Fluorescent probe and preparation method and use thereof

11209437 · 2021-12-28

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a fluorescent probe and a preparation process and the use thereof. The fluorescent probe is sensitive and specific to viscosity, and can be used for specific fluorescent labeling of proteins, and can also be used for quantification, detection or kinetic studies of proteins, and the imaging of cells, tissues and living bodies.

Claims

1. A fluorescent probe, which has a structure as shown in formula (I); ##STR00148## wherein, R is selected from ##STR00149## X.sub.1 is selected from hydrogen, a saturated aliphatic straight or branched alkyl group of 1 to 10 carbon atoms, ##STR00150## X.sub.2 is selected from —CH.sub.2CH.sub.2CH.sub.2— or —CH.sub.2CH.sub.2O—; the moiety B is selected from the following Formulas containing the thiophene ring: ##STR00151## ##STR00152## and wherein, R.sub.1 is hydrogen; R.sub.2 is selected from the group consisting of cyano, carboxyl, a heteroaryl group, or a modified alkyl group; when R.sub.2 is the heteroaryl group, the heteroaryl group is a 5- to 10-membered monocyclic or fused bicyclic ring containing at least one heteroatom selected from N, O, or S in the ring; when R.sub.2 is the modified alkyl group, said modified alkyl group is an alkyl group wherein any carbon atom or the carbon atom with the hydrogen atom thereon together contained is independently replaced with one or more groups selected from —O—, OH, —CO—, a secondary amino group; the modified alkyl group has 1 to 4 carbon atoms; R.sub.3 is cyano, or in formula (I), the structural part as shown in formula (I-2) has a structure represented by the following Formula (I-2-b): ##STR00153## wherein, R.sub.d is methyl or phenyl.

2. The fluorescent probe according to claim 1, wherein the R.sub.2 is selected from the following structures, or a bicyclic fused aromatic ring or fused aromatic heterocyclic ring formed by the following structures themselves or fused with each other: ##STR00154##

3. The fluorescent probe according to claim 1, characterized in that the fluorescent probe is selected from the following structures: ##STR00155## ##STR00156## ##STR00157## ##STR00158## ##STR00159## ##STR00160## ##STR00161## ##STR00162## ##STR00163## ##STR00164## ##STR00165## ##STR00166## ##STR00167## ##STR00168## ##STR00169## ##STR00170##

4. A process for preparing the fluorescent probe according to claim 1, comprising a step of reacting a fluorescent dye of formula (II) with a ligand and a linker: ##STR00171## wherein, after reaction, D′ forms —X.sub.2—NX.sub.1-group that bonds to the formula (II′) ##STR00172##

5. A fluorescent activated protein specific labeling method, comprising the following steps: contacting the fluorescent probe according to claim 1 with a target protein of a protein tag or a fusion protein tag, labeling reaction taking place at the ligand moiety of the fluorescent probe with the protein tag, and the fluorescent probe is labeled onto the protein tag; optionally, the fluorescent probe is covalently labeled on the protein tag; optionally, a reaction medium of the labeling reaction is selected from a pure protein solution, a cell lysate or an in situ medium in which the target protein of the protein tag or the fused protein tag is located; optionally, the in situ medium is intracellular media, organelle media, living tissue media, Hood or body fluids.

6. A probe kit comprising the fluorescent probe according to claim 1, optionally further comprising a biocompatible medium which is at least one selected from dimethyl sulfoxide, a buffer, and physiological saline; optionally the buffer is phosphate buffer.

7. A fluorescent activated protein specific labeling method, comprising the following steps: contacting the fluorescent probe according to claim 1 with a target protein of a protein tag or a fusion protein tag, labeling reaction taking place at the ligand moiety of the fluorescent probe with the protein tag, and the fluorescent probe is labeled onto the protein tag; optionally, the fluorescent probe is covalently labeled on the protein tag; optionally, a reaction medium of the labeling reaction is selected from a pure protein solution, a cell lysate or an in situ medium in which the target protein of the protein tag or the fused protein tag is located; optionally, the in situ medium is intracellular media, organelle media, living tissue media, blood or body fluids.

8. A fluorescent activated protein specific labeling method, comprising the following steps: contacting the fluorescent probe according to claim 2 with a target protein of a protein tag or a fusion protein tag, labeling reaction taking place at the ligand moiety of the fluorescent probe with the protein tag, and the fluorescent probe is labeled onto the protein tag; optionally, the fluorescent probe is covalent's/labeled on the protein tag; optionally, a reaction medium of the labeling reaction is selected from a pure protein solution, a cell lysate or an in situ medium in which the target protein of the protein tag or the fused protein tag is located; optionally, the in situ medium is intracellular media, organelle media, living tissue media, blood or body fluids.

9. A fluorescent activated protein specific labeling method, comprising the following steps: contacting the fluorescent probe according to claim 3 with a target protein of a protein tag or a fusion protein tag, labeling reaction taking place at the ligand moiety of the fluorescent probe with the protein tag, and the fluorescent probe is labeled onto the protein tag; optionally, the fluorescent probe is covalently labeled on the protein tag; optionally, a reaction medium of the labeling reaction is selected from a pure protein solution, a cell lysate or an in situ medium in which the target protein of the protein tag or the fused protein tag is located; optionally, the in situ medium is intracellular media, organelle media, living tissue media, blood or body fluids.

10. A probe kit, comprising the fluorescent probe according to claim 2, optionally, the probe kit further comprises a biocompatible medium; optionally, the biocompatible medium is at least one selected from dimethyl sulfoxide, a buffer, and physiological saline; optionally, the buffer includes phosphate buffer.

11. A probe kit, comprising the fluorescent probe according to claim 1, optionally, the probe kit further comprises a biocompatible medium; optionally, the biocompatible medium is at least one selected from dimethyl sulfoxide, a buffer, and physiological saline; optionally, the buffer includes phosphate buffer.

12. A probe kit, comprising the fluorescent probe according to claim 3, optionally, the probe kit further comprises a biocompatible medium; optionally, the biocompatible medium is at least one selected from dimethyl sulfoxide, a buffer, and physiological saline; optionally, the buffer includes phosphate buffer.

13. The fluorescent probe according to claim 1, wherein, the structure of the Formula (I-2) is selected from the group consisting of the following Formulas: ##STR00173## ##STR00174## ##STR00175##

14. The fluorescent probe according to claim 1, wherein said modified alkyl group is a group containing one or more substituents from C.sub.1 to C.sub.4 alkyl groups, —O—, —O—CO—, or —NH—CO—.

15. The fluorescent probe according to claim 14, wherein the C.sub.1 to C.sub.4 alkyl groups are methyl, ethyl, propyl, isopropyl, and isobutyl.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. The fluorescence emission diagram of activated fluorescence of different wavelengths after different probes are bound to protein tags;

(2) FIG. 2 to FIG. 11 are standard curves of the corresponding fluorescence intensity versus different SNAP protein tag concentrations for probe 1, probe 14, probe 21, probe 30, probe 43, probe 48, probe 56, probe 63, probe 70, and probe 88, respectively;

(3) FIG. 12 is a fluorescence spectrum of cell labeled with different probes, wherein (1) to (8) are probe 1, probe 15, probe 21, probe 30, probe 56, probe 60, probe 63, Probe 88, respectively, group A is a HeLa cell with a protein tag expressed, and group B is a HeLa-WT cell (original HeLa cell, without a protein tag expressed);

(4) FIG. 13 shows micrographs of different organelles labeled with different probes, wherein group A to group F are probe 1, probe 21, probe 48, probe 60, probe 66, probe 77 respectively, (1) to (9) are the nucleus, mitochondria, Golgi, endoplasmic reticulum, whole cells, cytoskeleton, extracellular membrane, lysosome, and intracellular membrane, respectively;

(5) FIG. 14 shows the two-color labeling of the same cell by different probes, wherein A is probe 1 labeled mitochondrion, B is probe 43 labeled nucleus, and C is an orthogonal imaging of A and B;

(6) FIG. 15 shows labeling with probe 88 in living mice, wherein group A is a blank group, group B is a control group, group C is a sample group, (1) is a liver, and (2) is a kidney;

(7) FIG. 16 shows the fluorescence changes of probe 21 in mammalian cells with the protein degradation;

(8) FIG. 17 shows tracing cell gap assembly process with different probes, wherein, A is the fluorescent channel of probe 21, B is the fluorescent channel of probe 1, and C is the superimposed fluorescent channel of probe 21 and probe 1.

EXAMPLES

(9) Specific examples of the present invention will be described in detail below. It should be understood that the specific examples described herein are merely illustrative description of the present invention and are not intended to limit the present invention.

Example 1

(10) A fluorescence-activated covalently labeling fluorescent probe 1 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(11) ##STR00027##

Compound 1

(12) To a solution of N-methyl-N-(2-hydroxyethyl)-4-amino-benzaldehyde (0.358 g, 2 mmol) and tert-butyl cyanoacetate (0.338 g, 2.4 mmol) in 50 mL anhydrous ethanol, a catalytic amount of anhydrous zinc chloride was added. The obtained mixture was heated in an oil bath for 5 hrs under the protection of Ar. After the reaction was completed, the solution was cooled at room temperature, a part of the solvent was removed by rotary evaporation. A large amount of precipitate was formed. The precipitate was separated by filtration, thoroughly washed with cooled ethanol twice and finally dried in vacuo to give a pure yellow compound 1 (0.49 g, 81%). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 6.85 (d, 2H, J=9.2 Hz), 4.79 (bt, 1H), 3.55-3.59 (m, 4H), 3.08 (s, 3H), 1.50 (s, 9H).

Compound 2

(13) The synthesis was carried out with reference to the method disclosed in Antje Keppler et. al. Nat Biotechnology. 2002, 21, 86-89. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.82 (s, 1H), 7.39 (m, 4H), 6.27 (s, 2H), 5.45 (s, 2H), 3.71 (s, 2H).

Probe 1

(14) Compound 1 (0.302 g, 1.0 mmol) and 4-dimethylaminopyridine (0.146 g, 1.2 mmol) were dissolved in 20 mL anhydrous dichloromethane, p-nitro phenyl chloroformate (0.242 g, 1.2 mmol) in 10 mL anhydrous dichloromethane was added dropwise under the protection of Ar. The obtained mixture was stirred and kept at room temperature for 1 hr under the protection of Ar. After the reaction was completed, the solvent was completely removed by rotary evaporation. The residue was re-dissolved in anhydrous N,N-dimethylformamide (DFM), compound 2 (0.324 g, 1.2 mmol) was added in the presence of anhydrous triethylamine (TEA) (0.16 ml, 1.2 mmol). The obtained mixture was stirred at room temperature for another 30 min under the protection of Ar. After the reaction was completed, the solvent was completely removed by rotary evaporation. The residue was purified by gel silica gel column chromatography to give a pure Probe 1, at a yield of 70%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 6.85 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.79 (bt, 1H), 4.40 (d, 2H, J=4.90 Hz), 3.55-3.59 (m, 4H), 3.08 (s, 3H), 1.50 (s, 9H).

Example 2

(15) A fluorescence-activated covalently labeling fluorescent probe 2 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(16) ##STR00028##

Compound 3

(17) The synthesis was carried out with reference to the method disclosed in J. Das et. al. Bioorg. Med. Chem. Lett. 2005, 15, 337-343. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 4.12 (s, 2H).

Compound 4

(18) This compound was obtained by following the general procedure for compound 1. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.11-8.07 (m, 2H), 8.01-7.97 (m, 3H), 7.70 (d, 1H, J=8.8 Hz), 7.46-7.43 (m, 1H), 6.27 (dd, 1H, J=9.2, 1.6 Hz), 6.02 (s, 1H), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Probe 2

(19) This probe was obtained by following the general procedure for probe 1, and the yield was 75%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.41 (s, 1H), 10.01 (s, 1H), 8.11-8.07 (m, 2H), 8.01-7.97 (m, 3H), 7.81 (s, 1H), 7.70 (d, 1H, J=8.8 Hz), 7.46-7.43 (m, 1H), 7.41 (m, 4H), 6.29 (s, 2H), 6.27 (dd, 1H, J=9.2, 1.6 Hz), 6.02 (s, 1H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.9 Hz), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Example 3

(20) A fluorescence-activated covalently labeling fluorescent probe 3 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(21) ##STR00029##

Compound 5

(22) This compound was obtained by following the general procedure for compound 1, and the yield was 95%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.09 (s, 1H), 8.02 (d, 1H, J=8.0 Hz), 7.98 (d, 2H, J=9.2 Hz), 7.86 (d, 1H, J=8.4 Hz), 7.48 (t, 1H, J=7.8 Hz), 7.36 (t, 1H, J=7.36 Hz), 6.73 (d, 2H, J=9.2 Hz), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Probe 3

(23) This probe was obtained by following the general procedure for probe 1, and the yield was 65%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.40 (s, 1H), 10.02 (s, 1H), 8.09 (s, 1H), 8.02 (d, 1H, J=8.0 Hz), 7.98 (d, 2H, J=9.2 Hz), 7.86 (d, 1H, J=8.4 Hz), 7.81 (s, 1H), 7.48 (t, 1H, J=7.8 Hz), 7.40 (m, 4H), 7.36 (t, 1H, J=7.36 Hz), 6.73 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 1H, J=4.8 Hz), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Example 4

(24) A fluorescence-activated covalently labeling fluorescent probe 4 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(25) ##STR00030##

Compound 6

(26) The synthesis was carried out with reference to the method disclosed in the literature (Srikun D 1 et. al JACS 2010, 132, 4455-4465). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.33 (d, 2H, J=8.0 Hz), 7.31 (d, 2H, J=8.0 Hz), 7.10 (brs, 2H), 6.10 (s, 1H), 5.25 (s, 2H), 3.68 (s, 2H).

Probe 4

(27) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.99 (brs, 1H), 8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 7.39 (d, 2H), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.85 (d, 2H, J=9.2 Hz), 6.10 (s, 1H), 5.26 (s, 2H), 4.79 (bt, 1H), 4.36 (s, 2H), 3.55-3.59 (m, 4H), 3.08 (s, 3H), 1.50 (s, 9H).

Example 5

(28) A fluorescence-activated covalently labeling fluorescent probe 5 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(29) ##STR00031##

Probe 5

(30) This probe was obtained by following the general procedure for probe 1, and the yield was 59%. 1H-NMR (400 MHz, DMSO-d6): δ=9.97 (s, 1H), 8.11-8.07 (m, 2H), 8.01-7.97 (m, 3H), 7.70 (d, 1H, J=8.8 Hz), 7.46-7.43 (m, 1H), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.10 (s, 2H), 6.27 (dd, 1H, J=9.2, 1.6 Hz), 6.10 (s, 1H), 6.02 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Example 6

(31) A fluorescence-activated covalently labeling fluorescent probe 6 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(32) ##STR00032##

Probe 6

(33) This probe was obtained by following the general procedure for probe 1, and the yield was 55%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.98 (brs, 1H), 8.09 (s, 1H), 8.02 (d, 1H, J=8.0 Hz), 7.98 (d, 2H, J=9.2 Hz), 7.86 (d, 1H, J=8.4 Hz), 7.48 (t, 1H, J=7.8 Hz), 7.39 (d, 2H, J=8.4 Hz), 7.36 (t, 1H, J=8.4 Hz), 7.26 (d, 2H, J=8.0 Hz), 7.09 (s, 2H), 6.73 (d, 2H, J=9.2 Hz), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Example 7

(34) A fluorescence-activated covalently labeling fluorescent probe 7 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(35) ##STR00033##

Compound 7

(36) The synthesis was carried out with reference to the method disclosed in the literature. .sup.1H-NMR (400 MHz, CD.sub.3OD): δ=7.84 (d, 1H, J=6.0 Hz), 7.40 (d, 2H, J=8.0 Hz), 7.31 (d, 2H, J=8.0 Hz), 6.14 (d, 1H, J=6.0), 5.29 (s, 2H), 3.78 (s, 2H).

Probe 7

(37) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 7.93 (d, 2H, J=8.0 Hz), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz) 6.85 (d, 2H, J=9.2 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.55-3.59 (m, 4H), 3.08 (s, 3H), 1.50 (s, 9H).

Example 8

(38) A fluorescence-activated covalently labeling fluorescent probe 8 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(39) ##STR00034##

Probe 8

(40) This probe was obtained by following the general procedure for probe 1, and the yield was 60%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.11-8.07 (m, 2H), 8.01-7.97 (m, 3H), 7.93 (d, 1H, J=5.6 Hz), 7.75 (s, 1H), 7.70 (d, 1H, J=8.8 Hz), 7.46-7.43 (m, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.27 (dd, 1H, J=9.2, 1.6 Hz), 6.10 (d, 1H, J=5.6 Hz), 6.02 (s, 1H), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Example 9

(41) A fluorescence-activated covalently labeling fluorescent probe 9 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(42) ##STR00035##

Probe 9

(43) This probe was obtained by following the general procedure for probe 1, and the yield was 65%. 1H-NMR (400 MHz, CDCl3): δ=8.09 (s, 1H), 8.02 (d, 1H, J=8.0 Hz), 7.98 (d, 2H, J=9.2 Hz), 7.93 (d, 1H, J=5.6), 7.86 (d, 1H, J=8.4 Hz), 7.75 (s, 1H), 7.48 (t, 1H, J=7.8 Hz), 7.36 (t, 1H, J=7.36 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.73 (d, 2H, J=9.2 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.88 (t, 2H, J=5.6 Hz), 3.64 (t, 2H, J=5.6 Hz), 3.15 (s, 3H).

Example 10

(44) A fluorescence-activated covalently labeling fluorescent probe 10 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(45) ##STR00036##

Compound 8

(46) This compound was obtained by following the general procedure for compound 1, and the yield was 95%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 6.85 (d, 2H, J=9.2 Hz), 4.79 (bt, 1H), 3.85 (t, 4H, J=5.6 Hz), 3.60 (t, 4H, J=5.6 Hz), 1.50 (s, 9H).

Probe 10

(47) This probe was obtained by following the general procedure for probe 1, and the yield was 35%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 6.85 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.79 (bt, 1H), 4.40 (d, 2H, J=4.90 Hz), 3.87 (m, 4H), 3.61 (m, 4H), 1.51 (s, 9H).

Example 11

(48) A fluorescence-activated covalently labeling fluorescent probe 11 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(49) ##STR00037##

Probe 11

(50) Compound 1 (0.629 g, 1.0 mmol) and 4-dimethylaminopyridine (0.146 g, 1.2 mmol) were dissolved in 20 mL anhydrous DMF, p-nitrophenylchloroformate (0.242 g, 1.2 mmol) in 10 mL anhydrous dichloromethane was added dropwise under the protection of Ar. The obtained mixture was stirred and kept at room temperature for 1 hr. Then, 3-amino-propanesulfonic acid (0.168 g, 1.2 mmol) was added in the presence of TEA (0.16 ml, 1.2 mmol). The obtained mixture was stirred at room temperature for another 30 min under the protection of Ar. After the reaction was completed, the solvent was completely removed by rotary evaporation, and the residue was separated by a reverse phase column to give a pure probe 11 of 0.397 g, and the yield was 50%. 1H-NMR (400 MHz, DMSO-d6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 6.85 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.79 (bt, 1H), 4.40 (d, 2H, J=4.90 Hz), 3.81 (t, 4H, J=6.0 Hz), 3.60 (t, 4H, J=6.0 Hz), 3.21 (t, 2H, 5.6 Hz), 2.71 (t, 2H, 5.6 Hz), 2.31 (m, 2H), 1.51 (s, 9H).

Example 12

(51) A fluorescence-activated covalently labeling fluorescent probe 12 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(52) ##STR00038##

Compound 9

(53) The synthesis was carried out with reference to the method disclosed in the literature (Tetsuaki Fujhara et al. Chem Comm, 2015, 51, 17382-17385). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.75 (d, 2H, J=8.2 Hz), 7.30 (d, 2H, J=7.8 Hz), 4.11 (t, 2H, J=4.8 Hz), 3.52-3.65 (m, 16H), 3.37 (s, 3H), 2.50 (s, 3H).

Compound 10

(54) Compound 8 (0.664 g, 2 mmol) was dissolved in 10 mL anhydrous DMF, cooled to 0° C. under the protection of Ar, 60% NaH (0.088 g, 2.2 mmol) was added. The obtained mixture was stirred for 5 min under the protection of Ar. Then, Compound 9 (0.781 g, 2 mmol) was added. After slowly returning to room temperature and stirring for 3.5 hrs, 0.5 ml water was added to quench the reaction. The solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a pale yellow oil of 0.396 g, and the yield was 36%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 6.85 (d, 2H, J=9.2 Hz), 3.56-3.68 (m, 24H), 3.38 (s, 3H), 1.50 (s, 9H).

Probe 12

(55) This probe was obtained by following the general procedure for probe 1, and the yield was 71%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 6.85 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.56-3.68 (m, 24H), 3.38 (s, 3H), 1.50 (s, 9H).

Example 13

(56) A fluorescence-activated covalently labeling fluorescent probe 13 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(57) ##STR00039##

Compound 11

(58) The synthesis was carried out by the method disclosed in the literature (Yang W et al. J. Photochem. Photobiol. A. 2011, 222, 228-235). .sup.1H-NMR (400 MHz, D.sub.2O): δ=9.43 (s, 1H), 7.72 (d, 2H, J=9.0 Hz), 6.81 (d, 2H, J=9.0 Hz), 3.71 (t, 2H, J=7.36 Hz), 3.03 (s, 3H), 2.44 (t, 2H, J=7.2 Hz).

Compound 12

(59) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, D.sub.2O): δ=8.01 (s, 1H), 7.72 (d, 2H, J=9.0 Hz), 6.81 (d, 2H, J=9.0 Hz), 3.71 (t, 2H, J=7.36 Hz), 3.03 (s, 3H), 2.44 (t, 2H, J=7.2 Hz), 1.49 (s, 9H).

Probe 13

(60) Compound 12 (0.33 g, 1 mmol), benzotriazole-1-yl-oxytripyrrolidinylphosphonium hexafluorophosphate (0.625 g, 1.2 mmol) and compound 2 (0.324 g, 1.2 mmol) were put in a 50 ml round-bottom flask, to which 15 ml anhydrous DMF and 0.3 nil of triethylamine were added. The obtained mixture was stirred and kept at room temperature for 0.5 hr under the protection of Ar. After the reaction was completed, the solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a pale yellow solid, 0.524 g. The yield was 90%. .sup.1H-NMR (400 MHz, D.sub.2O): δ=12.43 (s, 1H), 10.00 (s, 1H), 8.01 (s, 1H), 7.81 (s, 1H), 7.72 (d, 2H, J=9.0 Hz), 7.40 (m, 4H), 6.81 (d, 2H, J=9.0 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.71 (t, 2H, J=7.36 Hz), 3.03 (s, 3H), 2.47 (t, 2H, J=7.2 Hz), 1.49 (s, 9H).

Example 14

(61) A fluorescence-activated covalently labeling fluorescent probe 14 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(62) ##STR00040##

Compound 13

(63) The synthesis was carried out by the method disclosed in literature (L. X. Wu, K. Burgess, J. Am. Chem. Soc. 2008, 130, 4089-4096). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.63-7.48 (m, 5H), 4.27 (s, 2H), 3.13 (s, 3H).

Compound 14

(64) This compound was obtained by following the general procedure for compound 1, and the yield was 99%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 6.85 (d, 2H, J=9.2 Hz), 4.27 (s, 2H), 3.55-3.59 (m, 4H), 3.08 (s, 3H), 3.13 (s, 3H).

Probe 14

(65) This probe was obtained by following the general procedure for probe 1, and the yield was 70%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.96 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.63-7.48 (m, 5H), 7.40 (m, 4H), 6.84 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 4.27 (s, 2H), 3.55-3.59 (m, 4H), 3.13 (s, 3H), 3.03 (s, 3H).

Example 15

(66) A fluorescence-activated covalently labeling fluorescent probe 15 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(67) ##STR00041##

Compound 15

(68) The synthesis was carried out by the method disclosed in literature (L. X. Wu, K. Burgess, J. Am. Chem. Soc. 2008, 130, 4089-4096). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=3.98 (q, 2H, J=2.4 Hz), 3.01 (s, 3H), 2.15 (t, 3H, J=2.4 Hz).

Compound 16

(69) This compound was obtained by following the general procedure for compound 1, and the yield was 97%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.00 (s, 1H), 7.97 (d, 2H, J=9.2 Hz), 6.85 (d, 2H, J=9.2 Hz), 3.98 (q, 2H, J=2.4 Hz), 3.55-3.59 (m, 4H), 3.08 (s, 3H), 3.01 (s, 3H), 2.15 (t, 3H, J=2.4 Hz).

Compound 17

(70) Compound 16 (0.546 g, 2 mmol), benzaldehyde (0.530 g, 5 mmol) and anhydrous zinc chloride (0.545 g, 4 mmol) were dissolved in 100 ml anhydrous toluene. The mixture was heated to reflux in an oil bath for 48 hrs, After the reaction was completed, the solvent was completely removed by rotary evaporation, and the residue was dissolved in 100 ml of methylene dichloride, washed with water three times, and the organic phase is dried over anhydrous sodium sulfate, and the solvent was was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a red-brown solid 0.181 g. The yield was 25%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.21 (d, 2H, J=8.8 Hz), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.45-7.38 (m, 3H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 15

(71) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.21 (d, 2H, J=8.8 Hz), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.81 (s, 1H), 7.45-7.38 (m, 7H), 7.24 (s, 1H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 16

(72) A fluorescence-activated covalently labeling fluorescent probe 16 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(73) ##STR00042##

Probe 16

(74) This probe was obtained by following the general procedure for probe 1, and the yield was 78%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.99 (brs, 1H), 8.21 (d, 2H, J=8.8 Hz), 8.00 (d, 1H, J=16 Hz), 7.85 (d, 2H, J=8.0 Hz), 7.45-7.39 (m, 3H), 7.35 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.24 (s, 1H), 7.09 (s, 2H), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 17

(75) A fluorescence-activated covalently labeling fluorescent probe 17 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(76) ##STR00043##

Probe 17

(77) This probe was obtained by following the general procedure for probe 1, and the yield was 71%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.21 (d, 2H, J=8.8 Hz), 8.00 (d, 1H, J=16 Hz), 7.93 (d, 1H, J=5.6), 7.85 (d, 2H, J=8.0 Hz), 7.75 (s, 1H), 7.45-7.38 (m, 3H), 7.33 (d, 2H, J=8.0 Hz), 7.24 (s, 1H), 7.19 (d, 2H, J=8.0 Hz), 7.01 (s, 1H), 6.92 (d, 2H, J=8.8 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 18

(78) A fluorescence-activated covalently labeling fluorescent probe 18 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(79) ##STR00044##

Compound 18

(80) The synthesis was carried out by the method disclosed in the literature (Wang H. et al. Tetra Let, 2007, 48, 3471-3474). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.05 (m, 2H), 7.01 (m, 2H), 1.83 (s, 6H).

Compound 19

(81) Compound 18 (0.279 g, 1 mmol) was dissolved in 20 ml of anhydrous pyridine, ml of N-methyl-N-hydroxyethyl was added, and heated in an oil bath at 40° C. overnight under the protection of Ar, After the reaction was completed, the solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a red product 0.187 g. The yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.05 (m, 2H), 7.01 (m, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.83 (s, 6H).

Probe 18

(82) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.05 (m, 2H), 7.01 (m, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.83 (s, 6H).

Example 19

(83) A fluorescence-activated covalently labeling fluorescent probe 19 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(84) ##STR00045##

Probe 19

(85) This probe was obtained by following the general procedure for probe 1, and the yield was 75%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.90 (brs, 1H), 8.05 (m, 2H), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 7.01 (m, 2H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.83 (s, 6H).

Example 20

(86) A fluorescence-activated covalently labeling fluorescent probe 20 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(87) ##STR00046##

Probe 20

(88) This probe was obtained by following the general procedure for probe 1, and the yield was 71%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.05 (m, 2H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 7.01 (m, 2H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.83 (s, 6H).

Example 21

(89) A fluorescence-activated covalently labeling fluorescent probe 21 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(90) ##STR00047##

Compound 20

(91) The synthesis was carried out by the method disclosed in the literature (WO 2013142841 (A1) 2013 Sep. 26). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.92 (s, 1H), 7.63 (d, 1H, J=5.2 Hz), 7.31 (d, 1H, J=5.2 Hz).

Compound 21

(92) Compound 20 (0.438 g, 2 mmol) was dissolved in 15 mL of N-methyl-N-hydroxyethylamine, copper powder (6.4 mg, 0.01 mmol), cuprous iodide (19 mg, 0.01 mmol), tripotassium phosphate (0.850 g, 4 mmol) were added, and heated in an oil bath at 80° C. overnight under the protection of Ar. After the reaction was completed, cooled at room temperature, the system was poured into 50 mL of water and was extracted three times with 50 ml dichloromethane; the organic phases were combined, and the solvent was completely removed by rotary evaporation. After separation by column chromatography, 0.362 g of a yellow product was obtained, and the yield was 85%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.92 (s, 1H), 7.63 (d, 1H, J=5.2 Hz), 7.31 (d, 1H, J=5.2 Hz), 3.85 (t, 2H, J=5.6 Hz), 3H, J=5.6 Hz), 3.10 (s, 3H).

Compound 22

(93) Compound 21 (0.426 g, 2 mmol) was dissolved in 50 ml of anhydrous dichloromethane, 1 ml of triethylamine was added, and acetic anhydride (0.3 ml, 3 mmol) was slowly added dropwise under an ice bath. After the temperature was raised to room temperature, the system was stirred for 3 hrs. After the reaction was completed, 100 ml water was added. The organic phase was separated, and the aqueous phase was extracted twice with 50 ml dichloromethane. The organic phase was combined and dried over anhydrous sodium sulfate. The solvent was completely removed by rotary evaporation. The residue was directly used in the next step without being further purified.

(94) The residue was dissolved in 50 nil of dichloromethane. 5 ml of DMF was added, 2 ml of phosphorus oxychloride was added under an ice bath, and the mixture was stirred under the protection of Ar for 0.5 h. The system was slowly warmed at room temperature and stirring was continued for 5 hrs; after the reaction was completed, saturated sodium carbonate solution was added to adjust pH to 10.0; stirring was carried out at room temperature overnight, and the organic phase was separated the next day, and the aqueous phase was extracted three times with 50 ml of dichloromethane, and the organic phase was combined and washed twice with saturated brine. The organic phase was dried over anhydrous sodium sulfate. The solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a yellow solid 0.285 g, and the yield was 59%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=10.01 (s, 1H), 7.92 (s, 1H), 7.63 (s, 1H) 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Compound 23

(95) This compound was obtained by following the general procedure for compound 1, and the yield was 89%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.02 (s, 1H), 6.43 (s, 1H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.49 (s, 9H).

Probe 21

(96) This probe was obtained by following the general procedure for probe 1, and the yield was 65%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.22 (s, 1H), 10.01 (s, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 6.43 (s, 1H), 6.28 (s, 2H), 5.45 (s, 2H), 4.41 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 1.49 (s, 9H).

Example 22

(97) A fluorescence-activated covalently labeling fluorescent probe 22 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(98) ##STR00048##

Compound 24

(99) This compound was obtained by following the general procedure for compound 1, and the yield was 93%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.22 (s, 1H), 8.02 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 6.43 (s, 1H), 3.75 (t, 2H, J=5.6 Hz), 3.55 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 22

(100) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.02 (s, 1H), 10.00 (s, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.81 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 6H), 6.43 (s, 1H), 6.28 (s, 2H), 5.45 (s, 2H), 4.41 (d, 2H, J=4.8 Hz), 3.75 (t, 2H, J=5.6 Hz), 3.55 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 23

(101) A fluorescence-activated covalently labeling fluorescent probe 23 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(102) ##STR00049##

Compound 25

(103) This compound was obtained by following the general procedure for compound 1, and the yield was 88%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.09 (d, 1H, J=8.0 Hz), 8.02 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 6.43 (s, 1H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 23

(104) This Probe was obtained by following the general procedure for Probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.32 (s, 1H), 10.03 (s, 1H), 8.22 (s, 1H), 8.09 (d, 1H, J=8.0 Hz), 8.02 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.81 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (m, 4H), 6.43 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 24

(105) A fluorescence-activated covalently labeling fluorescent probe 24 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(106) ##STR00050##

Probe 24

(107) This probe was obtained by following the general procedure for probe 1, and the yield was 58%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.98 (brs, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.43 (s, 1H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.49 (s, 9H).

Example 25

(108) A fluorescence-activated covalently labeling fluorescent probe 25 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(109) ##STR00051##

Probe 25

(110) This probe was obtained by following the general procedure for probe 1, and the yield was 63%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.99 (brs, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.44 (d, 2H, J=8.4 Hz), 7.36-7.42 (m, 2H), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.43 (s, 1H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.75 (t, 2H, J=5.6 Hz), 3.55 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 26

(111) A fluorescence-activated covalently labeling fluorescent probe 26 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(112) ##STR00052##

Probe 26

(113) This probe was obtained by following the general procedure for probe 1, and the yield was 58%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.98 (brs, 1H), 8.22 (s, 1H), 8.09 (d, 1H, J=8.0 Hz), 8.02 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.43 (s, 1H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 27

(114) A fluorescence-activated covalently labeling fluorescent probe 27 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(115) ##STR00053##

Probe 27

(116) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.02 (s, 1H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.43 (s, 1H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.49 (s, 9H).

Example 28

(117) A fluorescence-activated covalently labeling fluorescent probe 28 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(118) ##STR00054##

Probe 28

(119) This probe was obtained by following the general procedure for probe 1, and the yield was 63%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.02 (s, 1H), 7.93 (d, 1H, J=5.6), 7.77 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.30 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.43 (s, 1H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.75 (t, 2H, J=5.6 Hz), 3.55 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 29

(120) A fluorescence-activated covalently labeling fluorescent probe 29 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(121) ##STR00055##

Probe 29

(122) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.09 (d, 1H, J=8.0 Hz), 8.02 (s, 1H), 7.96 (d, 1H, J=5.6), 7.90 (d, 1H, J=8.0 Hz), 7.75 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.43 (s, 1H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 30

(123) A fluorescence-activated covalently labeling fluorescent probe 30 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(124) ##STR00056##

Compound 26

(125) This compound was obtained by following the general procedure for compound 21, and the yield was 87%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.02 (s, 1H), 7.66 (d, 1H, J=8.4 Hz), 7.44-7.48 (m, 1H), 7.41 (m, 1H), 7.29 (m, 1H), 3.60 (t, 2H, J=5.6 Hz), 3.34 (t, J=8.0 Hz, 3H), 3.10 (s, 3H).

Compound 27

(126) This compound was obtained by following the general procedure for compound 22, and the yield was 56%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.92 (s, 1H), 7.81 (s, 1H), 7.68 (d, J=9.0 Hz, 1H), 6.92 (d, J=2.0 Hz, 1H), 6.82 (d, J=9.1, 2.3 Hz, 1H), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.10 (s, 3H).

Compound 28

(127) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.22 (s, 1H), 8.02 (s, 1H), 6.43 (s, 1H), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.11 (s, 3H), 1.48 (s, 9H).

Probe 30

(128) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.20 (s, 1H), 7.81 (s, 2H), 7.68 (d, J=9.0 Hz, 1H), 7.40 (m, 4H), 6.92 (d, J=2.0 Hz, 1H), 6.82 (d, J=9.1, 2.3 Hz, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.11 (s, 3H), 1.51 (s, 9H).

Example 31

(129) A fluorescence-activated covalently labeling fluorescent probe 31 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(130) ##STR00057##

Compound 29

(131) This compound was obtained by following the general procedure for compound 4, and the yield was 93%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.45 (s, 1H), 8.09 (d, J=8.00 Hz, 2H), 8.07 (s, 1H), 7.94 (d, J=8.00 Hz, 2H), 7.51 (m, 1H), 7.41 (m, 1H), 6.45 (s, 1H), 3.61 (t, 3H, J=8.0 Hz), 3.34 (t, J=8.0 Hz, 3H), 3.21 (s, 3H).

Probe 31

(132) This probe was obtained by following the general procedure for probe 1, and the yield was 71%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.45 (s, 1H), 8.09 (d, J=8.00 Hz, 2H), 8.07 (s, 1H), 7.94 (d, J=8.00 Hz, 2H), 7.81 (s, 1H), 7.51 (m, 1H), 7.41 (m, 5H), 6.45 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 3H, J=8.0 Hz), 3.34 (t, J=8.0 Hz, 3H), 3.21 (s, 3H).

Example 32

(133) A fluorescence-activated covalently labeling fluorescent probe 32 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(134) ##STR00058##

Compound 30

(135) This compound was obtained by following the general procedure for compound 1, and the yield was 89%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.09 (d, 1H, J=8.00 Hz), 7.94 (d, 1H, J=8.00 Hz), 7.81 (s, 1H), 7.68 (d, J=9.0 Hz, 1H), 7.51 (m, 1H), 7.41 (m, 1H), 6.92 (d, J=2.0 Hz, 1H), 6.82 (d, J=9.1, 2.3 Hz, 1H), 6.45 (s, 1H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.21 (s, 3H).

Probe 32

(136) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.09 (d, 1H, J=8.00 Hz), 7.94 (d, 1H, J=8.00 Hz), 7.81 (s, 2H), 7.68 (d, J=9.0 Hz, 1H), 7.51 (m, 1H), 7.41 (m, 5H), 6.92 (d, J=2.0 Hz, 1H), 6.82 (d, J=9.1, 2.3 Hz, 1H), 6.45 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.62 (t, 2H, J=8.0 Hz), 3.36 (t, J=8.0 Hz, 2H), 3.21 (s, 3H).

Example 33

(137) A fluorescence-activated covalently labeling fluorescent probe 33 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye

(138) ##STR00059##

Probe 33

(139) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. 1H-NMR (400 MHz, CDCl.sub.3): δ=9.99 (brs, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.43 (s, 1H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.21 (s, 3H), 1.48 (s, 9H).

Example 34

(140) A fluorescence-activated covalently labeling fluorescent probe 34 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(141) ##STR00060##

Probe 34

(142) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.22 (s, 1H), 8.02 (s, 1H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.43 (s, 1H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 3.21 (s, 3H), 1.48 (s, 9H).

Example 35

(143) A fluorescence-activated covalently labeling fluorescent probe 35 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(144) ##STR00061##

Compound 29

(145) This compound was obtained by following the general procedure for compound 26, and the yield was 42%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.62 (d, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (dd, 1H, J.sub.1=9.0 Hz, J.sub.2=2.4 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H).

Compound 30

(146) Compound 29 (0.965 g, 5 mmol) was dissolved in 50 ml acetonitrile in a 100 ml round-bottom flask, and potassium carbonate (1.38 g, 10 mmol) and bromohexane (1.33 g, 6 mmol) were added. The resulting mixture was heated to reflux in an oil bath under the protection of Ar. After the reaction was completed, filtering was carried out, and the solvent was removed by rotary evaporation. The residue was dissolved in 100 ml ethyl acetate, then washed with water, saturated brine, respectively. The organic phase was dried over anhydrous sodium sulfate. The solvent was completely removed by rotary evaporation. The residue was purified by gel silica gel column chromatography to give a waxy solid 1.182 g, and the yield was 71%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.64 (d, 1H, J=8.8 Hz), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (m, 1H), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 3.12-3.09 (t, 2H, J=7.6 Hz), 1.59-1.65 (m, 24H), 0.89 (t, 3H, J=2.0 Hz).

Compound 31

(147) This compound was obtained by following the general procedure for compound 27, and the yield was 56%. 1H-NMR (400 MHz, CDCl3): δ=9.92 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (m, 1H), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 3.12-3.09 (t, 2H, J=7.6 Hz), 1.59-1.65 (m, 24H), 0.89 (t, 3H, J=2.0 Hz).

Compound 32

(148) This compound was obtained by following the general procedure for compound 1, and the yield was 87%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (m, 1H), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 3.12-3.09 (t, 2H, J=7.6 Hz), 1.59-1.65 (m, 33H), 0.89 (t, 3H, J=2.0 Hz).

Probe 35

(149) This probe was obtained by following the general procedure for probe 1, and the yield was 60%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.83 (s, 1H), 7.78 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0 Hz), 6.82 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 3.12-3.09 (t, 2H, J=7.6 Hz), 1.59-1.65 (m, 33H), 0.89 (t, 3H, J=2.0 Hz).

Example 36

(150) A fluorescence-activated covalently labeling fluorescent probe 36 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(151) ##STR00062##

Compound 33

(152) Compound 29 (0.580 g, 3 mmol) was dissolved in 60 ml of toluene in a 100 ml round-bottom flask, 1 ml of acrylonitrile and 1 ml of acetic acid were added, heated to reflux in an oil bath for 24 h under the protection of Ar. After the reaction was completed, the system was poured into 100 ml of water, the organic phase was separated, and the aqueous phase was extracted twice with 50 ml of dichloromethane. The organic phases were combined and dried over anhydrous sodium sulfate. The solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a product 0.487 g. The yield was 66%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.62 (d, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (dd, 1H, J.sub.1=9.0 Hz, J.sub.2=2.4 Hz), 3.72 (t, 2H, J=6.8 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 2.57 (t, 2H, J=6.8 Hz).

Compound 34

(153) This compound was obtained by following the general procedure for compound 27, and the yield was 43%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.97 (s, 1H), 7.60 (d, 1H), 7.80 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (dd, 1H, J.sub.1=9.0 Hz, J.sub.2=2.4 Hz), 3.72 (t, 2H, J=6.8 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 2.57 (t, 2H, J=6.8 Hz).

Compound 35

(154) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.00 (s, 1H), 7.60 (d, 1H), 7.80 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (dd, 1H, J.sub.1=9.0 Hz, J.sub.2=2.4 Hz), 3.72 (t, 2H, J=6.8 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 2.57 (t, 2H, J=6.8 Hz), 1.49 (s, 9H).

Probe 36

(155) This probe was obtained by following the general procedure for probe 1, and the yield was 55%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 7.60 (d, 1H), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0 Hz), 6.82 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.72 (t, 2H, J=6.8 Hz), 3.62 (t, J=8.0 Hz, 3H), 3.35 (t, J=8.0 Hz, 3H), 2.57 (t, 2H, J=6.8 Hz), 1.49 (s, 9H).

Example 37

(156) A fluorescence-activated covalently labeling fluorescent probe 37 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(157) ##STR00063##

Compound 36

(158) This compound was obtained by following the general procedure for compound 21, and the yield was 67%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.62 (d, 1H, J=8.8 Hz), 7.15 (d, 1H, J=5.6 Hz), 7.08-7.01 (m, 2H), 6.81 (d, 1H, J=2.4 Hz), 3.62 (t, 4H, J=8.0 Hz), 3.35 (t, 4H, J=8.0 Hz).

Compound 37

(159) This compound was obtained by following the general procedure for compound 27, and the yield was 67%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.99 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.81 (m, 1H), 3.62 (t, 4H, J=8.0 Hz), 3.35 (t, 4H, J=8.0 Hz).

Compound 38

(160) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.00 (s, 1H), 7.83 (s, 1H), 7.69 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.81 (m, 1H), 3.62 (t, 4H, J=8.0 Hz), 3.35 (t, 4H, J=8.0 Hz), 1.49 (s, 9H).

Probe 37

(161) This probe was obtained by following the general procedure for probe 1, and the yield was 44%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 9.99 (s, 1H), 8.00 (s, 1H), 7.83 (s, 1H), 7.81 (s, 1H), 7.69 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0 Hz), 6.81 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.62 (t, 4H, J=8.0 Hz), 3.35 (t, 4H, J=8.0 Hz), 1.49 (s, 9H).

Example 38

(162) A fluorescence-activated covalently labeling fluorescent probe 38 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(163) ##STR00064##

Compound 39

(164) This compound was obtained by following the general procedure for compound 10, and the yield was 45%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.00 (s, 1H), 7.83 (s, 1H), 7.69 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.81 (m, 1H), 3.56-3.68 (m, 24H), 3.38 (s, 3H), 1.49 (s, 9H).

Probe 38

(165) This probe was obtained by following the general procedure for probe 1, and the yield was 67%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.00 (s, 1H), 7.83 (s, 1H), 7.81 (s, 1H), 7.69 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0 Hz), 6.81 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.56-3.68 (m, 24H), 3.38 (s, 3H), 1.49 (s, 9H).

Example 39

(166) A fluorescence-activated covalently labeling fluorescent probe 39 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(167) ##STR00065##

Probe 39

(168) This probe was obtained by following the general procedure for probe 11, and the yield was 65%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 9.99 (s, 1H), 8.00 (s, 1H), 7.83 (s, 1H), 7.81 (s, 1H), 7.69 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0 Hz), 6.81 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.62 (t, 4H, J=8.0 Hz), 3.35 (t, 4H, J=8.0 Hz), 3.21 (t, 2H, 5.6 Hz), 2.71 (t, 2H, 5.6 Hz), 2.31 (m, 2H), 1.49 (s, 9H).

Example 40

(169) A fluorescence-activated covalently labeling fluorescent probe 40 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(170) ##STR00066##

Compound 41

(171) This compound was obtained by following the general procedure for compound 27, and the yield was 68%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.62 (d, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0 Hz), 6.82 (dd, 1H, J.sub.1=9.0 Hz, J.sub.2=2.4 Hz), 3.55 (t, 2H, J=7.6 Hz), 3.35 (t, 2H, J=6.8 Hz), 3.13 (s, 3H), 1.24 (m, 2H).

Probe 40

(172) This probe was obtained by following the general procedure for probe 13, and the yield was 88%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 7.81 (s, 1H), 7.82 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0 Hz), 6.82 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.55 (t, 2H, J=7.6 Hz), 3.35 (t, 2H, J=6.8 Hz), 3.13 (s, 3H), 1.24 (m, 2H).

Example 41

(173) A fluorescence-activated covalently labeling fluorescent probe 41 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(174) ##STR00067##

Compound 44

(175) This compound was obtained by following the general procedure for compound 14, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.22 (s, 1H), 8.02 (s, 1H), 6.43 (s, 1H), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.11 (s, 3H), 3.00 (s, 3H), 2.15 (t, 3H, J=2.4 Hz), 1.48 (s, 9H).

Probe 41

(176) This probe was obtained by following the general procedure for probe 1, and the yield was 55%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 6.43 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.11 (s, 3H), 3.00 (s, 3H), 2.15 (t, 3H, J=2.4 Hz), 1.48 (s, 9H).

Example 42

(177) A fluorescence-activated covalently labeling fluorescent probe 42 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(178) ##STR00068##

Compound 45

(179) This compound was obtained by following the general procedure for compound 1, and the yield was 93%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.22 (s, 1H), 8.02 (s, 1H), 7.63-7.68 (m, 5H), 6.43 (s, 1H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.15 (s, 3H), 3.11 (s, 3H).

Probe 42

(180) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.81 (s, 1H), 7.63-7.68 (m, 5H), 6.43 (s, 1H), 7.40 (m, 4H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, J=8.0 Hz, 3H), 3.34 (t, J=8.0 Hz, 3H), 3.15 (s, 3H), 3.11 (s, 3H).

Example 43

(181) A fluorescence-activated covalently labeling fluorescent probe 43 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(182) ##STR00069##

Compound 46

(183) This compound was obtained by following the general procedure for compound 21, and the yield was 78%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.07 (s, 1H), 7.77 (d, 1H, J=1.6 Hz), 7.66 (d, 1H, J=8.4 Hz), 7.50 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Compound 47

(184) This compound was obtained by following the general procedure for compound 22, and the yield was 81%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.99 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Compound 48

(185) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H), 1.50 (s, 9H).

Probe 43

(186) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.81 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (m, 5H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H), 1.50 (s, 9H).

Example 44

(187) A fluorescence-activated covalently labeling fluorescent probe 44 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(188) ##STR00070##

Probe 44

(189) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.99 (brs, 1H), 8.01 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (m, 1H), 7.33 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H), 1.50 (s, 9H).

Example 45

(190) A fluorescence-activated covalently labeling fluorescent probe 45 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(191) ##STR00071##

Probe 45

(192) This probe was obtained by following the general procedure for probe 1, and the yield was 67%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.89 (d, 1H, J=5.6), 7.75 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H), 1.50 (s, 9H).

Example 46

(193) A fluorescence-activated covalently labeling fluorescent probe 46 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(194) ##STR00072##

Compound 49

(195) This compound was obtained by following the general procedure for compound 1, and the yield was 97%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.99 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.36-7.42 (m, 3H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Probe 46

(196) This probe was obtained by following the general procedure for probe 1, and the yield was 65%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.32 (s, 1H), 10.01 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.32-7.37 (m, 3H), 7.40 (m, 4H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Example 47

(197) A fluorescence-activated covalently labeling fluorescent probe 47 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(198) ##STR00073##

Compound 50

(199) This compound was obtained by following the general procedure for compound 1, and the yield was 97%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.04 (d, 1H, J=8.0 Hz), 7.90 (d, 1H, J=8.0 Hz), 7.99 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Probe 47

(200) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.04 (d, 1H, J=8.0 Hz), 7.90 (d, 1H, J=8.0 Hz), 7.99 (s, 1H), 7.81 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (m, 5H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Example 48

(201) A fluorescence-activated covalently labeling fluorescent probe 48 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(202) ##STR00074##

Probe 48

(203) This probe was obtained by following the general procedure for probe 1, and the yield was 97%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.04 (d, 1H, J=8.0 Hz), 7.93 (d, 1H, J=5.6), 7.90 (d, 1H, J=8.0 Hz), 7.99 (s, 1H), 7.75 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Example 49

(204) A fluorescence-activated covalently labeling fluorescent probe 49 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(205) ##STR00075##

Compound 51

(206) This compound was obtained by following the general procedure for compound 1, and the yield was 87%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.99 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Probe 49

(207) This probe was obtained by following the general procedure for probe 1, and the yield was 31%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.32 (s, 1H), 10.05 (s, 1H), 8.01 (s, 1H), 7.81 (s, 1H), 7.61 (d, 1H, J=1.6 Hz), 7.49 (d, 1H, J=8.4 Hz), 7.40 (m, 5H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.11 (s, 3H).

Example 50

(208) A fluorescence-activated covalently labeling fluorescent probe 50 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(209) ##STR00076##

Compound 52

(210) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.98 (s, 1H), 7.64-7.48 (m, 7H), 7.40 (dd, 1H, J.sub.1=8.4 Hz, J.sub.2=1.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.13 (s, 3H), 3.11 (s, 3H).

Probe 50

(211) This probe was obtained by following the general procedure for probe 1, and the yield was 67%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 7.98 (s, 1H), 7.81 (s, 1H), 7.64-7.48 (m, 7H), 7.40 (m, 5H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.13 (s, 3H), 3.11 (s, 3H).

Example 51

(212) A fluorescence-activated covalently labeling fluorescent probe 51 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(213) ##STR00077##

Compound 53

(214) This compound was obtained by following the general procedure for compound 21, and the yield was 81%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.67 (s, 1H), 7.95 (d, 1H, J=10.0 Hz), 7.15 (d, 1H, J=2.4 Hz), 7.00 (dd, 1H, J.sub.1=8.8 Hz, J.sub.2=2.4 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H).

Compound 54

(215) This compound was obtained by following the general procedure for compound 22, the yield was 56%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=10.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.07-7.04 (m, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H).

Compound 55

(216) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.07-7.04 (m, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H), 1.50 (s, 9H).

Probe 51

(217) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.07-7.04 (m, 2H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H), 1.50 (s, 9H).

Example 52

(218) A fluorescence-activated covalently labeling fluorescent probe 52 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(219) ##STR00078##

Probe 52

(220) This probe was obtained by following the general procedure for probe 1, and the yield was 69%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.99 (brs, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.19 (s, 2H), 7.07-7.04 (m, 2H), 6.10 (s, 1H), 5.26 (s, 2H), 4.36 (s, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H), 1.50 (s, 9H).

Example 53

(221) A fluorescence-activated covalently labeling fluorescent probe 52 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(222) ##STR00079##

Probe 53

(223) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.90 (d, 1H, J=5.6), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 7.07-7.04 (m, 2H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H), 1.50 (s, 9H).

Example 54

(224) A fluorescence-activated covalently labeling fluorescent probe 54 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(225) ##STR00080##

Compound 56

(226) This compound was obtained by following the general procedure for compound 1, and the yield was 81%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.07-7.04 (m, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H).

Probe 54

(227) This probe was obtained by following the general procedure for probe 1, and the yield was 65%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.81 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.40 (m, 4H), 7.36-7.42 (m, 2H), 7.07-7.04 (m, 2H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H).

Example 55

(228) A fluorescence-activated covalently labeling fluorescent probe 55 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(229) ##STR00081##

Compound 57

(230) This compound was obtained by following the general procedure for compound 1, and the yield was 97%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.04 (d, 1H, J=8.0 Hz), 8.00 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.07-7.04 (m, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H).

Probe 55

(231) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.04 (d, 1H, J=8.0 Hz), 8.00 (d, 1H, J=10.0 Hz), 7.95 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.07-7.04 (m, 2H), 3.61 (t, 2H, J=8.0 Hz), 3.34 (t, 2H, J=8.0 Hz), 3.10 (s, 3H).

Example 56

(232) A fluorescence-activated covalently labeling fluorescent probe 56 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(233) ##STR00082##

Compound 58

(234) N-methyl-N-hydroxyethylaniline (1.88 g, 12.5 mmol) and NaHCO.sub.3 (1.57 g, 18.7 mmol) were dissolved in 48 ml of dichloromethane and 36 ml of water, cooled to 0° C., and I.sub.2 (3.0 g, 11.8 mmol) was added slowly, then, the system was gradually warmed to room temperature, stirred for 30 min, the system was diluted with 300 ml of dichloromethane and 40 ml of water; the organic phase was separated, and the organic phase was washed with water, sodium thiosulfate solution and brine, respectively, and dried over anhydrous sodium sulfate; the solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a pure compound 22 (2.46 g, 92%). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.46 (d, 1H, J=7.60 Hz), 6.56 (d, 1H, J=7.60 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 2.94 (s, 3H).

Compound 59

(235) Compound 58 (5.54 g, 20 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (213 mg, 0.3 mmol), cuprous iodide (38 mg, 0.2 mmol) were dissolved in 20 ml of trimethylamine. After stirred at room temperature for 30 min under the protection of Ar, propargyl alcohol (1.53 ml, 26 mmol) was added, and the mixture was stirred at room temperature for 24 hrs. After the reaction was completed, the mixture was filtered, the solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a brown solid of 3.20 g, and the yield was 78%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.30 (d, 2H, J=8.8 Hz), 6.60 (d, 2H, J=8.8 Hz), 4.45 (d, 2H, J=4.0 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Compound 60

(236) Compound 59 (2.05 g, 10 mmol) was dissolved in 50 ml of tetrahydrofuran, 10 g of active manganese dioxide was added, and stirred under the protection of Ar for 24 h at room temperature. When the reaction was completed, the solution was filtered, and the solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a brown solid of 1.42 g, and the yield was 70%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.37 (s, 1H), 7.49 (d, 2H, J=8.8 Hz), 6.74 (d, 2H, J=8.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Compound 61

(237) This compound was obtained by following the general procedure for compound 61, and the yield was 81%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.47 (d, 2H, J=8.8 Hz), 6.76 (d, 2H, J=8.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.50 (s, 9H).

Probe 56

(238) This probe was obtained by following the general procedure for probe 1, and the yield was 55%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.81 (s, 1H), 7.47 (d, 2H, J=8.8 Hz), 7.40 (m, 4H), 6.76 (d, 2H, J=8.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.50 (s, 9H).

Example 57

(239) A fluorescence-activated covalently labeling fluorescent probe 57 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(240) ##STR00083##

Probe 57

(241) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.47 (d, 2H, J=8.8 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.76 (d, 2H, J=8.8 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.50 (s, 9H).

Example 58

(242) A fluorescence-activated covalently labeling fluorescent probe 58 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(243) ##STR00084##

Compound 62

(244) This compound was obtained by following the general procedure for compound 1, and the yield was 90%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.47 (d, 2H, J=8.8 Hz), 7.36-7.42 (m, 2H), 6.76 (d, 2H, J=8.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Probe 58

(245) This probe was obtained by following the general procedure for probe 1, and the yield was 50%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.81 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.47 (d, 2H, J=8.8 Hz), 7.40 (m, 4H), 7.36-7.42 (m, 2H), 6.76 (d, 2H, J=8.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Example 59

(246) A fluorescence-activated covalently labeling fluorescent probe 59 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(247) ##STR00085##

Compound 63

(248) This compound was obtained by following the general procedure for compound 1, and the yield was 90%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.04 (d, 1H, J=8.0 Hz), 8.01 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.47 (d, 2H, J=8.8 Hz), 7.45 (t, 1H, J=8.0 Hz), 6.76 (d, 2H, J=8.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Probe 59

(249) This probe was obtained by following the general procedure for probe 1, and the yield was 49%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.04 (d, 1H, J=8.0 Hz), 8.01 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.81 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.47 (d, 2H, J=8.8 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (m, 4H), 6.76 (d, 2H, J=8.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Example 60

(250) A fluorescence-activated covalently labeling fluorescent probe 60 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(251) ##STR00086##

Compound 64

(252) The synthesis was carried out by the method disclosed in WO2009152165 (A2), Dec. 17, 2009. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.37 (s, 1H), 7.24 (s, 1H).

Compound 65

(253) This compound was obtained by following the general procedure for compound 21, and the yield was 85%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.37 (s, 1H), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Compound 66

(254) This compound was obtained by following the general procedure for compound 22, and the yield was 56%. 1H-NMR (400 MHz, DMSO-d.sub.6): δ=10.04 (s, 1H), 7.84 (s, 1H), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Compound 67

(255) This compound was obtained by following the general procedure for compound 1, and the yield was 88%. 1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.01 (s, 1H), 7.84 (s, 1H), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.50 (s, 9H).

Probe 60

(256) This probe was obtained by following the general procedure for probe 1, and the yield was 55%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.84 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.24 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.50 (s, 9H).

Example 61

(257) A fluorescence-activated covalently labeling fluorescent probe 61 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(258) ##STR00087##

Compound 68

(259) This compound was obtained by following the general procedure for compound 1, and the yield was 99%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.01 (s, 1H), 7.84 (s, 1H), 7.74 (1H, d, J=4.0 Hz), 7.55 (1H, d, J=4.0 Hz), 7.36-7.42 (2H, m), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Probe 61

(260) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.84 (s, 1H), 7.81 (s, 1H), 7.74 (1H, d, J=4.0 Hz), 7.55 (1H, d, J=4.0 Hz), 7.36-7.42 (6H, m), 7.24 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Example 62

(261) A fluorescence-activated covalently labeling fluorescent probe 62 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(262) ##STR00088##

Compound 68

(263) This compound was obtained by following the general procedure for compound 1, and the yield was 99%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.07 (1H, d, J=8.0 Hz), 8.01 (s, 1H), 7.90 (1H, d, J=8.0 Hz), 7.84 (s, 1H), 7.53 (1H, t, J=8.0 Hz), 7.45 (1H, t, J=8.0 Hz), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Probe 62

(264) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.07 (1H, d, J=8.0 Hz), 8.01 (s, 1H), 7.90 (1H, d, J=8.0 Hz), 7.84 (s, 1H), 7.81 (s, 1H), 7.53 (1H, t, J=8.0 Hz), 7.45 (1H, t, J=8.0 Hz), 7.40 (m, 4H), 7.24 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Example 63

(265) A fluorescence-activated covalently labeling fluorescent probe 63 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(266) ##STR00089##

Compound 70

(267) 6-Bromo-1-benzothiophene (0.43 g, 2 mmol) was dissolved in 50 ml of dry dihalomethane, potassium acetate (0.4 g, 4 mmol) was added, and bromine (0.32 g, 2 mmol) was added in an ice bath. The system was slowly risen to room temperature. When the reaction was completed, 100 ml of saturated sodium thiosulfate solution was added. The organic phase was separated, and the aqueous phase was extracted three times with dichloromethane, and the organic phase was combined and dried by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a yellow product 0.64 g. and the yield was 81%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.81 (s, 1H). 7.68 (d, J=9.0 Hz, 1H), 6.92 (d, J=2.0 Hz, 1H).

Synthesis of Compound 71

(268) Compound 70 (1.27 g, 3.43 mmol) was dissolved in 50 ml of dry triethylamine, and dichloroditetra(triphenylphosphine) palladium (120.2 mg, 0.171 mmol), cuprous iodide (65.2 mg, 0.343 mmol) and trimethylsilylacetylene (344 mg, 3.43 mmol) were added, heated in an oil bath for 24 h under the protection of Ar. After completion of the reaction, 5 ml of water was added to quench the reaction. The solvent was completely removed by rotary evaporation. The residue was dissolved in diethyl ether, and filtered. Rotary evaporation was carried out to give a residue, which was used in the next step without purification.

(269) The crude product was dissolved in 30 ml of NMP, added with sodium sulfide nonahydrate (0.87 g, 3.63 mmol). The mixture was heated in an oil bath at 190° C. for 12 h under the protection of Ar, cooled at room temperature, and added with 20 ml of saturated ammonium chloride solution, and the resulting was extracted with dichloromethane three times, and the organic phase was combined and dried over anhydrous Na.sub.2SO.sub.4, and Na.sub.2SO.sub.4 was removed by filtration. The solvent was removed by rotary evaporation to give a residue which was purified by gel silica gel column chromatography to give a yellow solid 0.85 g, and the yield was 49%. .sup.1H-NMR (400 MHz, CDCl3): δ=7.87 (m, 1H), 7.71 (m, 1H), 7.51 (d, J=5.4 Hz, 1H), 7.41 (m, 1H), 7.32 (d, J=5.4 Hz, 1H).

Compound 72

(270) This compound was obtained by following the general procedure for compound 21, and the yield was 75%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.86 (m, 1H), 7.73 (m, 1H), 7.54 (d, J=5.4 Hz, 1H), 7.41 (m, 1H), 7.32 (d, J=5.4 Hz, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Compound 73

(271) This compound was obtained by following the general procedure for compound 22, and the yield was 56%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.71 (s, 1H), 7.87 (m, 1H), 7.71 (m, 1H), 7.51 (d, J=5.4 Hz, 1H), 7.32 (d, J=5.4 Hz, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Compound 74

(272) This compound was obtained by following the general procedure for compound 1, and the yield was 93%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.87 (m, 1H), 7.71 (m, 1H), 7.51 (d, J=5.4 Hz, 1H), 7.32 (d, J=5.4 Hz, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.49 (s, 9H).

Probe 63

(273) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 7.81 (s, 1H), 8.01 (s, 1H), 7.87 (m, 1H), 7.71 (m, 1H), 7.51 (d, J=5.4 Hz, 1H), 7.40 (m, 4H), 7.32 (d, J=5.4 Hz, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H), 1.49 (s, 9H).

Example 64

(274) A fluorescence-activated covalently labeling fluorescent probe 64 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(275) ##STR00090##

Compound 75

(276) This compound was obtained by following the general procedure for compound 75, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.87 (m, 1H), 7.71 (m, 1H), 7.51 (d, J=5.4 Hz, 1H), 7.32 (d, J=5.4 Hz, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Probe 64

(277) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.87 (m, 1H), 7.81 (s, 1H), 7.71 (m, 1H), 7.51 (d, J=5.4 Hz, 1H), 7.40 (m, 4H), 7.32 (d, J=5.4 Hz, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Example 65

(278) A fluorescence-activated covalently labeling fluorescent probe 65 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(279) ##STR00091##

Compound 76

(280) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.87 (m, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.71 (m, 1H)), 7.55 (d, 1H, J=4.0 Hz), 7.51 (d, J=5.4 Hz, 1H), 7.36-7.42 (m, 2H), 7.32 (d, J=5.4 Hz, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Probe 65

(281) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.93 (d, 1H, J=5.6), 7.87 (m, 1H), 7.77 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.71 (m, 1H)), 7.55 (d, 1H, J=4.0 Hz), 7.51 (d, J=5.4 Hz, 1H), 7.36-7.42 (m, 4H), 7.32 (d, J=5.4 Hz, 1H), 7.19 (d, 2H, J=8.0 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).

Example 66

(282) A fluorescence-activated covalently labeling fluorescent probe 66 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(283) ##STR00092##

Compound 77

(284) Compound 58 (0.554 g, 2 mmol) and 5-aldehyde-2-thiopheneboronic acid (0.374 g, 2.4 mmol) were dissolved in 10 ml of toluene, 10 ml of ethanol, and 2 ml of 2 N K.sub.2CO.sub.3 solution was added. After heating in an oil bath at 85° C. for 5 hrs under the protection of Ar, the reaction was completed, and the solution was cooled at room temperature, and then the reaction was quenched with water (10 ml). The organic phase was separated and the aqueous phase was extracted with dichloromethane. The organic phase was combined, washed with brine, dried over anhydrous sodium sulfate and the solvent was removed by rotary evaporation to give a residue which was purified by gel silica gel column chromatography to give a pure product 0.339 g, and the yield was 65%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.81 (s, 1H), 7.68 (s, 1H), 7.55 (d, 1H, J=8.00 Hz), 7.25 (d, 2H, J=8.00 Hz), 6.78 (d, 2H, J=8.00 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H).

Compound 78

(285) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.01 (s, 1H), 7.68 (s, 1H), 7.55 (d, 1H, J=8.00 Hz), 7.25 (d, 2H, J=8.00 Hz), 6.78 (d, 2H, J=8.00 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 1.50 (s, 9H).

Probe 66

(286) This probe was obtained by following the general procedure for probe 1, and the yield was 54%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.01 (s, 1H), 7.81 (s, 1H), 7.68 (s, 1H), 7.55 (d, 1H, J=8.00 Hz), 7.40 (m, 4H), 7.25 (d, 2H, J=8.00 Hz), 6.78 (d, 2H, J=8.00 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 1.50 (s, 9H).

Example 67

(287) A fluorescence-activated covalently labeling fluorescent probe 67 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(288) ##STR00093##

Compound 79

(289) Cyanoacetic acid (1.0 g, 10 mmol) was added to a 25 ml round bottom flask, and 2-methoxyethylamine was added and stirred at room temperature under the protection of Ar. After completion of the reaction, 10 ml of anhydrous diethyl ether was added, and the mixture was separated by ultrasonication, filtered, and dried in vacuo to give a white solid. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=6.5 (s, 1H), 3.48-3.52 (m, 4H), 3.38 (s, 3H).

Compound 80

(290) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.31 (s, 1H), 8.22 (bt, 1H), 7.82 (d, 1H, J=4.00 Hz), 7.58 (d, 2H, J=8.80 Hz), 7.50 (d, 2H, J=4.00 Hz), 6.77 (d, 2H, J=8.80 Hz), 4.74 (bt, 1H), 3.57 (t, 2H, J=5.20 Hz), 3.41-3.48 (m, 4H), 3.38 (t, 2H, J=5.20 Hz), 3.27 (s, 3H), 3.01 (s, 3H).

Probe 67

(291) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.31 (s, 1H), 8.22 (bt, 1H), 7.82 (m, 2H), 7.58 (d, 2H, J=8.80 Hz), 7.50 (d, 2H, J=4.00 Hz), 7.40 (m, 4H), 6.77 (d, 2H, J=8.80 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.74 (bt, 1H), 4.40 (d, 2H, J=4.8 Hz), 3.57 (t, 2H, J=5.20 Hz), 3.41-3.48 (m, 4H), 3.38 (t, 2H, J=5.20 Hz), 3.27 (s, 3H), 3.01 (s, 3H).

Example 68

(292) A fluorescence-activated covalently labeling fluorescent probe 68 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(293) ##STR00094##

Probe 68

(294) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.99 (s, 1H), 8.31 (s, 1H), 8.22 (bt, 1H), 7.82 (d, 1H, J=4.00 Hz), 7.58 (d, 2H, J=8.80 Hz), 7.50 (d, 2H, J=4.00 Hz), 7.39 (d, 2H, J=8.4 Hz), 7.26 (d, 2H, J=8.4 Hz), 7.09 (s, 2H), 6.77 (d, 2H, J=8.80 Hz), 6.10 (s, 1H), 5.26 (s, 2H), 4.74 (bt, 1H), 4.36 (s, 2H), 3.57 (t, 2H, J=5.20 Hz), 3.41-3.48 (m, 4H), 3.38 (t, 2H, J=5.20 Hz), 3.27 (s, 3H), 3.01 (s, 3H).

Example 69

(295) A fluorescence-activated covalently labeling fluorescent probe 69 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(296) ##STR00095##

Probe 69

(297) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.31 (s, 1H), 8.22 (bt, 1H), 7.93 (d, 1H, J=5.6), 7.82 (d, 1H, J=4.00 Hz), 7.75 (s, 1H), 7.58 (d, 2H, J=8.80 Hz), 7.50 (d, 2H, J=4.00 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.77 (d, 2H, J=8.80 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.74 (bt, 1H), 4.45 (d, 2H, J=5.6 Hz), 3.57 (t, 2H, J=5.20 Hz), 3.41-3.48 (m, 4H), 3.38 (t, 2H, J=5.20 Hz), 3.27 (s, 3H), 3.01 (s, 3H).

Example 70

(298) A fluorescence-activated covalently labeling fluorescent probe 70 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(299) ##STR00096##

Compound 81

(300) The synthesis was carried out by the method disclosed in the reference (WO2013142841 (A1) Sep. 26, 2013). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.87 (s, 2H), 7.54 (s, 1H), 7.42 (d, J=5.6 Hz, 1H), 7.39 (d, J=5.6 Hz, 1H).

Compound 82

(301) This compound was obtained by following the general procedure for compound 21, and the yield was 76%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.87 (s, 2H), 7.54 (s, 1H), 7.42 (d, J=5.6 Hz, 1H), 7.39 (d, J=5.6 Hz, 1H), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H).

Compound 83

(302) This compound was obtained by following the general procedure for compound 22, and the yield was 62%. .sup.1H-NMR (400 MHz, CDCl3): δ=9.99 (s, 1H), 7.89 (s, 2H), 7.59 (s, 1H), 7.27 (s, 1H), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H).

Compound 84

(303) This compound was obtained by following the general procedure for compound 1, and the yield was 88%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.89 (s, 2H), 7.59 (s, 1H), 7.27 (s, 1H), 7.05 (s, 1H), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H).

Probe 70

(304) This probe was obtained by following the general procedure for probe 1, and the yield was 54%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.22 (s, 1H), 10.11 (s, 1H), 7.89 (s, 2H), 7.81 (s, 1H), 7.59 (s, 1H), 7.40 (m, 4H), 7.27 (s, 1H), 7.05 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H).

Example 71

(305) A fluorescence-activated covalently labeling fluorescent probe 71 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(306) ##STR00097##

Compound 85

(307) This compound was obtained by following the general procedure for compound 1, and the yield was 95%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.98 (s, 1H), 7.89 (s, 2H), 7.59 (s, 1H), 7.27 (s, 1H), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.48-3.50 (m, 4H), 3.38 (s, 3H), 3.06 (s, 3H).

Probe 71

(308) This probe was obtained by following the general procedure for probe 1, and the yield was 66%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.92 (s, 1H), 10.21 (s, 1H), 7.98 (s, 1H), 7.89 (s, 2H), 7.81 (s, 1H), 7.59 (s, 1H), 7.40 (m, 4H), 7.27 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.48-3.50 (m, 4H), 3.38 (s, 3H), 3.06 (s, 3H).

Example 72

(309) A fluorescence-activated covalently labeling fluorescent probe 72 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(310) ##STR00098##

Probe 72

(311) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.98 (s, 1H), 7.93 (d, 1H, J=5.6), 7.89 (s, 2H), 7.75 (s, 1H), 7.59 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.27 (s, 1H), 7.19 (d, 2H, J=8.0 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.48-3.50 (m, 4H), 3.38 (s, 3H), 3.06 (s, 3H).

Example 73

(312) A fluorescence-activated covalently labeling fluorescent probe 73 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(313) ##STR00099##

Compound 87

(314) The synthesis was carried out by the method disclosed in the literature (Takuya M. et al. RSC Adv. 2015.5.55406-55410). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.20 (d, 2H, J=4.8 Hz), 7.07 (d, 2H, J=4.8 Hz), 0.41 (s, 6H).

Compound 88

(315) Compound 87 (0.4 g, 1.8 mmol) was dissolved in 100 ml of anhydrous tetrahydrofuran, cooled to −30° C., added with N-bromodibutimide, stirred under the protection of Ar for 2 hrs, and 5 ml of water was added to quench the reaction. The system was returned to room temperature, and the solvent was completely removed by rotary evaporation, and the residue was dissolved in 100 ml of dichloromethane and washed with water three times. The organic phase was dried over anhydrous Na.sub.2SO.sub.4, and Na.sub.2SO.sub.4 was removed by filtration. The solvent was removed by rotary evaporation to give a residue which was purified by gel silica gel column chromatography to give a white solid 0.31 g, and the yield was 57%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.73 (s, 1H), 7.42 (d, 1H, J=4.8 Hz), 7.15 (d, 1H, J=4.8 Hz), 0.46 (s, 6H).

Compound 89

(316) This compound was obtained by following the general procedure for compound 21, and the yield was 76%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.73 (s, 1H), 7.42 (d, 1H, J=4.8 Hz), 7.15 (d, 1H, J=4.8 Hz), 3.86 (t, 2H, J=4.80 Hz), 3.56 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H).

Compound 90

(317) This compound was obtained by following the general procedure for compound 22, and the yield was 66%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.87 (s, 1H), 7.83 (s, 1H), 7.10 (s, 1H), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H).

Compound 91

(318) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.83 (s, 1H), 7.11 (s, 1H), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H).

Probe 73

(319) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.82 (s, 1H), 10.00 (s, 1H), 7.83 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.11 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H).

Example 74

(320) A fluorescence-activated covalently labeling fluorescent probe 74 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(321) ##STR00100##

Compound 92

(322) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.83 (s, 1H), 7.11 (s, 1H), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 1.50 (s, 9H), 0.42 (s, 6H).

Probe 74

(323) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=10.92 (s, 1H), 9.84 (s, 1H), 7.83 (s, 1H), 7.71 (s, 1H), 7.40 (m, 4H), 7.11 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 1.50 (s, 9H), 0.46 (s, 6H).

Example 75

(324) A fluorescence-activated covalently labeling fluorescent probe 75 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(325) ##STR00101##

Compound 93

(326) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.83 (s, 1H), 7.74 (1H, d, J=4.0 Hz), 7.55 (1H, d, J=4.0 Hz), 7.36-7.42 (2H, m), 7.11 (s, 1H), 4.12 (2H, s), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.42 (s, 6H).

Probe 75

(327) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.22 (s, 1H), 10.01 (s, 1H), 7.89 (s, 1H), 7.81 (s, 1H), 7.74 (1H, d, J=4.0 Hz), 7.70 (1H, d, J=4.0 Hz), 7.63-7.48 (m, 5H), 7.46 (m, 4H), 7.36-7.42 (2H, m), 7.11 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 4.12 (2H, s), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.13 (s, 3H), 3.06 (s, 3H), 0.46 (s, 6H).

Example 76

(328) A fluorescence-activated covalently labeling fluorescent probe 76 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(329) ##STR00102##

Compound 94

(330) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.99 (s, 1H), 7.11 (s, 1H), 6.50 (s, 1H), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H).

Probe 76

(331) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.42 (s, 1H), 10.01 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.4 (m, 4H), 7.11 (s, 1H), 6.50 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H).

Example 77

(332) A fluorescence-activated covalently labeling fluorescent probe 77 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(333) ##STR00103##

Compound 95

(334) The synthesis was carried out by the method disclosed in the literature (Martinez M. et al. Org. Biomol. Chem. 2012, 10.3892-3898). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.24 (dd, J.sub.1=5.2 Hz, J.sub.2=1.2 Hz, 1H), 7.13 (dd, 1H, J.sub.1=3.6 Hz, J.sub.2=1.2 Hz), 7.03 (dd, 1H, J.sub.1=5.2 Hz, J.sub.2=1.2 Hz), 6.99 (d, 1H, J=3.8 Hz), 6.93 (d, 1H, J=3.6 Hz).

Compound 96

(335) This compound was obtained by following the general procedure for compound 21, and the yield was 78%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.25 (dd, J.sub.1=5.2 Hz, J.sub.2=1.2 Hz, 1H), 7.13 (dd, 1H, J.sub.1=3.6 Hz, J.sub.2=1.2 Hz), 7.03 (dd, 1H, J.sub.1=5.2 Hz, J.sub.2=1.2 Hz), 6.99 (d, 1H, J=3.8 Hz), 6.93 (d, 1H, J=3.6 Hz), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.10 (s, 3H).

Compound 97

(336) This compound was obtained by following the general procedure for compound 22, and the yield was 65%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.75 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 5.81 (d, 1H, J=4.00 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.27 (s, 3H), 3.13 (s, 3H).

Compound 98

(337) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.00 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 5.81 (d, 1H, J=4.00 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H), 1.50 (s, 9H).

Probe 77

(338) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.52 (s, 1H), 10.01 (s, 1H), 8.00 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 6.29 (s, 2H), 5.81 (d, 1H, J=4.00 Hz), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.27 (s, 3H), 3.13 (s, 3H), 1.50 (s, 9H).

Example 78

(339) A fluorescence-activated covalently labeling fluorescent probe 78 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(340) ##STR00104##

Compound 99

(341) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.40 (m, 4H), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 6.29 (s, 2H), 5.81 (d, 1H, J=4.00 Hz), 5.46 (s, 2H), 4.40 (d, 2 H, J=4.8 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.48-3.52 (m, 4H), 3.38 (s, 3H), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Probe 78

(342) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.00 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 5.81 (d, 1H, J=4.00 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.48-3.52 (m, 4H), 3.38 (s, 3H), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Example 79

(343) A fluorescence-activated covalently labeling fluorescent probe 79 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(344) ##STR00105##

Compound 100

(345) This compound was obtained by following the general procedure for compound 1, and the yield was 97%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.04 (d, 1H, J=8.0 Hz), 7.94 (d, 1H, J=8.0 Hz), 7.89 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 5.81 (d, 1H, J=4.00 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Probe 79

(346) This probe was obtained by following the general procedure for probe 1, and the yield was 48%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.82 (s, 1H), 10.21 (s, 1H), 8.04 (d, 1H, J=8.0 Hz), 7.94 (d, 1H, J=8.0 Hz), 7.89 (s, 1H), 7.81 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (m, 4H), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 6.29 (s, 2H), 5.81 (d, 1H, J=4.00 Hz), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Example 80

(347) A fluorescence-activated covalently labeling fluorescent probe 80 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(348) ##STR00106##

Probe 80

(349) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.00 (s, 1H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.81 (d, 1H, J=4.00 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H), 1.50 (s, 9H).

Example 81

(350) A fluorescence-activated covalently labeling fluorescent probe 81 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(351) ##STR00107##

Compound 99

(352) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.00 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.57 (d, 1H, J=4.00 Hz), 7.51 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 5.81 (d, 1H, J=4.00 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Probe 81

(353) This probe was obtained by following the general procedure for probe 1, and the yield was 58%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.00 (s, 1H), 7.93 (d, 1H, J=5.6), 7.79 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.57 (d, 1H, J=4.00 Hz), 7.51 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 4H), 7.19 (d, 2H, J=8.0 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.81 (d, 1H, J=4.00 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Example 82

(354) A fluorescence-activated covalently labeling fluorescent probe 82 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(355) ##STR00108##

Probe 82

(356) This probe was obtained by following the general procedure for probe 1, and the yield was 57%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.04 (d, 1H, J=8.0 Hz), 7.94 (d, 2H, J=8.0 Hz), 7.89 (s, 1H), 7.75 (s, 1H), 7.57 (d, 1H, J=4.00 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 7.13 (d, 1H, J=4.00 Hz), 6.95 (d, 1H, J=4.00 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.81 (d, 1H, J=4.00 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.67 (t, 2H, J=5.60 Hz), 3.35 (t, 2H, J=5.60 Hz), 3.13 (s, 3H).

Example 83

(357) A fluorescence-activated covalently labeling fluorescent probe 83 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(358) ##STR00109##

Compound 101

(359) The synthesis was carried out by the method disclosed in the literature (WO2002020499 (A1). Apr. 14, 2002). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=6.91 (m, 2H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H) 4.71 (t, 1H, J=5.6 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H).

Compound 102

(360) This compound was obtained by following the general procedure for compound 22, and the yield was 57%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=9.89 (s, 1H), 7.21 (s, 1H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H) 4.71 (t, 1H, J=5.6 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H).

Compound 103

(361) This compound was obtained by following the general procedure for compound 1, and the yield was 88%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.99 (s, 1H), 7.21 (s, 1H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H) 4.71 (t, 1H, J=5.6 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H), 1.49 (s, 9H).

Probe 83

(362) This probe was obtained by following the general procedure for probe 1, and the yield was 68%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.42 (s, 1H), 10.01 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.21 (s, 1H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H), 1.49 (s, 9H).

Example 84

(363) A fluorescence-activated covalently labeling fluorescent probe 84 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(364) ##STR00110##

Probe 84

(365) This probe was obtained by following the general procedure for probe 1, and the yield was 48%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.99 (s, 1H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.21 (s, 1H), 7.19 (d, 2H, J=8.0 Hz), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H), 1.49 (s, 9H).

Example 85

(366) A fluorescence-activated covalently labeling fluorescent probe 85 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(367) ##STR00111##

Compound 104

(368) This compound was obtained by following the general procedure for compound 1, and the yield was 88%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.99 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.21 (s, 1H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H) 4.71 (t, 1H, J=5.6 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H).

Probe 85

(369) This probe was obtained by following the general procedure for probe 1, and the yield was 49%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.82 (s, 1H), 10.51 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.47 (m, 4H), 7.36-7.42 (m, 2H), 7.21 (s, 1H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H).

Example 86

(370) A fluorescence-activated covalently labeling fluorescent probe 86 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(371) ##STR00112##

Probe 86

(372) This probe was obtained by following the general procedure for probe 1, and the yield was 91%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.04 (d, 1H, J=8.0 Hz), 8.02 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.21 (s, 1H), 6.71 (d, 1H, J=8.0 Hz), 6.50 (m, 1H) 4.71 (t, 1H, J=5.6 Hz), 3.62 (m, 2H), 3.56 (m, 2H), 3.35 (m, 2H), 3.00 (m, 2H).

Example 87

(373) A fluorescence-activated covalently labeling fluorescent probe 87 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(374) ##STR00113##

Compound 106

(375) The synthesis was carried out by the method disclosed in Hao Y et al. Tetrahedron 2012. 68.552-558. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.06 (d, 1H, J=7.6 Hz), 6.94 (t, 1H, J=7.6H), 6.58 (t, 1H, J=7.2 Hz), 6.4 (d, 1H, 7.8 Hz), 5.19 (s, 1H), 2.35 (s, 3H), 1.36 (s, 6H).

Compound 107

(376) Compound 106 (1.73 g, 10 mmol) was added to a 250 ml round bottom flask, potassium carbonate (2.76 g, 20 mol), bromoethanol (2.48 g, 20 mmol) was added, and 120 ml of acetonitrile was added. The mixture was heated to reflux in an oil bath for 48 h under the protection of Ar. After completion of the reaction, the system was filtered, and the solvent was completely removed by rotary evaporation. The residue was dissolved in 100 ml of dichloromethane, washed three times with 50 ml of water, and the organic phase was dried over anhydrous sodium sulfate. The solvent was removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a brown product 1.76 g, and the yield was 81%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.06 (d, 1H, J=7.6 Hz), 6.94 (t, 1H, J=7.6H), 6.58 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Compound 108

(377) This compound was obtained by following the general procedure for compound 22, and the yield was 65%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.89 (s, 1H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Compound 109

(378) This compound was obtained by following the general procedure for compound 1, and the yield was 99%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (s, 1H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.50 (s, 9H), 1.36 (s, 6H).

Probe 87

(379) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.82 (s, 1H), 9.73 (s, 1H), 8.03 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.50 (s, 9H), 1.36 (s, 6H).

Example 88

(380) A fluorescence-activated covalently labeling fluorescent probe 88 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(381) ##STR00114##

Compound 110

(382) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.30 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Probe 88

(383) This probe was obtained by following the general procedure for probe 1, and the yield was 56%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.72 (s, 1H), 9.56 (s, 1H), 8.03 (s, 1H), 7.81 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.49 (m, 4H), 7.36-7.42 (m, 2H), 7.30 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Example 89

(384) A fluorescence-activated covalently labeling fluorescent probe 89 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(385) ##STR00115##

Compound 111

(386) This compound was obtained by following the general procedure for compound 1, and the yield was 99%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.04 (d, 1H, J=8.0 Hz), 7.99 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Probe 89

(387) This probe was obtained by following the general procedure for probe 1, and the yield was 61%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.76 (s, 1H), 9.86 (s, 1H), 8.04 (d, 1H, J=8.0 Hz), 7.99 (s, 1H), 7.90 (d, 1H, J=8.0 Hz), 7.81 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.40 (m, 4H), 7.45 (t, 1H, J=8.0 Hz), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Example 90

(388) A fluorescence-activated covalently labeling fluorescent probe 90 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(389) ##STR00116##

Probe 90

(390) This probe was obtained by following the general procedure for probe 1, and the yield was 52%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.03 (s, 1H), 7.93 (d, 1H, J=5.6), 7.75 (s, 1H), 7.38 (d, 1H, J=7.6 Hz), 7.31 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.50 (s, 9H), 1.36 (s, 6H).

Example 91

(391) A fluorescence-activated covalently labeling fluorescent probe 91 for CLIP protein tags was constructed using a molecular rotor as viscosity-sensitive fluorescent dye.

(392) ##STR00117##

Probe 91

(393) This probe was obtained by following the general procedure for probe 1, and the yield was 59%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.04 (d, 1H, J=8.0 Hz), 7.99 (s, 1H), 7.93 (d, 1H, J=5.6), 7.90 (d, 1H, J=8.0 Hz), 7.75 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.36 (d, 1H, J=7.6 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.19 (d, 2H, J=8.0 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.16 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Example 92

(394) A fluorescence-activated covalently labeling fluorescent probe 92 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(395) ##STR00118##

Compound 112

(396) The synthesis was carried out by the method disclosed in the literature (Ping Yan. et al. J. Org. Chem. 2008, 73, 6587-6594). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 1.50 (s, 6H).

Compound 113

(397) This compound was obtained by following the general procedure for compound 21, and the yield was 76%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz) 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Compound 114

(398) This compound was obtained by following the general procedure for compound 22, and the yield was 66%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.89 (s, 1H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Compound 115

(399) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.89 (s, 1H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (m, 15H).

Probe 92

(400) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d6): δ=12.42 (s, 1H), 10.01 (s, 1H), 7.89 (s, 1H), 7.18 (s, 1H), 7.81 (s, 1H), 7.4 (m, 4H), 6.96 (d, 2H, J=5.6 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (m, 15H).

Example 93

(401) A fluorescence-activated covalently labeling fluorescent probe 93 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(402) ##STR00119##

Compound 116

(403) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.89 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 4.12 (s, 2H), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Probe 93

(404) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.42 (s, 1H), 10.01 (s, 1H), 7.89 (s, 1H), 7.81 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 6H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 4.12 (s, 2H), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Example 94

(405) A fluorescence-activated covalently labeling fluorescent probe 94 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(406) ##STR00120##

Compound 117

(407) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.04 (d, 1H, J=8.0 Hz), 7.93 (d, 1H, J=8.0 Hz), 7.89 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 4.24 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Probe 94

(408) This probe was obtained by following the general procedure for probe 1, and the yield was 45%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): 12.42 (s, 1H), 10.01 (s, 1H), δ=8.04 (d, 1H, J=8.0 Hz), 7.93 (d, 1H, J=8.0 Hz), 7.89 (s, 1H), 7.81 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.40 (m, 4H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 4.24 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Example 95

(409) A fluorescence-activated covalently labeling fluorescent probe 95 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(410) ##STR00121##

Probe 95

(411) This probe was obtained by following the general procedure for probe 1, and the yield was 58%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.93 (d, 1H, J=7.2 Hz), 7.89 (s, 1H), 7.75 (s, 1H), 7.33 (d, 2H, J=8.0 Hz), 7.23 (d, 2H, J=8.0 Hz), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.15 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (m, 15H).

Example 96

(412) A fluorescence-activated covalently labeling fluorescent probe 96 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(413) ##STR00122##

Probe 96

(414) This probe was obtained by following the general procedure for probe 1, and the yield was 55%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.93 (d, 1H, J=7.2 Hz), 7.89 (s, 1H), 7.79 (s, 1H), 7.74 (d, 1H, J=4.0 Hz), 7.55 (d, 1H, J=4.0 Hz), 7.36-7.42 (m, 2H), 7.31 (d, 2H, J=8.0 Hz), 7.18 (m, 3H), 6.96 (d, 2H, J=5.6 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.15 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 4.12 (s, 2H), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Example 97

(415) A fluorescence-activated covalently labeling fluorescent probe 97 for CLIP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(416) ##STR00123##

Probe 97

(417) This probe was obtained by following the general procedure for probe 1, and the yield was 98%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.04 (d, 1H, J=8.0 Hz), 7.93 (m, 2H), 7.89 (s, 1H), 7.75 (s, 1H), 7.53 (t, 1H, J=8.0 Hz), 7.45 (t, 1H, J=8.0 Hz), 7.33 (d, 2H, J=8.0 Hz), 7.23 (d, 2H, J=8.0 Hz), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 6.06 (d, 1H, J=5.6 Hz), 5.27 (s, 2H), 5.15 (s, 2H), 4.45 (d, 2H, J=5.6 Hz), 4.24 (s, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H), 1.50 (s, 6H).

Example 98

(418) A fluorescence-activated covalently labeling fluorescent probe 98 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(419) ##STR00124##

Compound 118

(420) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.89 (s, 1H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 98

(421) This probe was obtained by following the general procedure for probe 1, and the yield was 33%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.12 (s, 1H), 10.05 (s, 1H), 7.89 (s, 1H), 7.81 (s, 1H), 7.4 (m, 4H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 99

(422) A fluorescence-activated covalently labeling fluorescent reference probe 99 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(423) ##STR00125##

Comparative Probe 99

(424) Compound 112 (0.375 g, 1 mmol), Compound 2 (0.297 g, 1.1 mmol) and benzotriazol-1-yl-oxytripyrrolidinylphosphonium hexafluorophosphate (0.625 g, 1.2 mmol) were dissolved in 15 ml of anhydrous dimethylformamide, and 0.2 ml of triethylamine was added, and the mixture was stirred at room temperature for 2 hrs under the protection of Ar. After the completion of the reaction, the solvent was completely removed by rotary evaporation, and the residue was purified by gel silica gel column chromatography to give a yellow solid 0.458, and the yield was 73%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.12 (s, 1H), 10.05 (s, 1H), 7.89 (s, 1H), 7.81 (s, 1H), 7.4 (m, 4H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 100

(425) A fluorescence-activated covalently labeling fluorescent reference probe 100 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(426) ##STR00126##

Compound 119

(427) The synthesis was carried out by the method disclosed in (Shirisha Gurrapu et al. ACS Med. Chem. Lett. 2015. 6.558-561). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.11 (s, 1H), 7.97 (d, 2H, J=9.0 Hz), 6.69 (d, 2H, J=9.6 Hz), 3.20 (s, 6H).

Comparative Probe 100

(428) This probe was obtained by following the general procedure for the reference probe 99, and the yield was 81%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.52 (s, 1H), 10.01 (s, 1H), 8.11 (s, 1H), 7.97 (d, 2H, J=9.0 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 6.69 (d, 2H, J=9.6 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.20 (s, 6H).

Example 101

(429) A fluorescence-activated covalently labeling fluorescent probe 101 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(430) ##STR00127##

Compound 120

(431) This compound was obtained by following the general procedure for compound 1, and the yield was 95%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.07 (s, 1H), 7.93 (d, 2H, J=9.2 Hz), 6.85 (d, 2H, J=9.2 Hz), 3.55-3.59 (m, 4H), 3.08 (s, 3H).

Probe 101

(432) This probe was obtained by following the general procedure for probe 1, and the yield was 35%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.22 (s, 1H), 10.01 (s, 1H), 8.07 (s, 1H), 7.93 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.4 (m, 4H), 6.85 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.55-3.59 (m, 4H), 3.08 (s, 3H).

Comparative Example 102

(433) A fluorescence-activated covalently labeling fluorescent reference probe 102 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(434) ##STR00128##

Comparative Probe 102

(435) This probe was obtained by following the general procedure for the reference probe 99, and the yield was 65%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=12.22 (s, 1H), 10.01 (s, 1H), 8.07 (s, 1H), 7.93 (d, 2H, J=9.2 Hz), 7.81 (s, 1H), 7.4 (m, 4H), 6.85 (d, 2H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.55-3.59 (m, 4H), 3.08 (s, 3H).

Example 103

(436) A fluorescence-activated covalently labeling fluorescent probe 103 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(437) ##STR00129##

Compound 122

(438) This compound was obtained by following the general procedure for compound 1, and the yield was 89%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.09 (s, 1H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Probe 103

(439) This probe was obtained by following the general procedure for probe 1, and the yield was 89%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.22 (s, 1H), 9.87 (s, 1H), 8.09 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Comparative Example 104

(440) A fluorescence-activated covalently labeling fluorescent reference probe 104 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(441) ##STR00130##

Comparative Probe 104

(442) This probe was obtained by following the general procedure for probe 1, and the yield was 89%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.22 (s, 1H), 9.87 (s, 1H), 8.09 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.46 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Example 105

(443) A fluorescence-activated covalently labeling fluorescent probe 105 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(444) ##STR00131##

Compound 123

(445) This compound was obtained by following the general procedure for compound 1, and the yield was 99%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.03 (s, 1H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 3.11 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Probe 105

(446) This probe was obtained by following the general procedure for probe 99, and the yield was 95%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.72 (s, 1H), 9.89 (s, 1H), 8.03 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.11 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Comparative Example 106

(447) A fluorescence-activated covalently labeling fluorescent probe 106 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(448) ##STR00132##

Comparative Probe 106

(449) This probe was obtained by following the general procedure for the reference probe 99, and the yield was 95%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.72 (s, 1H), 9.89 (s, 1H), 8.03 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 7.36 (d, 1H, J=7.6 Hz), 6.78 (t, 1H, J=7.2 Hz), 6.49 (d, 1H, 7.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.11 (m, 4H), 2.35 (s, 3H), 1.36 (s, 6H).

Example 107

(450) A fluorescence-activated covalently labeling fluorescent probe 107 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(451) ##STR00133##

Compound 124

(452) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.02 (s, 1H), 6.43 (s, 1H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 107

(453) This probe was obtained by following the general procedure for probe 1, and the yield was 39%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.72 (s, 1H), 9.79 (s, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 6.43 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2 H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 108

(454) A fluorescence-activated covalently labeling fluorescent reference probe 6 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(455) ##STR00134##

Comparative Probe 108

(456) This probe was obtained by following the general procedure for probe 92, and the yield was 89%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.72 (s, 1H), 9.79 (s, 1H), 8.22 (s, 1H), 8.02 (s, 1H), 7.81 (s, 1H), 7.40 (m, 4H), 6.43 (s, 1H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 109

(457) A fluorescence-activated covalently labeling fluorescent probe 109 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(458) ##STR00135##

Compound 125

(459) This compound was obtained by following the general procedure for compound 1, and the yield was 89%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.00 (s, 1H), 7.49 (d, 2H, J=8.8 Hz), 6.74 (d, 2H, J=8.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 109

(460) This probe was obtained by following the general procedure for probe 99, and the yield was 93%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.51 (s, 1H), 9.72 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.49 (d, 2H, J=8.8 Hz), 7.40 (m, 4H), 6.74 (d, 2H, J=8.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 110

(461) A fluorescence-activated covalently labeling fluorescent reference probe 110 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(462) ##STR00136##

Comparative Probe 110

(463) This probe was obtained by following the general procedure for the reference probe 99, and the yield was 93%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.51 (s, 1H), 9.72 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.49 (d, 2H, J=8.8 Hz), 7.40 (m, 4H), 6.74 (d, 2H, J=8.8 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 111

(464) A fluorescence-activated covalently labeling fluorescent probe 111 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(465) ##STR00137##

Compound 127

(466) This compound was obtained by following the general procedure for compound 1, and the yield was 98%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.95 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=9.0 Hz), 6.92 (d, 1H, J=2.0), 6.82 (d, 1H, J=9.2 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H)

Probe 111

(467) This probe was obtained by following the general procedure for probe 99, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.12 (s, 1H), 10.09 (s, 1H), 7.95 (s, 1H), 7.81 (m, 2H), 7.68 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0), 6.82 (d, 1H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 112

(468) A fluorescence-activated covalently labeling fluorescent reference probe 112 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(469) ##STR00138##

Comparative Probe 112

(470) This probe was obtained by following the general procedure for the reference probe 99, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=12.12 (s, 1H), 10.09 (s, 1H), 7.95 (s, 1H), 7.81 (m, 2H), 7.68 (d, 1H, J=9.0 Hz), 7.40 (m, 4H), 6.92 (d, 1H, J=2.0), 6.82 (d, 1H, J=9.2 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 113

(471) A fluorescence-activated covalently labeling fluorescent reference probe 113 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(472) ##STR00139##

Compound 128

(473) This compound was synthesized according to the method disclosed in the literature (Masahiro Ono et al. Bioorg. Med. Chem. 2009, 17, 7002-7007). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=10.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.07-7.04 (m, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Compound 129

(474) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.07-7.04 (m, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Probe 113

(475) This probe was obtained by following the general procedure for the reference probe 99, and the yield was 89%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.42 (s, 1H), 9.89 (s, 1H), 8.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 7.07-7.04 (m, 2H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 114

(476) A fluorescence-activated covalently labeling fluorescent probe 114 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(477) ##STR00140##

Compound 130

(478) This compound was obtained by following the general procedure for compound 1, and the yield was 96%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.07-7.04 (m, 2H), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 114

(479) This probe was obtained by following the general procedure for probe 92, and the yield was 89%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.42 (s, 1H), 9.89 (s, 1H), 8.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 7.07-7.04 (m, 2H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 115

(480) A fluorescence-activated covalently labeling fluorescent reference probe 115 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(481) ##STR00141##

Comparative Probe 115

(482) This probe was obtained by following the general procedure for probe 99, the yield was 89%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.42 (s, 1H), 9.89 (s, 1H), 8.06 (s, 1H), 8.03 (d, 1H, J=10.0 Hz), 7.81 (s, 1H), 7.40 (m, 4H), 7.07-7.04 (m, 2H), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 116

(483) A fluorescence-activated covalently labeling fluorescent reference probe 116 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(484) ##STR00142##

Compound 131

(485) The synthesis was carried out by the method disclosed in the literature (Marian. Z. J. et. al. Tetrahedron., 2008, 64, 10605-10618). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.98 (s, 1H), 7.68 (d, 1H, J=4.0 Hz), 7.56 (d, 2H, J=9.0 Hz), 7.24 (d, 1H, J=4.0 Hz), 6.72 (d, 2H, J=9.0 Hz), 3.03 (s, 6H).

Compound 132

(486) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.00 (s, 1H), 7.68 (d, 1H, J=4.0 Hz), 7.56 (d, 2H, J=9.0 Hz), 7.24 (d, 1H, J=4.0 Hz), 6.72 (d, 2H, J=9.0 Hz), 3.03 (s, 6H).

Comparative Probe 116

(487) This probe was obtained by following the general procedure for probe 92, and the yield was 97%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.02 (s, 1H), 9.56 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=4.0 Hz), 7.56 (d, 2H, J=9.0 Hz), 7.40 (m, 4H), 7.24 (d, 1H, J=4.0 Hz), 6.72 (d, 2H, J=9.0 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.03 (s, 6H).

Example 117

(488) A fluorescence-activated covalently labeling fluorescent probe 117 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(489) ##STR00143##

Compound 133

(490) This compound was obtained by following the general procedure for compound 1, and the yield was 91%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=8.00 (s, 1H), 7.68 (d, 1H, J=4.0 Hz), 7.56 (d, 2H, J=9.0 Hz), 7.24 (d, 1H, J=4.0 Hz), 6.72 (d, 2H, J=9.0 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 117

(491) This probe was obtained by following the general procedure for probe 99, and the yield was 97%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.02 (s, 1H), 9.56 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=4.0 Hz), 7.56 (d, 2H, J=9.0 Hz), 7.40 (m, 4H), 7.24 (d, 1H, J=4.0 Hz), 6.72 (d, 2H, J=9.0 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 118

(492) A fluorescence-activated covalently labeling fluorescent reference probe 118 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(493) ##STR00144##

Comparative Probe 118

(494) This probe was obtained by following the general procedure for probe 92, and the yield was 97%. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=11.02 (s, 1H), 9.56 (s, 1H), 8.00 (s, 1H), 7.81 (s, 1H), 7.68 (d, 1H, J=4.0 Hz), 7.56 (d, 2H, J=9.0 Hz), 7.40 (m, 4H), 7.24 (d, 1H, J=4.0 Hz), 6.72 (d, 2H, J=9.0 Hz), 6.29 (s, 2H), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 119

(495) A fluorescence-activated covalently labeling fluorescent reference probe 119 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(496) ##STR00145##

Compound 134

(497) The synthesis was carried out by the method disclosed in the literature (US 20090042227 (A1). 2009 Dec. 12). .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=9.75 (s, 1H), 7.57 (d, 1H, J=4.0 Hz), 7.13 (d, 1H, J=4.0 Hz), 6.95 (d, 1H, J=4.0 Hz), 5.81 (d, 1H, J=4.0 Hz), 3.00 (s, 6H).

Compound 135

(498) This compound was obtained by following the general procedure for compound 1, and the yield was 94%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.99 (s, 1H), 7.57 (d, 1H, J=4.0 Hz), 7.13 (d, 1H, J=4.0 Hz), 6.95 (d, 1H, J=4.0 Hz), 5.81 (d, 1H, J=4.0 Hz), 3.00 (s, 6H).

Reference Probe 119

(499) This probe was obtained by following the general procedure for the reference probe 99. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.32 (s, 1H), 9.75 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.57 (d, 1H, J=4.0 Hz), 7.40 (m, 4H), 7.13 (d, 1H, J=4.0 Hz), 6.95 (d, 1H, J=4.0 Hz), 6.29 (s, 2H), 5.81 (d, 1H, J=4.0 Hz), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.00 (s, 6H).

Example 120

(500) A fluorescence-activated covalently labeling fluorescent probe 120 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(501) ##STR00146##

Compound 136

(502) This compound was obtained by following the general procedure for compound 1, and the yield was 94%. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.99 (s, 1H), 7.57 (d, 1H, J=4.0 Hz), 7.13 (d, 1H, J=4.0 Hz), 6.95 (d, 1H, J=4.0 Hz), 5.81 (d, 1H, J=4.0 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Probe 120

(503) This probe was obtained by following the general procedure for probe 1. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.32 (s, 1H), 9.75 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.57 (d, 1H, J=4.0 Hz), 7.40 (m, 4H), 7.13 (d, 1H, J=4.0 Hz), 6.95 (d, 1H, J=4.0 Hz), 6.29 (s, 2H), 5.81 (d, 1H, J=4.0 Hz), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Comparative Example 121

(504) A fluorescence-activated covalently labeling fluorescent reference probe 121 for SNAP protein tags was constructed using a molecular rotor as a viscosity-sensitive fluorescent dye.

(505) ##STR00147##

Reference Probe 121

(506) This probe was obtained by following the general procedure for probe 99. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=11.32 (s, 1H), 9.75 (s, 1H), 7.99 (s, 1H), 7.81 (s, 1H), 7.57 (d, 1H, J=4.0 Hz), 7.40 (m, 4H), 7.13 (d, 1H, J=4.0 Hz), 6.95 (d, 1H, J=4.0 Hz), 6.29 (s, 2H), 5.81 (d, 1H, J=4.0 Hz), 5.46 (s, 2H), 4.40 (d, 2H, J=4.8 Hz), 3.85 (t, 2H, J=5.6 Hz), 3.60 (t, 2H, J=5.6 Hz), 3.10 (s, 3H).

Example 122

(507) Reference probes BG-CCVJ and BG-gly-CCVJ were prepared by the method reported in literature (T. Y. Wang et al. Chem Sci. 2016, 7, 301-307).

(508) Probes 1 to 98, 101, 103, 105, 107, 109, 111, 114, 117, and 120, and the reference probes 99, 100, 102, 104, 106, 108, 110, 112, 113, 115, 116, 118, 119, 121, BG-CCVJ and BG-Gly-CCVJ were dissolved in dimethyl sulfoxide, respectively, to prepare mother liquors having a concentration of 1×10.sup.−2 M, to each of which glycerol and methanol were added and uniformly mixed, to prepare solutions finally having a concentration of 1×10.sup.−5 M. Depending on the probes, fluorescence emission spectra of the probes were detected successively with the maximum excitation wavelength of each probe under the same conditions, and the results were shown in Table 1.

(509) As can be seen from Table 1, the probes of the Examples have fluorescence emission wavelength in a wide range, and have fluorescence intensity in glycerol significantly different from that in methanol. That is, these probes are sensitive to viscosity changes and have viscosity responsiveness.

Example 123

(510) Probes were mixed with corresponding protein tags to obtain mixed samples, in which the final probe concentration was 5 μM, and the final protein tag concentration was 10 μM. The mixed samples were incubated 37° C. for 1 hr, fluorescence spectrophotometer was used to detect the change in fluorescence intensity, and the results are shown in Table 1.

(511) It can be seen from the quantum yield of free probe in Table 1 that the probes of the Examples and the reference probes had extremely low fluorescence prior to binding to a protein tag, close to the background fluorescence level of a PBS buffer, which indicates that prior to binding to the protein tag, the fluorescence of the viscosity-sensitive fluorescent probes has not been activated. From the quantum yield of probe bound to protein tag, after reacting with the protein tags, the probes of the Examples could be detected to have significant signal enhancement in corresponding excitation transmission channels, the fluorescence activation multiple reached several hundreds to a thousand or more, and the brightness was high, which illustrates that after the probes of the Examples are bound to the protein tags, fluorescence of the probes can be activated, and the probes have good fluorescent molecular switching properties. In contrast, though the fluorescence of the reference probes could also be activated, the quantum yield of activated fluorescence was very low, and the brightness was very poor. In particular, in view of comparison results between probe 98 and reference probe 99, probe 101 and reference probe 102, probe 103 and reference probe 104, probe 105 and reference probe 106, probe 107 and reference probe 108, probe 109 and reference probe 110, probe 111 and reference probe 112, probe 114 and reference probe 115, probe 117 and reference probe 118, probe 120 and reference probe 121 in Table 1, for the same fluorescent dye, when the ligand is connected to the electron donor part of the fluorescent dye, the fluorescence activation brightness of the probe is much higher than the reference probe in which ligand is connected to the electron acceptor part of the fluorescent dye.

(512) Accordingly, it can be seen that the fluorescence of the probe binding protein tag of the embodiment can be activated and has good fluorescence molecular switching properties. Compared with the reference probes formed by binding a ligand to an electron acceptor of the fluorescent dyes, the probes formed by binding a ligand to an electron donor of the fluorescent dyes in the Examples have significantly improved fluorescence activation brightness.

(513) TABLE-US-00001 TABLE 1 fluorescence emission spectra of different probes Quantum Fluorescence Quantum yield of probe Emission Fluorescence ratio in yield of free bound to wavelength/ activation glycerol to Name probe protein tag nm multiple methanol probe 1 <0.001 0.35 480 360 560 probe 2 0.001 0.15 510 146 410 probe 3 0.0019 0.27 532 139 399 probe 4 <0.001 0.35 480 490 562 probe 5 <0.001 0.15 555 1174 790 probe 6 <0.001 0.37 610 989 1183 probe 7 <0.001 0.23 480 1502 1455 probe 8 0.0018 0.12 510 68 320 probe 9 <0.001 0.21 531 745 851 probe 10 <0.001 0.39 482 431 655 probe 11 0.0013 0.36 481 270 422 probe 12 0.0012 0.41 482 351 405 probe 13 <0.001 0.29 483 315 391 probe 14 <0.001 0.18 531 771 560 probe 15 <0.001 0.21 580 277 320 probe 16 <0.001 0.21 580 359 311 probe 17 <0.001 0.15 580 498 402 probe 18 0.0017 0.45 535 265 301 probe 19 0.0012 0.45 535 361 299 probe 20 <0.001 0.32 535 398 341 probe 21 <0.001 0.48 555 560 1481 probe 22 <0.001 0.36 590 610 1821 probe 23 <0.001 0.42 610 712 1235 probe 24 <0.001 0.48 555 590 1681 probe 25 <0.001 0.36 590 670 1621 probe 26 <0.001 0.42 610 910 1123 probe 27 <0.001 0.39 555 665 1134 probe 28 <0.001 0.31 590 551 1132 probe 29 <0.001 0.33 610 621 998 probe 30 <0.001 0.55 570 535 1125 probe 31 <0.001 0.41 607 421 1135 probe 32 <0.001 0.46 609 638 997 probe 33 <0.001 0.55 570 957 1781 probe 34 <0.001 0.48 570 857 1774 probe 35 0.0012 0.53 570 433 972 probe 36 0.001 0.50 570 488 1258 probe 37 0.0012 0.56 570 469 1135 probe 38 0.0011 0.56 570 503 1011 probe 39 0.0016 0.55 570 335 892 probe 40 0.001 0.41 570 421 759 probe 41 0.0015 0.31 575 212 101 probe 42 0.0013 0.38 600 298 178 probe 43 <0.001 0.37 602 982 1028 probe 44 <0.001 0.37 603 1586 1459 probe 45 <0.001 0.29 603 958 752 probe 46 <0.001 0.21 620 563 682 probe 47 <0.001 0.26 627 358 235 probe 48 <0.001 0.16 625 428 180 probe 49 <0.001 0.11 601 541 210 probe 50 <0.001 0.29 612 416 358 probe 51 <0.001 0.25 625 392 359 probe 52 <0.001 0.25 625 435 270 probe 53 <0.001 0.18 625 579 401 probe 54 <0.001 0.17 650 498 391 probe 55 <0.001 0.25 651 382 211 probe 56 <0.001 0.39 566 989 436 probe 57 <0.001 0.31 566 1026 762 probe 58 <0.001 0.27 590 519 419 probe 59 <0.001 0.39 600 498 370 probe 60 0.0011 0.81 620 751 1199 probe 61 0.0012 0.77 620 668 817 probe 62 <0.001 0.32 640 592 711 probe 63 0.0015 0.73 620 486 531 probe 64 <0.001 0.48 620 519 632 probe 65 <0.001 0.66 650 798 391 probe 66 <0.001 0.37 620 512 386 probe 67 <0.001 0.36 620 576 276 probe 68 <0.001 0.36 620 681 381 probe 69 <0.001 0.27 620 491 217 probe 70 0.0026 0.68 640 258 131 probe 71 0.0028 0.67 640 239 121 probe 72 0.001 0.47 640 486 268 probe 73 0.0031 0.76 680 248 325 probe 74 0.0025 0.78 680 311 297 probe 75 0.0021 0.44 700 211 105 probe 76 0.0011 0.37 680 351 186 probe 77 0.0014 0.38 655 268 279 probe 78 <0.001 0.28 672 369 189 probe 79 <0.001 0.31 681 419 298 probe 80 0.0011 0.38 655 349 218 probe 81 <0.001 0.29 672 391 235 probe 82 <0.001 0.21 681 321 241 probe 83 <0.001 0.18 515 209 103 probe 84 <0.001 0.16 515 431 121 probe 85 <0.001 0.15 535 391 187 probe 86 <0.001 0.17 550 413 214 probe 87 <0.001 0.45 575 515 209 probe 88 <0.001 0.29 595 621 298 probe 89 <0.001 0.32 612 421 129 probe 90 <0.001 0.28 575 541 109 probe 91 0.0013 0.24 612 192 163 probe 92 <0.001 0.65 645 923 241 probe 93 <0.001 0.56 675 753 362 probe 94 <0.001 0.47 700 569 158 probe 95 <0.001 0.42 645 553 431 probe 96 <0.001 0.31 675 435 125 probe 97 <0.001 0.23 700 812 261 probe 98 <0.001 0.78 650 893 182 Reference <0.001 0.01 649 53 129 Probe 99 Reference <0.001 0.011 480 43 213 Probe 100 probe 101 <0.001 0.37 481 463 362 Reference <0.001 0.02 480 31 212 Probe 102 probe 103 <0.001 0.27 515 651 321 Reference <0.001 0.02 515 23 351 Probe 104 probe 105 <0.001 0.41 510 549 328 Reference <0.001 0.01 555 62 215 Probe 106 probe 107 <0.001 0.47 555 564 526 Reference <0.001 0.02 555 30 329 Probe 108 probe 109 <0.001 0.33 566 546 341 Reference <0.001 0.01 567 23 218 Probe 110 probe 111 <0.001 0.49 570 681 621 Reference <0.001 0.01 570 41 211 Probe 112 Reference <0.001 0.01 625 36 129 Probe 113 probe 114 <0.001 0.27 625 328 230 Reference <0.001 0.01 625 38 113 Probe 115 Reference <0.001 0.01 620 29 125 Probe 116 probe 117 <0.001 0.39 620 562 321 Reference <0.001 0.02 621 29 158 Probe 118 Reference <0.001 0.01 655 15 362 Probe 119 probe 120 <0.001 0.42 656 469 421 Reference <0.001 0.01 655 39 219 Probe 121 Reference <0.001 0.02 501 170 260 Probe BG-CCVJ Reference <0.001 — — 60 260 Probe BG-Gly-CCVJ

Example 124

(514) SNAP protein tags were added to 30 μM the solutions of probe 1, probe 14, probe 21, probe 30, probe 48, probe 43, probe 56, respectively, to produce mixed sample solutions in which the final concentration of the SNAP protein tags was 0.1 μM, 0.5 μM, 0.7 μM, 1.2 μM, 4.5 μM, 8.1 μM, 13.1 μM and 14.8 μM. The mixed sample solutions were placed at 37° C. to react for 1 hr. A fluorescence spectrophotometer was used to detect the change in excitation emission spectrum of the sample, and the relationship between SNAP protein tag concentration and fluorescence intensity was drawn according to the emission spectrum intensity, and the results were shown in FIGS. 2 to 11, respectively.

(515) As can be seen from FIG. 2, SNAP protein tag concentration within the range of 0.1 um to 14.8 um has a good linear relationship with the fluorescence intensity of the probe, so protein tags can be quantitatively detected according to the standard curve.

Example 125

(516) HeLa cells were taken as an example to exhibit the labeling effect of the compound in mammalian cells. HeLa cells with stable expression of protein tags and HeLa-WT cells (HeLa primitive cells, with no protein tag expressed) were implanted in a 14 mm glass-bottom 96-well cell culture plate and stabilized for 10 hrs. Probes 1, 15, 21, 30, 56, 60, 63, 88 were added to the media, respectively and diluted to 5 μMs. The cells were incubated in a carbon dioxide incubator at 37° C. for 2 hrs, and then a Leica TPS-8 confocal microscopy was used to image the fluorescent changes of the labeled cells. The results of group B in FIG. 12 show that no corresponding fluorescence signal was detected in HeLa-WT cells after the addition of the aforesaid probes, indicating that the fluorescence of the probes was not affected by the intracellular environment. However, for HeLa cells with protein tags expressed shown by group A in FIG. 12, strong fluorescent signals could be detected, which are nearly 300 times stronger.

(517) The above experiments indicate that the probe can specifically label intracellular protein tags and achieve fluorescence specific lighting, and meanwhile, the fluorescence of the probe is not affected by the intracellular environment.

Example 126

(518) To verify that probes 1, 21, 48, 60, 66 and 77 can be used to label target proteins located by different organelles, HeLa cells were taken as an example to detect the effect of probes on labeling different subcellular proteins. HeLa cells were implanted 5000 cells per well in a 96-well glass-bottom cell culture plate. 14 hrs later, the cells were transfected with the plasmids encoding different organelle localized protein tags using Lipo2000; the original medium was removed 24 hrs after transfection, washed with a phenol-free red DMEM medium twice, and incubated with a phenol-free red medium containing 0.2 μM probes for 2 hrs, and then the cell labeling effects were detected by imaging with a leica TCS-8 confocal microscopy. Results are shown in FIG. 13. The probes can clearly display a variety of subcellular organelle structures without washing, including but not limited to nucleus, mitochondria, golgi body, endoplasmic reticulum, whole cell, cytoskeleton, extracellular membrane, lysosome, and endometrium.

(519) These results indicate that the probe can be used as a powerful tool for labeling cell subcellular organelles.

Example 127

(520) HeLa cells were implanted 5000 cells per well in a 96-well glass-bottom cell culture plate. 14 hrs later, the cells were transfected with pcdna3.1-clip-nls (The plasmid encoding nucleus localized CLIP tag), pcdna3.1-mito-snap (The plasmid encoding mitochondrial localized SNAP tag) using Lipo2000, 0.1 μM per well. The original medium was removed 24 hrs after transfection, washed twice with a phenol-free red DMEM medium. Then, the cells were incubated respectively with a phenol-free red media containing 0.2 μM probe 1 and probe 43 for two hrs, and then the cell labeling effects were detected by imaging with a leica TCS-8 confocal microscopy. Results are shown in FIG. 13. The probe 1 and problem 43 respectively can clearly display the structures of mitochondrial and nuclear without washing, and the co-localization coefficient of the fluorescence channel of nuclear labeled by probe 43 and the fluorescence channel of mitochondria labeled by probe 1 is less than 0.1, indicating that the two fluorescence channels will not interfere with each other.

(521) The above experiments indicated that the spectra of fluorescence groups of different probes would not interfere with each other, and orthogonal labeling imaging could be performed simultaneously.

Example 128

(522) First, a SNAP protein tag expressing plasmid, pcdna3.1-SNAP (sample group), and a control plasmid without SNAP protein tag expressing, pcdna3.1-CAT (control group), were introduced into mice. This method dissolves plasmids in a large volume of solution and rapidly injects them into mice through tail vein injection. The mouse liver and kidneys absorb DNA and then express the target protein. 20 hrs after plasmid injection, 0.4 μM probe 88 dissolved in 200 μl PBS was injected into mice through tail vein injection to label the SNAP protein tag. 6 hrs later, the mice were dissected, and the fluorescence differences in the liver parts of different mouse samples were detected by KODAK multi-spectral in vivo imaging system. Results are shown in FIG. 15. The liver fluorescence of the control plasmid pcdna3.1-CAT injected with probe 88 was very low, close to the background fluorescence level of the blank liver without the probe, while the liver of SNAP plasmid pcdna3.1-SNAP injected with probe 88 had strong fluorescence, and the signal intensity was more than 20 times higher than that of the control group.

(523) The above experiments showed that the fluorescence of the probe was not affected by the internal environment of animals, and it could be applied to live animals in vivo, and it could specifically label SNAP protein tags expressed in liver parts and generate strong fluorescence signals.

Example 129

(524) Through the directed evolution displayed by phage, after six rounds of SNAP-tag screening, two SNAP-tag mutants were cloned, which were SNAP F33G and SNAP V164E, respectively. The two SNAP-tag mutants were labeled by probes 1, 21, 40, respectively in accordance with the method described in Example 123. As shown by the results, under the same conditions, the quantum yield after fluorescence activation of the probes was 2.1 to 1.6 times of the original yield, as compared with the sequences disclosed by a literature (Bright Mollwitz et al. Biochem 2012, 51, 986-986).

(525) Attached is the DNA sequences of SNAP F33G and SNAP V164E:

(526) DNA sequence of SNAP F33G (SEQ ID NO: 1):

(527) TABLE-US-00002 ATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGG CAAGCTGGAACTGTCTGGGTGCGAACAGGGCCTGCACCGTATCATCGGCC TGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCTGCCCCAGCC GCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAA CGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCC TGCACCACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTGG AAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCACCT GGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCC TGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTGGTGCAG GGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGTGAAAGAGTG GCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTTAA

(528) DNA sequence of SNAP V164E (SEQ ID NO: 2):

(529) TABLE-US-00003 ATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGG CAAGCTGGAACTGTCTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCC TGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCTGCCCCAGCC GCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAA CGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCC TGCACCACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTGG AAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCACCT GGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCC TGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTGGTGCAG GGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGAGAAAGAGTG GCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTTAA

Example 130

(530) To verify the correlation between the fluorescent activation of the probe of the present invention and the existence of proteins, SNAP protein in mammalian cells was taken as an example, and the fluorescence changes of SNAP protein binding probes after protein degradation were detected in HeLa cells by taking AID degradation system as an example. Firstly, HeLa cells were implanted 20,000/cm.sup.2 in a 20 mm glass-bottom cell culture dish, and 14 hrs later, plasmids pcdna3.1-TIR1 and pcdna3.1-SNAP-IAA17-H2B were transfected by invitrogen's lipofectmain2000 transfection reagent. 24 hrs after the cell transfection, the original cell culture medium was replaced with a phenol-free red DMEM medium containing 1 μM of probe 21 to label the cells. The cell samples were incubated in a carbon dioxide incubator at 37° C. for 1 hour. After the labeling was completed, the fluorescence signal of labeled cells was detected by imaging with a Leica SP8 laser confocal microscopy, and indoleacetic acid (IAA) was added to induce SNAP-IAA17-H2B protein to degrade, and the cell fluorescence changes were detected during the protein degradation. Results are as shown in FIG. 16, the SNAP-IAA17-H2B protein was located in the nucleus (0 min), and protein degradation was induced by indoleacetic acid. With the increase of time, the fluorescence signal of SNAP-IAA17-H2B protein was gradually decreased. When indoleacetic acid was added for 120 min, the fluorescence signal was basically invisible, and the protein degradation rate was consistent with the results reported in literature. The above experiment indicates that the fluorescent properties of probes in mammalian cells also depend on the presence of proteins. When proteins exist, the fluorescence is activated, and when proteins are degraded, the fluorescence disappears, which can be used to track and monitor the degradation process of target proteins.

Example 131

(531) To verify that the probe of the present invention can be used to monitor the assembly and degradation process of biological macromolecules in mammalian cells in real time, the process of tracing the assembly of intercellular protein CX43 to form intercellular channels in mammalian cells by the probe was detected by taking HeLa cells as an example. The C-terminal of CX43 gene was fused with SNAP gene, and HeLa cell line with stable expression of fusion protein CX43-SNAP was constructed and obtained by lentivirus infection technology. HeLa-CX43-SNAP cell lines were implanted in a 20 mm glass-bottom cell culture dish 10 hrs before the probe labeling. To conduct labeling, a phenol-free red DMEM medium was first used to dilute the probe 21 to 2 μM to replace the original cell culture medium. Cells were incubated in a carbon dioxide incubator at 37° C. for 1 hour. The cells were then washed twice using a fresh phenol-free red DMEM medium, with unbound probe 21 removed at 2-minute intervals. Then, DMEM phenol-free red culture medium containing 1 μM probe 1 was added to label cells. Leica SP8 confocal microscopy was used to monitor for a long time the fluorescence intensity and position changes of labeled cell samples at the corresponding fluorescence channels of probes 21 and 1, as shown in FIGS. 17A and 17B, respectively. A long-columnar specific fluorescence signal between two cells can be seen in the fluorescence channel of probe 21, as shown in FIG. 17A, consistent with the results reported in the literature (Guido Gaietta et al. Science 2002, 296, 503-507). When probe 1 was just added, the fluorescence signal could not be detected in its corresponding fluorescence channel, as shown in FIG. 17B, indicating that probe 21 labeled all CX43 proteins present in the cell. With the extension of culture time, new CX43-SNAP proteins were synthesized and labeled by probe 1. After labeling for 2 hrs, a fluorescent signal of probe 1 appeared and gradually increased at the edge of intercellular channels labeled by probe 21, while the fluorescent signal of probe 21 originally at the intercellular channels gradually decreased, indicating that the CX43-SNAP protein newly synthesized in intercellular channels replaced the original CX43-SNAP protein gradually from the surrounding to the center. The superimposed channel are as shown in FIG. 17C, consistent with the results reported in literature. The above experimental results demonstrate that SNAP series of compounds can be applied to real-time monitoring of the assembly and degradation of biomacromolecules in cells.