Method for detecting aflatoxin B1 based on fluorescent copper nanoparticles

Abstract

Disclosed is a method for detecting aflatoxin B1 based on fluorescent copper nanoparticles, belonging to the technical fields of analytical chemistry, materials science and nano biosensing. In the disclosure, β-CD@DNA-Cu NMs are prepared by using Y-shaped DNA as a template, ascorbic acid as a reducing agent and β-CD as a fluorescence stabilizing and enhancing agent. Then, a ratiometric fluorescent probe is constructed based on the β-CD@DNA-Cu NMs. Finally, the detection of AFB1 with high sensitivity, high selectivity and high accuracy is achieved by using the fluorescent probe. According to the method of the disclosure, in linear ranges of 0.03-10 ppb and 10-18 ppb, a ratio value of I.sub.433 nm/I.sub.650 nm and a concentration of AFB1 exhibit a good linear relationship respectively, and a limit of detection is 0.012 ppb (S/N=3). Metal ions Ca.sup.2+ may be replaced with Yb.sup.3+, Y.sup.3+, Er.sup.3+ and Pt.sup.2+, which are also suitable for increasing sensitivity of AFB1 in rice.

Claims

1. A method for preparing fluorescent copper nanoparticles β-CD@DNA-Cu NMs, comprising the following steps: (1) preparing of DNA-Cu NMs by mixing a template strand Y-shaped DNA solution and an ascorbic acid solution uniformly, then adding a cupric acetate solution, and mixing the mixture uniformly to obtain a DNA-Cu NMs solution; and (2) preparing of β-CD modified DNA-Cu NMs by mixing the DNA-Cu NMs solution obtained in step (1) and a β-CD solution uniformly, and performing ultrafiltration to obtain the β-CD@DNA-Cu NMs.

2. The method according to claim 1, wherein the β-CD solution in step (2) has a concentration of 0.5-5 mM.

3. The method according to claim 1, wherein further comprising preparing the template strand Y-shaped DNA in step (1) by: mixing three oligonucleotide strands (Y.sub.0a, Y.sub.0b, Y.sub.0c) equally in an MOPS buffer to obtain a mixed solution; then heating the mixed solution to 90° C., and after 5 min of denaturation, slowly cooling the mixed solution to room temperature to obtain the Y-shaped DNA; and storing the Y-shaped DNA solution in a refrigerator at −18° C., wherein the MOPS buffer has a concentration of 5-20 mM, a concentration of NaAc is 75-300 mM, a concentration of MgCl.sub.2 is 1-10 mM, and a pH is 6.5-8.5; a DNA sequence of Y.sub.0a is set forth in SEQ ID NO.1: CCTGTCTGCCTAATGTGCGTCGTAAG; a DNA sequence of Y.sub.0b is set forth in SEQ ID NO.2: CTTACGACGCACAAGGAGATCATGAG; and a DNA sequence of Y.sub.0c is set forth SEQ ID NO.3: CTCATGATCTCCTTTAGGCAGACAGG.

4. A method for preparing a β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor based on the fluorescent copper nanoparticles β-CD@DNA-Cu NMs prepared by the method according to claim 1, comprising the following steps: adding a solution of the fluorescent copper nanoparticles β-CD@DNA-Cu NMs prepared by the method according to claim 1 to an AFB1 solution, shaking the mixture at 300-500 rpm for 0.5-1.5 min, and mixing the mixture uniformly to obtain the β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor, wherein a concentration of the β-CD@DNA-Cu NMs is 200 μM-2 mM, and the AFB1 solution has a concentration of 0.05-18 ppb.

5. The method according to claim 4, wherein a volume ratio of the solution of β-CD@DNA-Cu NMs to the AFB1 solution is 1:8-10.

6. The method according to claim 4, wherein the AFB1 solution is obtained by dissolving AFB1 in 1-40% methanol/water (V/V).

7. A method for preparing a β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 based on the β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor prepared by the method according to claim 4, comprising the following steps: mixing an AFB1 solution and a metal ions M solution uniformly to obtain an M-AFB1 mixed solution; and then adding a solution of the fluorescent copper nanoparticles β-CD@DNA-Cu NMs prepared by the method according to claim 1 to the M-AFB1 mixed solution, shaking the mixture at 300-500 rpm for 0.5-1.5 min, and mixing the mixture uniformly to obtain the β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor.

8. The method according to claim 7, wherein the AFB1 solution has a concentration of 0.05-18 ppb, the metal ions M solution has a concentration of 1-50 mM, and the metal ions M comprise Pt.sup.2+, Yb.sup.3+, Er.sup.3+, Y.sup.3+, Ca.sup.2+ and Hg.sup.2+.

9. The method according to claim 7, wherein metal compounds corresponding to the metal ions M comprise: tetrachloroplatinic acid, ytterbium chloride hexahydrate, erbium chloride, yttrium chloride hexahydrate, anhydrous calcium chloride and an Hg.sup.2+ standard solution.

10. The method according to claim 7, wherein a volume ratio of the AFB1 solution to the metal ions M solution is 7-9:1.

11. The method according to claim 7, wherein a volume ratio of the solution of β-CD@DNA-Cu NMs to the M-AFB1 mixed solution is 1:9.

12. A β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 prepared by the method according to claim 7.

13. A method for detecting AFB1 based on the β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 according to claim 12, comprising the following steps: (1) pretreatment of sample: adding an extraction solvent to a sample to be tested to carry out extraction, and carrying out centrifugation and filtration to obtain a sample to be analyzed; and (2) testing: carrying out fluorescence detection on the sample to be analyzed to obtain fluorescence values at 433 nm and 650 nm, I.sub.433 nm and I.sub.650 nm, and then substituting the fluorescence values into an AFB1 standard curve to obtain a concentration of AFB1 in the sample to be tested.

14. The method according to claim 13, wherein the extraction solvent in step (1) is one of methanol/water, ethanol/water or acetonitrile/water with a volume fraction of 40%.

15. The method according to claim 13, wherein a ratio of the sample to be tested to the extraction solvent in step (1) is 1:3-5 in g/mL.

16. The method according to claim 13, wherein the AFB1 standard curve in step (2) is I.sub.433 nm/I.sub.650 nm=0.0627C−0.0068, R.sup.2=0.9963, and a linear range is 0.03-10 ppb; and I.sub.433 nm/I.sub.650 nm=0.4825C−4.7038, R.sup.2=0.9736, and a limit of detection is 0.012 ppb (S/N=3), wherein I.sub.433 nm is the maximum fluorescence value of AFB1, I.sub.650 nm is the maximum fluorescence value of β-CD@DNA-Cu NMs, and the ratio value of I.sub.433 nm/I.sub.650 nm represents the detection result; and C is the concentration of AFB1.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 is a schematic diagram of detection of AFB1 by a β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor.

(2) FIG. 2A shows TEM images of β-CD@DNA-Cu NMs modified with β-CD at 0.5 mM.

(3) FIG. 2B shows TEM images of β-CD@DNA-Cu NMs modified with β-CD at 2 mM.

(4) FIG. 2C shows TEM images of β-CD@DNA-Cu NMs modified with β-CD at 5 mM.

(5) FIG. 3 shows a fluorescence excitation spectrum (Ex) and an emission spectrum (Em) of β-CD@DNA-Cu NMs.

(6) FIG. 4A shows ratiometric fluorescent curves of β-CD@DNA-Cu NMs-Ca.sup.2+-AFB1 when different concentrations of AFB1 are added.

(7) FIG. 4B shows standard curves of β-CD@DNA-Cu NMs-Ca.sup.2+-AFB1 when different concentrations of AFB1 are added.

(8) FIG. 5A shows fluorescence spectra when other toxins in the grain sample (rice) are detected by the β-CD@DNA-Cu NMs-M-AFB1.

(9) FIG. 5B shows the ratio value of I.sub.433 nm/I.sub.650 nm when other toxins in the grain sample (rice) are detected by the β-CD@DNA-Cu NMs-M-AFB1.

DETAILED DESCRIPTION

(10) Preferred examples of the disclosure will be described below. It should be understood that the examples are intended to better explain the disclosure and are not intended to limit the disclosure.

Example 1

(11) A method for preparing fluorescent copper nanoparticles β-CD@DNA-Cu NMs included the following steps:

(12) (1) Preparation of template strand Y-shaped complementary nucleic acid duplex (Y-shaped DNA):

(13) Three oligonucleotide strands (Y.sub.0a, Y.sub.0b, Y.sub.0c) (Table 1) were equally mixed in an MOPS buffer (10 mM, pH 7.5, 150 mM NaAc, 1 mM MgCl.sub.2) to obtain a mixed solution. Then the mixed solution was heated to 90° C., and after 5 min of denaturation, the mixed solution was slowly cooled to room temperature to obtain the Y-shaped DNA. The Y-shaped DNA solution was stored in a refrigerator at −18° C.

(14) TABLE-US-00001 TABLE 1 DNA sequences of oligonucleotide strands No. Sequence (from 5′ to 3′) Y.sub.0a CCTGTCTGCCTAATGTGCGTCGTAAG SEQ ID NO. 1 Y.sub.0b CTTACGACGCACAAGGAGATCATGAG SEQ ID NO. 2 Y.sub.0c CTCATGATCTCCTTTAGGCAGACAGG SEQ ID NO. 3

(15) (2) Preparation of DNA-Cu NMs:

(16) The Y-shaped DNA solution (500 μL, 2 μM) and an ascorbic acid solution (500 μL, 1.25 mM) were mixed, then a cupric acetate solution (200 μL, 2 mM) was added, and the mixture was mixed thoroughly for 20 min until the solution turned yellow, thereby obtaining a DNA-Cu NMs solution.

(17) (3) β-CD modified DNA-Cu NMs:

(18) 900 μL of the DNA-Cu NMs solution and 133 μL of β-CD (2 mM) were mixed thoroughly for 1 min until the mixed solution turned from yellow to colorless. Then the excess reagents were removed by ultrafiltration through a 10 kd ultrafiltration tube to obtain β-CD@DNA-Cu NMs, which were stored at 4° C. in the dark. A schematic diagram of synthesis of β-CD@DNA-Cu NMs is shown in FIG. 1.

(19) The Y-shaped DNA solution was prepared and diluted with an MOPS buffer (10 mM, pH 7.5, 150 mM NaAc, 1 mM MgCl.sub.2). The ascorbic acid solution, the cupric acetate solution and the β-CD solution were prepared and diluted with ultrapure water (18.2 MΩ.Math.cm).

Example 2 Optimization of Preparation Process of Fluorescent Copper Nanoparticles

(20) The concentrations of the β-CD solution in Example 1 were adjusted to 0.5 mM, 2 mM and 5 mM, and the others conditions were the same as those in Example 1, thereby obtaining β-CD@DNA-Cu NMs.

(21) The obtained β-CD@DNA-Cu NMs were subjected to fluorescence testing under an excitation bandwidth of 10 nm, a slit width of 10 nm and an excitation wavelength of 365 nm. The test results are as follows:

(22) FIG. 2A, FIG. 2B and FIG. 2C shows TEM images of β-CD@DNA-Cu NMs modified with β-CD at different concentrations. As can be seen from FIG. 2A, FIG. 2B and FIG. 2C, as the concentration of β-CD increased from 0.5 mM to 2 mM and 5 mM, the average sizes of the β-CD@DNA-Cu NMs respectively increased from 10 nm to 12 nm and 14 nm. When the concentration of β-CD was in the range of 0-5 mM, with the increase of its concentration, the fluorescence became stronger. The fluorescence enhancement was associated with the stability of β-CD to copper nanoparticles. From the aspect of characterization, as the concentration of β-CD increased, the particle size increased, which was due to the increase in the quantity of β-CD modified copper nanoparticles.

(23) A fluorescence excitation spectrum (Ex) and an emission spectrum (Em) of β-CD@DNA-Cu NMs are shown in FIG. 3. The β-CD modified β-CD@DNA-Cu NMs at 2 mM exhibited spherical particles with uniform particle size and good dispersion, and had an average particle size of 12 nm, thus being the best. The fluorescence excitation wavelength of the β-CD@DNA-Cu NMs was in the range of 358-410 nm. When the excitation wavelength was between 358 nm and 410 nm, the emission peak of the β-CD@DNA-Cu NMs was not affected. Therefore, in order to obtain the maximum AFB1 fluorescence signal, 365 nm was selected as the excitation wavelength of the β-CD@DNA-Cu NMs-AFB1 or the β-CD@DNA-Cu NMs-M-AFB1 ratiometric system.

Example 3

(24) A method for preparing a β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor included the following steps:

(25) The solution of β-CD@DNA-Cu NMs (100 μL, 200 μM) obtained in Example 1 was added to an AFB1 solution (900 μL, 10 ppb), the mixture was shaken at 400 rpm for 1 min, and the mixture was mixed uniformly to obtain the β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor.

(26) The obtained β-CD@DNA-Cu NMs-AFB1 ratiometric fluorescent sensor was subjected to fluorescence testing under an excitation bandwidth of 10 nm, a slit width of 10 nm and an excitation wavelength of 365 nm. Fluorescence values at emission peaks 433 nm (AFB1) and 650 nm (β-CD@DNA-Cu NMs) were detected.

Example 4

(27) A method for preparing a β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 included the following steps:

(28) (1) An AFB1 standard solution was diluted to 10 ppb with methanol/water with a volume fraction of 40%. The β-CD@DNA-Cu NMs prepared in Example 1 were diluted to 200 μM with methanol/water with a volume fraction of 40%. A metal ions M solution was diluted with methanol/water with a volume fraction of 40%.

(29) (2) 800 μL of AFB1 solution and 100 μL of metal ions M solution (the concentrations are shown in Table 2) were mixed to obtain an M-AFB1 mixed solution. Then, 100 μL of solution of β-CD@DNA-Cu NMs was added to 900 μL of M-AFB1 mixed solution, and the mixture was shaken at 400 rpm for 1 min to obtain the β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1.

(30) The metal ions M include: platinum ions (Pt.sup.2+), palladium ions (Pd.sup.2+), ytterbium ions (Yb.sup.3+), erbium ions (Er.sup.3+), yttrium ions (Y.sup.3+), magnesium ions (Mg.sup.2+), thulium ions (Tm.sup.3+), calcium ions (Ca.sup.2+), mercury ions (Hg.sup.2+), potassium ions (K.sup.+), sodium ions (Na.sup.+), aluminum ions (Al.sup.3+) and copper ions (Cu.sup.2+). Metal compounds used were: tetrachloroplatinic acid (K.sub.2PtCl.sub.4), anhydrous palladium chloride (PdCl.sub.2), ytterbium chloride hexahydrate (YbCl.sub.3.Math.6H.sub.2O), erbium chloride (ErCl.sub.3), yttrium chloride hexahydrate (YCl.sub.3.Math.6H.sub.2O), magnesium chloride hexahydrate (MgCl.sub.2.Math.6H.sub.2O), thulium chloride hexahydrate (TmCl.sub.3.Math.6H.sub.2O), anhydrous calcium chloride (CaCl.sub.2), an Hg.sup.2+ standard solution, potassium chloride (KCl), sodium chloride (NaCl), aluminum chloride (AlCl.sub.3) and cupric chloride (CuCl.sub.2).

(31) The obtained β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 was subjected to fluorescence spectrum detection by using a fluorophotometer under an excitation bandwidth of 10 nm, a slit width of 10 nm and an excitation wavelength of 365 nm. Fluorescence values at emission peaks 433 nm (AFB1) and 650 nm (β-CD@DNA-Cu NMs) were detected.

(32) The test results are shown in Table 2:

(33) TABLE-US-00002 TABLE 2 Effects of different metal ions on fluorescence of β-CD@DNA-Cu NMs-M-AFB1 system. Concentration of metal ions M Metal ions M (mmol/L) F.sub.C-F.sub.M (F.sub.C-F.sub.M)/F.sub.AFB1 Pt.sup.2+ 1 mM 554.5 22.13 Pd.sup.2+ 1 mM 30 1.03 Yb.sup.3+ 1 mM 485.5 18.67 Er.sup.3+ 1 mM 479.8 18.51 Y.sup.3+ 1 mM 251.3 9.67 Hg.sup.2+ 1 mM 425.7 16.37 Ca.sup.2+ 50 mM  551.24 22 Tm.sup.3+ 5 mM 18.6 0.72 Mg.sup.2+ 5 mM 28.1 1.08 K.sup.+ 5 mM 28.5 1.09 Cu.sup.2+ 5 mM 26.1 1 Al.sup.3+ 5 mM 26.3 1.01 Na.sup.+ 5 mM 26.9 1 NOTE: F.sub.C is the fluorescence intensity of β-CD@DNA-Cu NMs-M-AFB1 at 433 nm; M represents different metal ions; F.sub.M is the background fluorescence of different metal ions at 433 nm; F.sub.AFB1 is the fluorescence value of 10 ppb AFB1; and (F.sub.C-F.sub.M)/F.sub.AFB1 is the number of times of fluorescence enhancement of AFB1 caused by different metal ions in the β-CD@DNA-Cu NMs-M-AFB1 system at 433 nm.

(34) As can be seen from Table 2, 1 mM Pt.sup.2+, Yb.sup.3+, Er.sup.3+ and Y.sup.3+ could enhance the (F.sub.C−F.sub.M)/F.sub.AFB1 value of AFB1 by 9.67-22.13 times. Under the condition of the same concentration, compared with the detection effect of Hg.sup.2+, Pt.sup.2+, Yb.sup.3+, Er.sup.3+ and Y.sup.3+ in the traditional method on AFB1, this example could achieve similar enhancement effect with much lower toxicity. 50 mM Ca.sup.2+ could enhance the (F.sub.C−F.sub.M)/F.sub.AFB1 value of AFB1 by 22 times, and Ca.sup.2+ was nontoxic and could be better used in practical detection.

Example 5

(35) A method for detecting AFB1 based on a β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions M as a fluorescence enhancer of AFB1 included the following steps:

(36) (1) Creation of standard curve

(37) An AFB1 standard solution was diluted with methanol/water with a volume fraction of 40% to 0 ppb, 0.05 ppb, 2 ppb, 4 ppb, 6 ppb, 8 ppb, 10 ppb, 12 ppb, 14 ppb, 16 ppb and 18 ppb respectively. The β-CD@DNA-Cu NMs prepared in Example 1 were diluted to 200 μM with methanol/water with a volume fraction of 40%. A Ca.sup.2+ solution was diluted to 50 mM with methanol/water with a volume fraction of 40%.

(38) 800 μL of AFB1 solution at different concentrations was mixed with 100 μL of CaCl.sub.2 solution (50 mM) to obtain a Ca.sup.2+-AFB1 mixed solution. Then, 100 μL of solution of β-CD@DNA-Cu NMs was added to 900 μL of Ca.sup.2+-AFB1 mixed solution, and the mixture was shaken at 400 rpm for 1 min.

(39) By using a fluorophotometer, under an excitation bandwidth of 10 nm, a slit width of 10 nm and an excitation wavelength of 365 nm, fluorescence values at emission peaks 433 nm (AFB1) and 650 nm (β-CD@DNA-Cu NMs) were detected.

(40) A standard curve was created based on the obtained I.sub.433 nm/I.sub.650 nm and the concentration of AFB1:

(41) The AFB1 standard curve is shown in 4. The standard curve was I.sub.433 nm/I.sub.650 nm=0.0627C−0.0068, R.sup.2=0.9963, and a linear range was 0.03-10 ppb; and I.sub.433 nm/I.sub.650 nm=0.4825C−4.7038, R.sup.2=0.9736, a linear range was 10-18 ppb, and a limit of detection was 0.012 ppb (S/N=3). I.sub.433 nm was the maximum fluorescence value of AFB1, and I.sub.650 nm was the maximum fluorescence value of β-CD@DNA-Cu NMs. The ratio value of I.sub.433 nm/I.sub.650 nm represented the detection result. C was the concentration of AFB1.

(42) (2) Pretreatment of samples:

(43) AFB1 standards at concentrations of 0.5 ppb, 10 ppb and 15 ppb were respectively added to rice samples. After being dried, the samples were placed at room temperature in the dark for 2 d. Then the rice samples were finely ground to powder, which served as samples to be tested.

(44) 5.0 g of sample to be tested was accurately weighed in a 50.0 mL centrifuge tube, and 20 mL of methanol/water with a volume percentage of 40% was added. The mixture was extracted by being shaken in a shaker at a speed of 250 rpm for 30 min and then subjected to ultrasonic treatment for 10 min for extraction. After the completion of the extraction, centrifugation was carried out at a speed of 10000 r/min for 5 min, thereby obtaining a supernatant. Then, the supernatant was filtered through a 0.22 μm filter membrane to obtain a sample to be analyzed. The sample to be analyzed was stored at 4° C.

(45) (3) Testing:

(46) Before analysis, the sample to be analyzed was pre-diluted 10 times. Then fluorescent testing was carried out under an excitation bandwidth of 10 nm, a slit width of 10 nm and an excitation wavelength of 365 nm, and fluorescence values at emission peaks 433 nm (AFB1) and 650 nm (β-CD@DNA-Cu NMs) were detected.

Example 6 Accuracy and Specificity of Method of Example 5

(47) 1. Accuracy of Method

(48) AFB1 standard solutions at concentrations of 0.05 ppb, 10 ppb and 15 ppb were respectively added to rice samples, and then testing was carried out by using the β-CD@DNA-Cu NMs-M-AFB1 ratiometric fluorescent sensor with metal ions Ca.sup.2+ as a fluorescence enhancer of AFB1 in Example 4. Each sample was tested 3 times. For specific operations, reference is made to Example 5.

(49) The test results are shown in Table 3. As can be seen from Table 3, the average concentrations of AFB1 were respectively 0.049 ppb, 9.62 ppb and 15.207 ppb, the recoveries were 96.2%-101%, and the relative standard deviation (RSD) values were all less than 3.5%, indicating that the method had good accuracy and precision.

(50) TABLE-US-00003 TABLE 3 Determination of AFB1 in grain (rice) samples (n = 3) Sample Added (ppb) Found (ppb) Recovery (%) RSD (%) Rice sample 0.05 0.049 98 2.81 10 9.62 96.2 3.03 15 15.207 101.4 3.42

(51) 2. Specificity of Method: Effects of Common Toxins in Rice Samples on Detection

(52) Ratiometric fluorescent probes were constructed from different toxins and β-CD@DNA-Cu NMs and used to detect AFB1. The specific operations are as follows:

(53) 800 μL of different toxins (500 ppb, namely AFB2, AFG1, AFG2, T-2, AFM1, ZEN and OTA) or 800 μL of different toxins (500 ppb) mixed with aflatoxin B1 (10 ppb) was mixed with 100 μL of CaCl.sub.2 solution (50 mM) to obtain a mixed solution. Then 100 μL of solution of β-CD@DNA-Cu NMs (200 μM) was taken and added to 900 μL of mixed solution, and the resulting mixture was shaken at 400 rpm for 1 min. Finally, fluorescence testing was carried out. Each sample was tested 3 times.

(54) The results are shown in FIG. 5A and FIG. 5B. As can be seen from FIG. 5A and FIG. 5B, when other common toxins (AFB2, AFG1, AFG2, T-2, AFM1, ZEN and OTA) were added at a concentration of 500 ppb, the fluorescence was enhanced by less than 4 times. In contrast, when the AFB1 was added at a concentration of 10 ppb, the fluorescence was enhanced by 22 times. The results demonstrated that these other common toxins could not interfere with the detection results of AFB1.

Example 7

(55) The CaCl.sub.2 solution (50 mM) in Example 5 may be replaced with K.sub.2PtCl.sub.4 (1 mM), YbCl.sub.3.Math.6H.sub.2O (1 mM), ErCl.sub.3 (1 mM) and YCl.sub.3.Math.6H.sub.2O (1 mM), which were also suitable for detecting AFB1 in rice.