new set of forward primers. The full length sequence was obtained by PCR on the original cDNA library using a set of primers from the DNA corresponding to the novel fluorescent protein obtained above. The PCR product was cloned into a pGEM vector and sequenced.
(18) BLAST searches were performed with BLASTP (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402.) Sequence comparisons were performed with ClustalX (Larkin, M. A., Blackshields, G, Brown, N. P., Chenna, R., McGettigan, P. A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J. D., Gibson, T. J., Higgins, D. G. (2007) Clustal W and Clustal X version 2.0. Bioinformatics, 23:2947-2948.)
(19) For protein expression, the cDNA was subcloned into a pBAD vector between the Nde I and Kpn I sites. The resulting vector was used to transform E. coli DH10B cells which were then selected on plates with carbenicillin and L-arabinose. A fluorescent colony was selected and grown overnight at 37C in LB media with carbenicillin. The overnight culture was diluted 24-fold into fresh LB media with carbenicillin and allowed to grow for 3 hours at 37 degrees C. The culture was then induced with the addition of 0.1% L-arabinose and allowed to grow for 22 hours at room temperature.
(20) The fluorescent E. coli were harvested by centrifugation and the pellet resuspended in a 10 mM Tris pH 8.0 solution with 0.5 mg/ml lysozyme added. After repeated freeze-thaw cycles, the viscous supernatant was pulled through a series of small gauge needles to shear the DNA. Fluorescence excitation and emission spectra were collected and are shown in
(21) Purification
(22) Whole E. coli cells, transformed with the gene for native Rhacostoma GFP, and grown in 500 ml of medium in 2.8 L Fernbach flasks, were collected by centrifugation in a refrigerated (4 C) Sorvall centrifuge at 10,000 rpm in 250 mL bottles. The supernatants were discarded and the cell pellets were removed and suspended in an aqueous solution of 1.6 M ammonium sulfate, buffered with 50 mM Tris-HCl at pH 8.0. This buffer also contained 0.02% sodium azide to kill the cells and 0.1% PMSF to block serine proteases from degrading the GFP.
(23) The cell suspension was diluted in the above buffer to a sufficient extent for the next step, (three-phase partitioning), to be most effective. Each of sixteen 50-mL falcon tubes was filled to the 25 mL mark with this suspension. Then 25 mL of t-butanol was added. Each tube was shaken vigorously, by hand, for 60 seconds and then the samples were centrifuged at room temperature in the same Falcon tubes at 3700 rpm in a table-top swinging bucket centrifuge for 20 min. This step produced three distinct phases: (1) a clear, upper organic layer containing 5 mL of water that came from the aqueous ammonium sulfate solution (˜30 mL total volume); (2) a robust semi-solid disk (about 3 mm thick); and (3) a clear, green-fluorescent lower liquid phase (˜20 mL). The alcohol layer was aspirated away and the congealed, semi-solid disks were lifted out with a spatula. The lower phase was kept. This completes the first stage of three-phase partitioning (TPP).
(24) Fresh t-butanol (30 mL) was added to the aqueous layer, again with vigorous shaking. Further dehydration of the aqueous layer occurred. After centrifugation, as performed in Stage I, there was again an alcohol layer at the top of the tubes (˜33 or 34 mL), a paper thin, intensely green disk below, and an aqueous layer below this (˜16 mL), almost devoid of GFP. Both liquid layers were aspirated away leaving the thin green disk adhering to the side wall of each Falcon tube. This completes Stage II of TPP.
(25) Next, using a minimum volume of pH 8-buffered 1.6 M ammonium sulfate stock solution, the green disks were serially transferred into a single Falcon tube. Four to five rounds of washing with tiny volumes of stock solution were performed until the GFP was just barely dissolved. This solution was dispensed into 12 microfuge tubes that were then spun at 16,000 rpm for 10 min. This time, four phases appeared after centrifugation. From top to bottom, the following were observed: (1) a clear organic layer; (2) a thin, non-fluorescent white disk; (3) a brilliantly fluorescent, but clear, aqueous layer; and (4) a small pellet at the bottom of the tube. The fluorescent layer was pipetted out, taking care not to include any of the other three phases of material. This completes Stage III of TPP. An absorption spectrum showed the absorbance at 466 nm divided by the absorbance at 277 nm of about 0.87, with a recovery of 101.8 OD's at 466 nm.
(26) The whole TPP sample was applied to a Phenyl Sepharose FF column (16×70 mm=14 mL) in 1.6 M ammonium sulfate buffered to pH 8.0 with TrisHCl (start buffer). After 225 mL of washing with start buffer (16 bed volumes) the absorbance at 277 nm of the final 15 mL fraction had dropped to 0.076 O.D. Units.
(27) Following this extensive washing step, the ammonium sulfate concentration was dropped to 0.8 M causing the fluorescent protein to elute isocratically. Isocratic elution was continued until the OD 466 dropped to 0.032 (down 100-fold from the peak value of 3.31). After Phenyl Sepharose FF, only the earliest fractions and the terminally pulsed fractions (in dilute Tris buffer) had absorbance ratios significantly below 1.78. Those fractions were excluded from the pool. The absorption spectrum, shown in
(28) The molar extinction coefficient of the fluorescent protein was determined by estimating the chromophore concentration under alkaline conditions. The protein sample was mixed with 1/100 volume of 10 M NaOH and the concentration calculated based on a molar excitation coefficient of 44,100 M.sup.−1 cm.sup.−1 at 446 nm for the alkaline-denatured chromophore. (Ward, W. W. 1981. Properties of the coelenterate green fluorescent proteins. In Bioluminescence and Chemiluminescence: Basic Chemistry and Analytical Applications (M. A. DeLuca and W. D. McElroy, eds.) pp. 225-234.)
(29) To generate fluorescent color variants of Rhacostoma FP, we used a combination of site-directed and random mutagenesis. Mutation of threonine 203 to tyrosine in wt Aequorea GFP contributes, at least in part, to the formation of a yellow fluorescing protein (Tsien R Y. The green fluorescent protein. Annu Rev Biochem. 1998;67:509-44). The Phialidium yellow fluorescent protein (Shagin D A, Barsova E V, Yanushevich Y G, Fradkov A F, Lukyanov K A, Labas Y A, Semenova T N, Ugalde J A, Meyers A, Nunez J M, Widder E A, Lukyanov S A, Matz M V. GFP-like proteins as ubiquitous metazoan superfamily: evolution of functional features and structural complexity. Mol Biol Evol. 2004 May; 21(5):841-50. Epub 2004 Feb. 1), one of the closest related to Rhacostoma, also has a tyrosine in this position (
(30) Results/Description
(31) 1. We have identified the nucleic acid sequence and the corresponding amino acid sequence of a novel fluorescent protein similar that that found in Rhacostoma atlantica.
(32) 2. The novel fluorescent protein was successfully expressed in E. coli, demonstrating that the DNA sequence encodes a fluorescent protein. The fluorescence excitation and emission spectra of an E. coli extract expressing Rhacostoma GFP are shown in
(33) 3. Rhacostoma GFP has an absorption max at about 466 nm (
(34) 4. The excitation spectrum of the wild type Rhacostoma GFP is red shifted compared to wild type GFP from Aequorea victoria. The extinction coefficient at 466 is 58,000 M.sup.−1 cm.sup.−1.
(35) 5.
(36) The emission spectrum of the Rhacostoma FP, with a peak in the 495-500 region (
(37) In most of the naturally occurring GFP's, the amino acid found in position 68 of the chromophore possesses an R-group capable of hydrogen bonding to another amino acid. Often that amino acid is a serine. In virtually all cases, a hydrogen bond connects serine 68 to the highly conserved glutamic acid in position 223 (refer to the Rhacostoma numbering in
(38) But in Rhacostoma GFP, what is normally a hydrogen bonding amino acid in position 68 is, surprisingly, an alanine. Alanine cannot engage in hydrogen bonding. So, in the same way that tyrosine 68 in Phialidium GFP and EGFP permit “slack” in the tether, so does alanine in Rhacostoma GFP. So, it appears that the effect of alanine 68 mimics that of threonine 68 in Phialidium GFP and EGFP, thus the red shift in all three. Among the 8 GFP's in the
(39) The new fluorescent proteins developed herein have many uses that include, but are not limited to, the following:
(40) A. As a fluorescent molecular marker. The protein can be expressed in an organism or cell as a fusion protein with a second protein or under direct control of a gene regulator or promoter. The Rhacostoma protein is readily expressed in E. coli without the need to alter DNA triplet codes for any of the amino acids.
(41) B. In fluorescence resonance energy transfer (FRET) methods. The fluorescent protein can be an energy donor or acceptor. The Rhacostoma fluorescent protein is well suited to FRET studies because of its relatively narrow fluorescence emission spectrum (as shown in
(42) C. As a reporter molecule attached to a solid support or bead. For example, the protein can be attached to the plate or bead with a peptide linker containing a specific protease cleavage site. Cleavage with the specific protease can result in release of the subject fluorescent protein. The GFPs discussed herein can be used with a GFP-on-a-string protease assay, as discussed in U.S. Pat. No. 7,883,863.
(43) D. Mutagenesis studies. The Rhacostoma GFP sequence has been, before the present, an unexplored template for modification. Parameters for exploration include monomer/dimer equilibrium, wavelength of excitation and emission, extinction coefficient, quantum yield, pH sensitivity, rate of maturation, turnover rate, and photostability. The desired property is largely dependent upon the application. For example, a FRET assay may require a blue fluorescence, while in vivo imaging is improved with a far red fluorescence.
(44) Mutation studies have been explored. Some Rhacostoma mutations have been designed to generate a monomer protein and a protein with a green, yellow, or red emission. The wild type protein has been characterized with respect to its pH profile, expression level, stability, and monomer/dimer equilibrium. Some mutations have excitation spectra red shifted compared to the wild type protein, potentially overlapping more with the 488 nm argon laser line. Argon lasers are widely used in fluorescence instrumentation such as fluorescence-activated cell sorters. Fluorescent proteins can be useful in cell sorters, either as proteins expressed in the cell, or attached to antibodies or ligands that bind to the outside of the cell. Beads can also be used in cell sorters, using fluorescent proteins to identify the beads.
(45) Additional PCR Details
(46) The Advantage-HF 2 PCR Kit (Clontech Laboratories, Inc.) was used for amplifying DNA from the Rhacostoma cDNA library. The thermocycler used was a Minicycler from MJ Research. Unless otherwise stated, the primer concentration was 200 nM. A typical reaction was 94° C. for 90 seconds followed by 26 cycles of 30 seconds at 94° C., 30 seconds at 60° C., and 3 minutes at 72° C.
(47) Primers used for Rhacostoma Cloning 1.sub.st set PCR reactions—Rhacostoma library as template
(48) TABLE-US-00001 >smart_tail1 (SEQ ID NO: 5) GTGGTATCAACGCAGAGTACTTTTTTTTTTTTT >FP202-27 Leptomedusa_primer (SEQ ID NO: 6) HGGDRANNTHCCWGTWCCATGGBCWAC
(49) Primer FP202-27 was used at 2uM. The reaction was run as above with 26 cycles. The product was then re-amplified for an additional 15 cycles.
(50) 2.sub.nd set PCR reactions—template was Rhacostoma library ligated into pGEM
(51) TABLE-US-00002 >BGAL primer (SEQ ID NO: 7) TGACCATGATTACGCCAAGCTATTTAGGTG >712 (SEQ ID NO: 8) TGGTAGTGCAGTCATTCCACATCAACG >642 (SEQ ID NO: 9) CGGCAGTGATGTATTCCACCATCCTC
(52) Nested PCR reactions. The first reaction used a primer combination of BGAL/712 followed by BGAL/642 primers. Each was run with 26 cycles.
(53) 3.sub.rd set PCR—Rhacostoma library as template
(54) TABLE-US-00003 >13 (SEQ ID NO: 10) CAGCGAGCGATACATCACACACACC >28 (SEQ ID NO: 11) CACACACACCAAGAACATTCAAAGTTTCC >712 (SEQ ID NO: 9) TGGTAGTGCAGTCATTCCACATCAACG
(55) Nested PCR reaction 13/712 followed by 28/712, each at 25 cycles.
(56) 4.sub.th Set PCR reactions—subclone from pGEM into pBAD
(57) TABLE-US-00004 >NDE_145 (SEQ ID NO: 12) CAAACCCATATGAGCACTGGAAAGACTGG >KPN_145 (SEQ ID NO: 13) CGGGTACCTTATCCTCCTTTATTATAAGCAGTGTC
(58) The reaction was run as above but with 21 cycles.