A METHOD FOR MULTIPLEXED DETECTION OF A PLURALITY OF TARGET BIOMOLECULES
20230151407 · 2023-05-18
Inventors
Cpc classification
B82Y20/00
PERFORMING OPERATIONS; TRANSPORTING
G01N21/6428
PHYSICS
B82Y40/00
PERFORMING OPERATIONS; TRANSPORTING
B82Y15/00
PERFORMING OPERATIONS; TRANSPORTING
C09K11/025
CHEMISTRY; METALLURGY
International classification
C09K11/02
CHEMISTRY; METALLURGY
Abstract
Described is a method for multiplexed detection of a plurality of target biomolecules having at least one detection target using optical encoding. The method includes steps: a. providing one or more nanoparticle types having a plurality of nanoparticles, each nanoparticle having a coating that provides binding affinity of the nanoparticle to a type-specific detection target, wherein each nanoparticle has a plurality of fluorophores that generates a signal which is unique for each nanoparticle type; b. providing a sample having a plurality of target biomolecules; c. contacting the sample with the plurality of nanoparticle types, thereby allowing the nanoparticles to bind with the detection targets of the target biomolecules; d. optically decoding the fluorophore signals emitted by the nanoparticle of the nanoparticle type bound to the detection target of the target biomolecules by measuring wavelength and intensity of the emitted signals, thereby detecting the presence and identity of the target biomolecules.
Claims
1. A method for multiplexed detection of a plurality of target biomolecules using optical encoding, wherein each target biomolecule has at least one detection target, comprising the steps of: a. providing a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle having a coating that provides binding affinity of the nanoparticle to a type-specific detection target, and wherein each nanoparticle comprises a plurality of fluorophores that generates a signal which is unique for each nanoparticle type; b. providing a sample comprising a plurality of target biomolecules; c. contacting the sample with the plurality of nanoparticle types, thereby allowing the nanoparticles to bind with the detection targets of the target biomolecules; and d. optically decoding the fluorophore signals emitted by the nanoparticle of the nanoparticle types bound to the detection target of the target biomolecules by measuring the wavelength and intensity of the emitted signals, thereby detecting the presence and identity of the target biomolecules.
2. The method according to claim 1, wherein each nanoparticle type is optically encoded by comprising controlled ratios of the plurality of fluorophores, thereby controlling the emission wavelength and intensity from the nanoparticle type, or (ii) altering the properties of the fluorophores affecting its emission intensity.
3. The method according to claim 1, wherein the binding affinity of the coating of the nanoparticle type is provided by a detection probe X attached via a linker to the nanoparticle, wherein the detection probe X is chosen from a nucleic acid molecule, an antigen or an antibody.
4. The method according to claim 1, wherein the coating of the nanoparticle furthermore comprises a repulsive component provided by a functional group Y attached via a linker to the nanoparticle, wherein the functional group Y is chosen from a charged group with a positive or negative charge, a zwitterionic group comprising both a positive or negative charge, or a sterically repulsive functional group.
5. The method according to claim 3, wherein the linker comprises at least one anchor group, which tethers the coating to the nanoparticle.
6. The method according to claim 3, wherein one or more linkers can provide one or more detection probes X and/or functional groups Y, or where multiple linkers can provide multiple detection probes X and/or functional groups Y via an interconnecting backbone.
7. The method according to claim 1, wherein the plurality of fluorophores are chosen from: (i) organic fluorophores; (ii) inorganic fluorophores; and/or (iii) a combination of organic fluorophores and inorganic fluorophores as defined in (i) and (ii).
8. The method according to claim 1, wherein the plurality of nanoparticles are silica nanoparticles, semiconductor nanoparticles, organic nanoparticles, inorganic nanoparticles, metal nanoparticles or polymeric nanoparticles, or combinations thereof.
9. The method according to claim 1, wherein the plurality of nanoparticles have an average diameter of less than 300 nm.
10. The method according to claim 1, wherein the plurality of nanoparticles are porous nanoparticles.
11. The method according to claim 1, wherein prior to step c, the target biomolecules are prepared by binding them to at least one molecule comprising the detection target for subsequent amplification.
12. The method according to claim 1, wherein the detection target comprises a nucleic acid molecule, which is, or facilitates a molecule that is, amplified using RCA or multiple hybridization events.
13. The method according to claim 1, wherein the decoding is effected by optical decoding.
14. The method according to claim 1, further providing one or more molecular probes, wherein each molecular probe comprises a fluorophore that is bound to a nucleic acid molecule, an antigen or an antibody providing binding affinity of the molecular probe to the specific detection target.
15. A kit of parts, comprising, in separate containers, (i) a plurality of nanoparticle(s) types comprising a plurality of nanoparticles, wherein each nanoparticle comprises a plurality of fluorophores that generates a signal which is unique for each nanoparticle type, (ii) a probing buffer, comprising a solution with controlled pH, salt concentration and additives facilitating specific detection target binding of the nanoparticle(s); and (iii) instructions for use of the kit in the method according to claim 1.
16. The method according to claim 5, wherein the linker further comprises a spacer group.
17. The method according to claim 7, wherein the organic fluorophores are selected from the list consisting of Atto 425, Alex fluor 405, Alexa Fluor 488, fluorescin, DiO, Atto 488, Cy3, DiI, Alexa fluor 546, Atto 550, Cy5, Alexa fluor 647, Texas red, DiD, Atto647(N), Atto 655, Cy7, Alexa fluor 680, Alexa fluor 750, Atto 680, and Atto 700, and combinations thereof.
18. The method according to claim 7, wherein the inorganic fluorophores are selected from the list consisting of quantum dots, rods, perovskite quantum dots, and metal-ligand complexes, and combinations thereof.
19. The method according to claim 1, wherein the plurality of nanoparticles have an average diameter of 3 to 100 nm.
20. The method according to claim 1, wherein the optical decoding is optical imaging.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0112] The above objects, as well as additional objects, features and advantages of the present disclosure, will be more fully appreciated by reference to the following illustrative and non-limiting detailed description of example embodiments of the present disclosure, when taken in conjunction with the accompanying drawings.
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
DEFINITIONS
[0130] The term “binding” with a target biomolecule, a nanoparticle and/or a detection target is to be interpreted as including the alternative of “hybridization” of nucleic acid molecules to each other.
[0131] The term “optical encoding” is to be interpreted as giving a particle a unique signal by incorporating a combination of multiple wavelengths and intensities of fluorophores. For example, the unique signal may be achieved by incorporating predetermined amounts of at least one fluorophore into and/or onto the nanoparticle, thereby arriving at a nanoparticle type that exhibits a specific emission wavelength and intensity.
[0132] For the avoidance of doubt, the optical encoding may be achieved by the incorporation of one, or a plurality, of fluorophores into the nanoparticles.
[0133] The term “nanoparticle type” is to be interpreted as a nanoparticle having a coating that provides binding affinity to a specific detection target and a unique optical encoding. A plurality of (e.g. at least two) nanoparticle types may be used in accordance with the invention, the various types having binding affinity for different targets. Each nanoparticle type will be represented by a plurality of nanoparticles having the same coating and optical encoding.
[0134] The term “nanoparticle” as used herein is also referred to, interchangeably, as the abbreviation “NP”.
DETAILED DESCRIPTION
[0135] Certain aspects of the present disclosure will now be described in further detail. The disclosure may, however, be embodied in other forms and should not be construed as limited to the herein disclosed embodiments. The disclosed embodiments are provided to fully convey the scope of the disclosure to the skilled person.
[0136] The first aspect of the invention provides a method for multiplexed detection of a plurality of target biomolecules using optical encoding, wherein each target biomolecule has at least one detection target, comprising the steps of: [0137] a. providing a plurality of nanoparticle types comprising a plurality of nanoparticles, each nanoparticle having a coating that provides binding affinity of the nanoparticle to a type-specific detection target, and wherein each nanoparticle comprises a plurality of fluorophores that generates a signal which is unique for each nanoparticle type; [0138] b. providing a sample comprising a plurality of target biomolecules; [0139] c. contacting the sample with the plurality of nanoparticle types, thereby allowing the nanoparticles to bind with the detection targets of the target biomolecules; and [0140] d. optically decoding the fluorophore signals emitted by the nanoparticle of the nanoparticle type bound to the detection target of the target biomolecules by measuring the wavelength and intensity of the emitted signals, thereby detecting the presence and identity of the target biomolecules.
[0141] In another aspect of the invention there is provided a method for multiplexed detection of one or more target biomolecules in situ, wherein each target biomolecule has at least one detection target, using optical encoding, may comprise the steps of: a. providing one or more nanoparticles in a suspension, each nanoparticle having a coating that provides binding affinity of the nanoparticle to a specific detection target, and wherein each nanoparticle comprises one or more fluorophores that generates a signal which is unique for each nanoparticle; b. providing one or more cells to be penetrated by the nanoparticles, wherein the cells comprises one or more target biomolecules; c. optionally preparing the target biomolecules for binding with the nanoparticles, such as binding the target biomolecules with a molecule comprising the detection target, and/or amplifying the detection target in situ; d. contacting the cells with the suspension comprising the nanoparticles, thereby allowing the nanoparticles to penetrate the cells in order to bind with the detection target of the target biomolecule; e. optically decoding the fluorophore signals emitted by the fluorophore of the nanoparticle hybridized to the detection target of the target biomolecules by measuring the wavelength and intensity of the emitted signals, thereby detecting the presence of the target biomolecules.
[0142]
[0143] Coating
[0144]
[0145] The binding affinity of the coating may be provided by a detection probe X attached via a linker to the nanoparticle, wherein detection probe X is chosen from a nucleic acid molecule, an antigen or an antibody.
[0146] The coating may furthermore comprise a repulsive component provided by a functional group Y attached via a linker to the nanoparticle, wherein functional group Y is chosen from a charged group with a positive or negative charge, a zwitterionic group the method comprises both a positive or negative charge, or a sterically repulsive functional group such as polymer chain or an aliphatic chain.
[0147] Also, the linker may comprise an anchor group A which tethers the coating to the nanoparticle and optionally a spacer group S.
[0148] See table 1 for examples of anchor groups and functional groups Y, depending on the surfaces of the nanoparticle. See table 2 for examples of spacer groups. Any of these groups may be used in the context of any aspect of the invention described herein.
TABLE-US-00001 TABLE 1 Anchor & Functional Compatible Surface groups Anchor & Functional groups Metal (Au) Thiol, Disulfide Carboxylic acid Amine Ammonium cation Phosphonic acid Silane Organosilane Sulfonate Phosphine Hydroxyl Catechol Gallol Silica Ethoxysilane Methoxysilane Silazane Chlorosilane Functional group Amine Isothiocyanate mediated Isocyanate Sulfonyl Chloride Aldehyde Carbodiimide Acyl azide Anhydride Fluorobenzen Carbonate NHS ester Imidoester Epoxide Flurophenyl ester Phosphine Carboxylic acid Thiol Maleimide Haloacetyl (Br—/I—) Pyridyl disulfide Thiosulfonate Vinylsulfone Aldehylde Alkoxyamine Hydrazide Click Azide Alkyne Cyclooctines (Dibenzocyclooctyne (DBCO), trans- cyclooctene (TCO)) Cyclononyne (bicyclo[6.1.0]nonyne (BCN)) Tetrazine Ligand Avidin Streptavidin NeutrAvidin Biotin
TABLE-US-00002 TABLE 2 Spacer type Poly- or Oligo- Bioinert polymers Poly(ethylene oxide/poly(ethylene glycol), polypeptide, polyglycerol, polyoxazolines Nucleotide oligomers/ Non-specific or repeat oligonucleotide polymers sequences Hydrocarbons Hexane, decane, pentadecane, octadecane, polyacetylene, polystyrene, polyethylene, Functional hydrocarbons Polyacrylamide, poly(acrylic acid), poly(methyl methacrylate), Poly(methyl acrylate)
[0149] One or multiple linkers may facilitate one or multiple detection probes X and/or functional groups Y, or where multiple linkers can facilitate multiple detection probes and/or functional groups Y via an interconnecting backbone. For example a polymer chain with functional groups incorporated in the monomer such that multiple anchor and functional groups for linking to detection probe is incorporated in the chain, allowing the chain to orient and bind to the nanoparticle surface using its anchor groups and further be modified with detection probes using linkers that form bonds with the remaining functional groups.
[0150] Fluorophores
[0151] One or more fluorophores may be selected from the alternatives provided in table 3 and derivatives thereof.
TABLE-US-00003 TABLE 3 Fluorophore Type Fluorophore Name Metallorganic Semiconductor Semiconductor quantum Dots (III-V, II-VI, Si) Perovskite quantum dots Carbon quantum dots Quantum rods P-dots (e.g. organic chromophoric polymers, whose surfaces can be modified with different amphiphilic polymers) Silicon quantum dots Blue Atto 425 4-[3-(ethoxycarbonyl)-6,8,8-trimethyl-2-oxo-7,8-dihydro-2H- pyrano[3,2-g]quinolin-9(6H)-yl]butanoic acid Alexa fluor 405 tris(N,N-diethylethanaminium) 8-[2-(4-{[(2,5-dioxopyrrolidin-1- yl)oxy]carbonyl}piperidin-1-yl)-2-oxoethoxy]pyrene-1,3,6- trisulfonate Green Alexa fluor 488 6-amino-9-(2,4-dicarboxyphenyl)-4,5-disulfo-3H-xanthen-3-iminium Fluorescin 3′,6′-dihydroxyspiro[isobenzofuran-1(3H),9′-[9H]xanthen]-3-one DiO 3,3′-Dioctadecyloxacarbocyanine Perchlorate Atto 488 BODIPY FL 3-{2-[(3,5-Dimethyl-1H-pyrrol-2-yl-κN)methylene]-2H-pyrrol-5-yl- κN}propanoato)(difluoro)boron Yellow - Orange Cy3 (amine and derivates) 6-[6-[(2E)-3,3-dimethyl-2-[(E)-3-(1,3,3-trirnethylindol-1-ium-2- yl)prop-2-enylidene]indol-1- yl]hexanoylamino]hexylazanium; dichloride DiI 1,1′-Dioctadecyl-3,3,3′,3′-Tetramethylindocarbocyanine Alexa fluor 546 2,3,5-trichloro-4-{[({6-[(2,5-dioxopyrrolidin-1- yl)oxy]-6-oxohexyl}carbamoyl)methyl]sulfanyl}-6- (2,2,4,8,10,10-hexamethyl-12,14-disulfo- 2,3,4,8,9,10-hexahydro-1H-13-oxa-1,11- diazapentacen-6-yl)benzoic acid Atto 550 N/A BODIPY TMR-X [N-{6-[(2,5-dioxopyrrolidin-1-yl)oxy]-6-oxohexyl}-3-(2-{[5-(4- methoxyphenyl)-1H-pyrrol-2-yl-kappaN]methylene}-3,5-dimethyl-2H- pyrrol-4-yl-kappaN)propanamidato](difluoro)boron Red Cy5 6-[6-[(2E)-3,3-dimethyl-2-[(2E,4E)-5-(1,3,3-trimethylindol-1-ium- 2-yl)penta-2,4-dienylidene]indol-1-yl]hexanoylamino]hexylazanium Alexa fluor 647 2-[5-[3,3-dimethyl-5-sulfo-1-(3-sulfopropyl)indol-1-ium-2-yl]penta- 2,4-dienylidene]-3-methyl-3-[5-oxo-5-(6- phosphonooxyhexylamino)pentyl]-1-(3-sulfopropyl)indole-5-sulfonic acid Texas Red 5-chlorosulfonyl-2-(3-oxa-23-aza-9- azoniaheptacyclo[17.7.1.15,9.02,17.04,15.023,27.013,28]octacosa- 1(27),2(17),4,9(28),13,15,18-heptaen-16-yl)benzenesulfonate DiD 1,1′-Dioctadecyl-3,3,3′,3′-Tetramethylindodicarbocyanine Atto 647(N), Atto 655 N/A Near-IR Cy7 1-(5-carboxypentyl)-2-[7-(1-ethyl-5-sulfo-1,3-dihydro-2H-indol-2- ylidene)hepta-1,3,5-trien-1-yl]-3H-indolium-5-sulfonate Alexa fluor 680 N/A Alexa fluor 750 N/A Atto 680, Atto 700 N/A
[0152] Nanoparticle
[0153] The nanoparticle may fulfil the following characteristics: [0154] The size of the nanoparticle may be small enough for the nanoparticle to be able to penetrate the cell membrane, i.e. typically a diameter of less than 100 nm is required. [0155] The coating of the nanoparticle may allow specific targeting of the nanoparticle to the detection target in question. Also, it is important and/or advantageous that the coating is such that aggregation is avoided, by tailoring the repulsive forces (for example cationic, anionic, zwitterionic or steric repulsive forces) of the coating and/or modifying the formulation of the buffers used during binding to detection targets. [0156] The plexing capacity of the nanoparticle is important. Preferably more than 50 and up to or more than 100 different codes should be possible to detect. Thus, challenges of quenching, dye stability and level discernment must be solved. By carefully designing the nanoparticle architecture, optionally utilizing the size to further incorporate both organic dyes as well as inorganic dyes, and with the possibility to further modify the matrix and structure of the nanoparticle the stability of dyes can be increased as well as increasing the flexibility of combining various fluorophores that can work in synchronization to generate a high magnitude of optical encoding. [0157] However, for the avoidance of doubt, plexing will be achieved as long as there are at least two nanoparticle types used. For example, plexing may be achieved with at least 3, 4, 5, 6, 7, 8,9 or 10 nanoparticle types. [0158] Guidance for synthetization of nanoparticles for use according to the invention, with a suitable size, coating and fluorophore content, can be found in literature of the art, such as e.g. Wang et al. (Nanoletters, 2005; 5:1 (37-43)). [0159] The examples also provide detailed guidance on how to synthesize nanoparticles for use in the invention.
[0160] Target Biomolecule Preparation
[0161] In the method of the invention, the target biomolecule may be prepared by binding it to a molecule the method comprises the detection target, such as a barcoded padlock probe or initiator sequence for HCR or other amplification methods.
[0162] The detection target may be a nucleic acid molecule or a protein, which is amplified using a method as listed in table 4.
TABLE-US-00004 TABLE 4 Method Details Rolling circle Padlock-probe mediated, clonal amplification amplification mediated method using the concept of rolling circle amplification. This is the most common in the emerging in-situ technologies. The padlock probe can be ligated directly on RNA transcripts, genomic DNA or on cDNA. The amplification can be performed using the target nucleic acid as primer or an external primer hybridizing to the backbone of the padlock probe. Multiple The concept of multiple hybridizations to hybridizations generate a stronger signal is the common (ISH) mediated: factor, one can design this in a multitude of HCR (Hairpin chain different ways where the detection target is reaction), and being built up using several hybridization probably more events. This is what's been used traditionally with FISH. After these hybridization events, the hybridization probes/complexes may be further amplified using rolling circle amplification Transposase-mediated Cleavage of genomic DNA and generation of amplification dumbbell structures for rolling circle amplification. Insertion of specific sequences for subsequent amplification such as a T7 RNA promoter. After the first round of rolling circle amplification or transcription, the amplification products can be detected/genotyped/sequenced in a second round of padlock probe mediated amplification. Antibody or Probes with specific affinity to proteins in aptamer-mediated the samples are pre-conjugated with a amplification specific oligonucleotide sequence serving as initiation site for an amplification event. Upon contact with the sample, these probes recognize specific targets in the sample and the remaining probes are washed away. The probes bound to specific targets are used as initiation sites for rolling circle amplification and subsequently detected using nanoparticles according to embodiments herein.
[0163] Optical Encoding & Decodine
[0164] The optical encoding may be effected by incorporating a plurality of fluorophores (e.g. of different wavelengths) in precisely controlled ratios (intensities) such that each combination of wavelengths/intensity ratios becomes uniquely separable when decoding thereby optically encoding each nanoparticle type. The different ratios of intensities can be achieved by (i) controlling the concentration of fluorophores in the nanoparticle and/or (ii) altering the size or optical properties of the fluorophores to control its emission intensity and thereby achieving ratiometric read-out. It is understood that the fluorophores incorporated in the nanoparticle may be encapsulated by its matrix and also placed at the surface of the nanoparticle.
[0165] Furthermore, each nanoparticle type is given a unique binding affinity through its coating such that it can recognize a unique detection target.
[0166] The decoding may be effected by optical decoding such as by optical imaging of the fluorescent signals. The signal from each nanoparticle type may be identified by measuring the wavelengths and intensities in order to ratiometrically identify the optical code incorporated in the nanoparticle types as shown in
[0167] The target biomolecule may be further co-labelled with small molecule probes (comprising their own fluorophores) together with the nanoparticles. This increases the robustness of the assay by introducing a control signal showing where specific binding occurs between nanoparticles and detection target of the biomolecule(s), and furthermore may introduce another dimension in the optical encoding increasing the degree of multiplexity by combining the signal emitted from the nanoparticle with the signal emitted from the biomolecule. Therefore, the identity of the biomolecule can be determined by using optically encoded nanoparticles together with additionally encoding the biomolecule with non-nanoparticle probes, for example by extending the number of wavelengths (fluorophore signals) emitted by the nanoparticle-biomolecule complex by co-labeling with a probe containing a molecular fluorophore.
Specific Embodiments of the Invention
[0168] Specific embodiments of the invention are provided in the paragraphs below.
[0169] In an embodiment of the invention there is provided a method for multiplexed detection of one or more target biomolecule(s) in situ using optical encoding, wherein each target biomolecule has at least one detection target, comprising the steps of: [0170] a. providing one or more nanoparticle type(s) in a suspension, each nanoparticle having a coating that provides binding affinity of the nanoparticle to a type-specific detection target, and wherein each nanoparticle comprises one or more fluorophore(s) that generates a signal which is unique for each nanoparticle type; [0171] b. providing one or more cells to be penetrated by the nanoparticle(s), wherein the cell(s) comprise(s) one or more target biomolecule(s); [0172] c. optionally preparing the target biomolecule(s) for binding with the nanoparticle(s), such as binding the target biomolecule(s) with at least one molecule comprising the at least one detection target, and/or amplifying the detection target(s) in situ; [0173] d. contacting the cells with the suspension comprising the nanoparticle(s), thereby allowing the nanoparticle(s) to penetrate the cells in order to bind with the detection target(s) of the target biomolecule; [0174] e. optically decoding the fluorophore signal(s) emitted by the nanoparticle of the nanoparticle type bound to the detection target of the target biomolecule(s) by measuring the wavelength and intensity of the emitted signal(s), thereby detecting the presence and identity of the target biomolecule(s).
[0175] Preferably each nanoparticle type is optically encoded by (i) incorporating precisely controlled ratios of at least one fluorophore, thereby controlling the emission wavelength and intensity from the nanoparticle type, or (ii) altering the properties of the fluorophore(s) affecting its emission intensity.
[0176] Advantageously the binding affinity of the coating of the nanoparticle type is provided by a detection probe X attached via a linker to the nanoparticle, wherein the detection probe X is chosen from a nucleic acid molecule, an antigen or an antibody.
[0177] Conveniently the coating of the nanoparticle furthermore comprises a repulsive component provided by a functional group Y attached via a linker to the nanoparticle, wherein the functional group Y is chosen from a charged group with a positive or negative charge, a zwitterionic group comprising both a positive or negative charge, or a sterically repulsive functional group such as polymer chain or an aliphatic chain.
[0178] Preferably the linker comprises at least one anchor group, which tethers the coating to the nanoparticle and optionally a spacer group.
[0179] Advantageously one or more linkers can provide one or more detection probes X and/or functional groups Y, or where multiple linkers can provide multiple detection probes X and/or functional groups Y via an interconnecting backbone.
[0180] Conveniently the one or more fluorophores are chosen from: [0181] (i) organic fluorophores, chosen from Atto 425, Cy3, Cy5, and Cy7; [0182] (ii) different colors of inorganic fluorophores, wherein the inorganic fluorophores comprises quantum dots, rods, perovskite quantum dots or metal-ligand complexes; and/or [0183] (iii) a combination of different colors of organic fluorophores and different colors of inorganic fluorophores, wherein the inorganic fluorophores comprises quantum dots, rods or perovskite quantum dots.
[0184] Preferably the nanoparticle has at least one of the following characteristics: [0185] i. it is a spherical particle comprising of silica and/or semiconductor, organic, inorganic, metal and/or polymer material; [0186] ii. it has a diameter of less than 300 nm, preferably less than 200 nm, and more preferably less than 100 nm, even more preferably less than 50 nm.
[0187] Advantageously in step c, the target biomolecule is prepared by binding to it at least one molecule comprising the detection target, such as a barcoded nucleic acid molecule, padlock probe or initiator sequence for subsequent amplification.
[0188] Conveniently the detection target comprises a nucleic acid molecule, which is, or facilitates a molecule that is, amplified using RCA or multiple hybridization events.
[0189] Preferably the decoding is effected by optical decoding such as by optical imaging.
[0190] Advantageously the method further comprises the step of providing one or more molecular probes, wherein each molecular probe comprises a fluorophore that is bound to a nucleic acid molecule, an antigen or an antibody providing binding affinity of the molecular probe to the specific detection target.
[0191] In another aspect of the invention there is provided a kit of parts, comprising, in separate containers, [0192] (i) nanoparticle(s) of one or more types in a suspension, each nanoparticle type having a coating that provides binding affinity of the nanoparticle to a specific detection target, and wherein each nanoparticle comprises one or more fluorophores that generates a signal which is unique for each nanoparticle type, optionally nanoparticle(s) of each type in a suspensions, each nanoparticle type having a coating without binding affinity of the nanoparticle to a specific detection target wherein the binding affinity is provided in a subsequent step by a detection probe X attached via a linker to the nanoparticle, wherein the detection probe X is chosen from a nucleic acid molecule, an antigen or an antibody; [0193] (ii) optionally, ingredients for providing the one or more nanoparticle type(s) with binding affinity to a specific detection target, comprising a reaction buffer facilitating the binding of detection probe X to the linker, a washing buffer, and a suspension buffer to suspend the nanoparticles in after the introduction of the binding affinity to the coating; [0194] (iii) a probing buffer, comprising a solution with controlled pH, salt concentration and additives facilitating specific detection target binding of the nanoparticle(s); and [0195] (iv) instructions for use of the kit in the method according to any of the paragraphs above in the section titled “Specific Embodiments of the Invention”.
[0196] The person skilled in the art realizes that the present disclosure is not limited to the preferred embodiments described above. The person skilled in the art further realizes that modifications and variations are possible within the scope of the appended claims.
[0197] Additionally, variations to the disclosed embodiments can be understood and effected by the skilled person in practicing the claimed disclosure, from a study of the drawings, the disclosure, and the appended claims.
[0198] Sequences
TABLE-US-00005 SEQ ID No: 1 TTTTTTTTTTCCTCAGTAATAGTGTCTTAC SEQ ID No: 2 TTACACCCTTTCTTTGACAA GTGTATGCAGCTCCTCAGTAATAGTGTCT TTGTGCGTCTATTTAGTGGAGCC CATG GACTGTTACTGAGCTGCGTT SEQ ID No: 3 TTGTCAAAGAAAGGGTGTAAAACGCAGCTCAGTAACAGTC SEQ ID No: 4 TGCGTCTATTTAGTGGAGCC SEQ ID No: 5 DBCO Oligo (SARS-COV-2) 5′-DBCO-TTTTTTTTTTTTCCTCAGTAATAGTGTCTTAC-3′ SEQ ID No: 6 DBCO oligo (HIV) 5′-DBCO-TTTTTTTTTTTGCGTCTATTTAGTGGAGCC-3′ SEQ ID No: 7 Synthetic target HIV 5′- CTCTCTCTCTCTATACTATATGTTTTAGTTTATATTGTTTCTTTCCCCCT GGCCTTAACCGAATTTTTTCCCATTTATCTAATTCTCCCCCGCT-3′ SEQ ID No: 8 Synthetic target SARS-COV-2 5′-Biotin- CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGGTGTGACAAGCTACAACA CGTTGTATGTTTGCGAGCAA-3′ SEQ ID No: 9 Padlock Probe HIV 5′-PO.sub.4-AAGGCCAGGGGGAAAG AGTAGCCGTGACTATCGACT TGCGT CTATTTAGTGGAGCCTTAAATGGGAAAAAATTCGGTT-3′ SEQ ID No: 10 Padlock probe SARS-COV-2 5′-PO.sub.4- TGTTGTAGCTTGTCACACCGGTGTATGCAGCTCCTCAGTAATAGTGTCTT ACGGCATCACTGGTTACGTCTGTTGCTCGCAAACATACAACG-3′ SEQ ID No: 11 AF750-Detection oligo (SARS-COV-2) 5′-TCCTCAGTAATAGTGTCTTACTTTT-AF750-3′ SEQ ID No: 12 Atto425-Detection oligo 5′-Atto425-CCTCAGTAATAGTGTCTTAC-3′
EXAMPLES
List of Abbreviations
[0199] NPs: Nanoparticles [0200] EtOH: Ethanol [0201] PBS: Phosphate buffered saline [0202] DEPC: Diethyl pyrocarbonate treated [0203] RCA: Rolling circle amplification [0204] RCP: Rolling circle product, the result of rolling circle amplification [0205] BSA: Bovine serum albumin [0206] dNTP: Deoxyribonucleotide triphosphate [0207] ATP: Adenosine triphosphate [0208] PEG: Polyethylene glycol [0209] SSC: Saline-sodium citrate [0210] EDTA: Ethylenediaminetetraacetic acid
Example 1—Suspension Conditions
[0211] In order to perform the claimed method, the conditions of the suspension, in which the method takes place, may have the following components and characteristics:
[0212] The suspension conditions can be controlled such that specific binding of nanoparticles to detection targets is facilitated over unspecific binding to other targets or non-targets (such as other biological matter/matrix or surface) while maintaining the stability of nanoparticle dispersion.
[0213] The following components play important role in optimizing NP binding to target biomolecules.
TABLE-US-00006 TABLE 5 Overview of components in probing/hybridization buffer. Type (effect) Examples Denaturants (lower Formamide/Urea/ethylene 0-60% (v/v) hybridization T) glycol/ethylene carbonate/sodium percholarate etc. Salts & Buffer (lower NaCl, KCl, MgCl.sub.2 0-3000 mM electrostatic repulsion) Citrate buffer 0-300 mM Phosphate buffer 0-300 mM (Buffers usually used as SSC, PBS) etc. pH (charge of nucleic acids) Adjusted with HCl/NaOH 6-9 Nuclease inhibitor EDTA, Riboprotect nuclease 0-10 mM inhibitor 0.1-5 U/μL Detergent (prevent SDS, Tween, Triton X-100, 0-5% (v/v or m/v) nonspecific binding) N-lauroylsarcosine etc. Blocking agents (prevent BSA, Casein, salmon sperm 0-10% (v/v or m/v) nonspecific binding) DNA, denatured ssDNA etc. Hybridization accelerators, dextran sulfate, PEG, ficoll 0-50% (e.g. 0-20%) crowding agents etc. (v/v or m/v)
[0214] In one embodiment, the following conditions were used:
TABLE-US-00007 SSC 2X Formamide 20% PEG 4000 5% pH 7-7.4
[0215] In another embodiment, the following conditions were used:
TABLE-US-00008 SSC 1X Formamide 10% PEG 4000 5% pH 7-7.4
Example 2—Using the Method for Multiplexed Detection
[0216]
TABLE-US-00009 TABLE 6 Overview of sequences used in examples ID Ref Sequence 1 S04018 TTTTTTTTTTCCTCAGTAATAGTGTCTTAC 2 S03625 TTACACCCTTTCTTTGACAA GTGTATGCAGCTCCTCAGT AATAGTGTCTTTGTGCGTCTATTTAGTGGAGCC CATG GACTGTTACTGAGCTGCGTT 3 S03844 TTGTCAAAGAAAGGGTGTAAAACGCAGCTCAGTAACAGTC 4 S03798 TGCGTCTATTTAGTGGAGCC
[0217] In one embodiment, NP surface coating was performed by adding 100 μL of NPs (125 mM Si, 0.62 uM Cy3 loading) to a solution of H2O (485 μL) followed by 11-azidoundecyltriethoxysilane (2.5 μL, 256 mM), mPEG5k-triethoxysilane (10 μL, 20 mM) and finally ammonium hydroxide (2 μL, 28-30%). The temperature was raised to 75° C. and the reaction mixture was shaken. After 3 hours the reaction mixture was washed by centrifugation 3 times with H.sub.2O and 1 time with PBS. The coated NPs were stored in 100 μL H.sub.2O.
[0218] To EtOH (50 μL), above coated NPs were added (30 μL) followed by PBS (20 μL) and DBCO modified nucleotide sequence S04018 (3 μL, 100 uM). The temperature was raised to 37° C. during shaking. After 19 hours the reaction mixture was washed by centrifugation 3 times with H2O. The sequence functionalized NPs were stored in 100 μL H.sub.2O.
[0219] In one embodiment, RCPs were prepared in solution by adding 5′-phosphorylated padlock probes S03625 (1 μL, 1 uM) to a solution of H2O (71.9 μL), phi29 reaction buffer (10 μL, 10×), T4 ligase (0.4 μL, 5 U/μL), BSA (10 μL, 2 μg/μL), ATP (2.7 μL, 25 mM) followed by target sequence S03844 (4 μL, 30 nM). The temperature was raised to 37° C. for 30 minutes. From this, 20 μL (first diluted 1:1000) was added to H.sub.2O (9.2 μL) followed by BSA (4 μL, 2 μg/μL), dNTPs (2 μL, 2.5 mM), phi 29 reaction buffer (4 μL, 10×) and phi 29 polymerase (0.8 μL, 10 U/μL). Temperature was raised to 30° C. for 2 hours followed by 65° C. for 5 minutes.
[0220] In one embodiment, NPs binding to RCPs were performed by first immobilizing 5 μL of RCPs to Superfrost Plus slides (Thermo Scientific) by deposition. The proceeding reactions were performed in Secure-seals (Grace Bio-Labs, 9 mm in diameter and 0.8 mm deep) attached to the slides. Hybridization mixture was prepared by adding NPs (5 μL) to a solution of SSC (5 μL, 20×), formamide (10 μL), H2O (24.5 μL), PEG 4000 (5 μL, 50%) followed by complementary detection oligo 503798-Cy5 (control probe). To the immobilized RCPs was added the hybridization mixture and temperature was raised to 37° C. After one hour the glass slide was washed 4 times with PBS-T (DEPC-PBS with 0.05% Tween-20), once with 70% EtOH, once with 85% EtOH and finally 99.5% EtOH.
[0221] In one embodiment, RCP generation in situ was performed instead of in solution. Cells were seeded on Superfrost Plus slides (Thermo Scientific). When the cells reached the desired confluency they were fixed in paraformaldehyde (3% (w/v)) in PBS at room temperature. After 30 min, slides were washed twice with DEPC-PBS once with 70% EtOH, once with 85% EtOH and finally 99.5% EtOH for 3 min each. The reactions were performed in Secure-seals (Grace Bio-Labs, 9 mm in diameter and 0.8 mm deep) attached to the slides. To make the RNA more readily available for cDNA synthesis, 0.1 M HCl was applied to the cells for 10 min at room temperature. This was followed by two washes in DEPC-PBS.
[0222] Reverse transcription was performed by adding a mixture of DEPC-H.sub.2O (34.75 μL), TranscriptMe buffer (5 μL, 10×), dNTPs (1 ML, 25 mM), BSA (0.5 ML, 20 μg/μL), random decamers (2.5 μL, 100 uM), RiboLock RNase Inhibitor (Fermentas) (1.25 μL, 40 U/μL) and reverse transcriptase (5 μL, 200 U/μL) to the cells and temperature was raised to 37° C. After 18 hours, the reaction mixture was removed and formaldehyde (3% (w/v)) was added. After 30 minutes the cells were washed with PBS-T twice.
[0223] Ligation was performed by adding a mixture of DEPC-H.sub.2O (22 μL), Ampligase buffer (20 mM Tris-HCl, pH 8.3, 25 mM KCl, 10 mM MgCl.sub.2, 0.5 mM NAD and 0.01% Triton X-100) (5 μL, 10×), KCl (2.5 μL, 1 M), formamide (10 μL), padlock probes (1 μL, 0.5 uM), BSA (0.5 μL, 20 μg/μL), Ampligase (5 μL, 5 U/μL) and RNase H (4 μL, 5 U/μL) to the cells and temperature raised to 37° C. for 30 minutes and then 45° C. After 1 hour, cells were washed with PBS-T twice.
[0224] RCA was performed by adding a mixture of DEPC-H.sub.2O (33 μL), Phi-29 buffer (5 μL, 10×), glycerol (5 μL, 50%), dNTPs (0.5 μL, 25 mM), BSA (0.5 μL, 20 μg/μL), Exonuclease I (1 μL, 20 U/μL), Phi-29 polymerase (5 μL, 10 U/μL) to the cells and raising the temperature to 37° C. After 4 hours, cells were washed with PBS-T twice. Subsequent NP and control probe binding was performed as above analogous to RCPs deposited on slides.
[0225] In one embodiment, image acquisition was performed using an Axioplan II epifluorescence microscope (Zeiss) equipped with a 100 W mercury lamp, a CCD camera (C4742-95, Hamamatsu), and a computer-controlled filter wheel with excitation and emission filters for visualization of 425, DAPI, FITC, Cy3, Cy3.5, Cy5 and Cy7. A ×20 (Plan-Apocromat, Zeiss), ×40 (Plan-Neofluar, Zeiss) or ×63 (Plan-Neofluar, Zeiss) objective was used for capturing the images.
Example 3—Nanoparticle Synthesis
[0226] Materials
[0227] Cyanine 3 NHS ester (Cy3-NHS), Cyanine 5 NHS ester (Cy5-NHS) were purchased from Lumiprobe GmbH, Germany. Dimethyl Sulfoxide (DMSO) (≥99.9%), Tetrahydrofuran (THF (99%) (3-aminopropyl)triethoxysilane (APTES), ammonium hydroxide (NH4OH) (28% NH3 in H2O, ≥99.99%), tetraethyl orthosilicate (TEOS) (99.999%), 11-azidoundecyltriethoxysilane (97%), ADIBO-PEG4-acid (90%) were purchased from Sigma Aldrich, Sweden. Ethanol absolute (≥99.8%) was purchased from VWR, Sweden. Ultra-pure MilliQ water used from MilliQ (IQ 7010) system.
[0228] Fluorophore Stock
[0229] Stock solutions of fluorophores were prepared by adding 1 ml of DMSO to 1 mg of respective fluorophore.
[0230] Optically Encoded Nanoparticles Library
[0231] Encoded NPs were synthesized by adding either of [0, 0.8, 1.6, 3.2, 6.4] μl Cy3-NHS, Cy5-NHS, Cy7-NHS respectively to 4 μL of APTES solution and raising the temperature to 37° C. during stirring or shaking. The APTES solution was prepared by first adding 10 μl of APTES to 990 μl of EtOH. For example, to produce a nanoparticle type batch of encoding [8, 16, 0], 0.8 μL of Cy3-NHS, 1.6 μL of Cy5-NHS and 0 μL of Cy7-NHS was added. This way any combination can be made using for example 3 colors and 5 levels according to above example. After 10 minutes, 38 μl of H.sub.2O was added followed by EtOH and the temperature was raised to 55° C. The amount of EtOH was set to reach a final reaction volume of 1 mL after the following additions; 54 μl of NH.sub.4OH was added followed by 38 μl of TEOS during vigorous stirring. After 2 hours, the NPs were washed by centrifugation 3 times using EtOH. The NPs were then redispersed in 1 mL EtOH and stored at 4° C. until further use.
[0232] The resulting nanoparticles had an average diameter size of 66 nm as measured by SEM and 75 nm as measured by DLS.
[0233] In one embodiment, a 7-plex encoded NP system was synthesized using above method with the following encodings: (32:0, 32:8, 32:16, 32:32, 16:32, 8:32, 0:32).
[0234] In another embodiment, a 15-plex encoded NP system was synthesized using above method with the following encodings: (8:0:16, 16:0:16, 32:0:16, 0:8:16. 8:8:16, 16:8:16, 32:8:16, 0:16:16, 8:16:16, 16:16:16, 32:16:16, 0:32:16, 8:32:16, 16:32:16, 32:32:16).
[0235] The absolute emissions of the 7-plex system can be seen in
[0236] Nanoparticle Coating
[0237]
[0238] NP surface functionalization was performed by adding 100 μL of NPs (175 mM Si) to ethanol (248.5 μL), followed by H2O (226.5 μL). To this was added ammonium hydroxide solution (20 μL, 2.8%, 1:10 dilution in EtOH). Finally, 11-azidoundecyltriethoxysilane (10 μL, 1:4 dilution in THF) was added and the temperature raised to 37° C. during stirring. After 18 hours, the NPs were washed by centrifugation 3 times using THF. The N3-NPs were then redispersed in 100 μL THF and stored at 4° C. until further use.
[0239] Above functionalized N3-NPs (50 μL) were added to H.sub.2O (112.6 μL) followed by DBCO modified oligo (4 μL, 100 μM, SEQ ID No:5). The temperature was raised to 37° C. After 1 hour, ADIBO-PEG4-acid (1.1 μL, 420 mM) was added. After 2 hours, the NPs were washed by centrifugation 3 times using EtOH. The NPs were then redispersed in 50 μL EtOH and stored at 4° C. until further use.
[0240] In another embodiment, above functionalized N3-NPs (50 μL) were added to H2O (112.6 μL) followed by DBCO modified oligo (4 μL, 100 μM, SEQ ID No:5) and ADIBO-PEG4-acid (0.3 μL, 115 mM). After 5 hours, the NPs were washed by centrifugation 3 times using EtOH. The NPs were then redispersed in 50 μL EtOH and stored at 4° C. until further use.
[0241]
[0242] In another embodiment, NP surface functionalization was performed by adding 100 μL of NPs (175 mM Si) to H2O (448 μL). To this was added ammonium hydroxide solution (2 μL, 28%) followed by mPEG5k-triethoxysilane (45 μL, 20 mM in H2O) and N3-PEG5k-triethoxysilane (5 ML, 10 mM in H2O). The temperature was raised to 75° C. during stirring or shaking. After 18 hours, the NPs were washed by centrifugation 3 times using H2O. The PEG-NPs were then redispersed in 100 μL H2O and stored at 4° C. until further use.
[0243] In another embodiment, NP surface functionalization was performed by adding 100 μL of NPs (175 mM Si) to H2O (448 ML). To this was added ammonium hydroxide solution (2 μL, 28%) followed by mPEG2k-triethoxysilane (45 ML, 20 mM in H2O) and N3-PEG5k-triethoxysilane (5 μL, 10 mM in H2O). The temperature was raised to 75° C. during stirring or shaking. After 18 hours, the NPs were washed by centrifugation 3 times using H2O. The PEG-NPs were then redispersed in 100 μL H2O and stored at 4° C. until further use.
[0244] Above functionalized PEG-NPs (30 ML) were added to H2O (5 ML) followed by DBCO modified oligo (5 μL, 100 μM, SEQ ID No:5). The temperature was raised to 37° C. After 18 hours, the NPs were washed by centrifugation 3 times using H2O. The NPs were then redispersed in 300 μL H2O and stored at 4° C. until further use.
[0245] What is particularly surprising is that when a PEG chain of 4000 Da or greater was used stability to the nanoparticle dispersion was provided, but the oligo was unable to bind to the target site. However, when using the shorted PEG4 chain, stability was still provided and the oligo was able to bind to the target site.
[0246]
[0247] Nanoparticle to RCP Hybridization
[0248] RCP stock (30 μL) was diluted [1:5] in SSC 1× buffer (Invitrogen) by the addition of 120 μL SSC 1× buffer to a PCR tube (200 μL) containing the RCP solution. A circle was marked on Superfrost-plus slide (25×75×2 mm, VWR) using a diamond tip pen. Next, 4.5 μL of the diluted RCP solution was added as a drop on the marked circle, followed by drying in a 37° C. oven for 5 minutes. The marked circle with the dried RCPs was washed by pipetting 200 μL PBS-tween20 (0.01M, 0.05% tween20, Invitrogen), the washing step was repeated 2 times and the area surrounding the marked circle was cleaned using a microfiber tissue.
[0249] A hybridization chamber (Grace Bio-labs, Secure-seal hybridization chamber 8-9 mm Diameter×0.8 mm depth) was attached over the marked circle on the superfrost-plus slide. Next, the labelling solution was prepared. 130.6 μL H.sub.2O was added to an Eppendorf tube (1.5 mL), 45 μL SSC buffer (4×, Invitrogen) followed by 10 seconds vortex of the solution at max setting. Next, 1.8 μL AF750-detection oligo (1 μM, SEQ ID No:11) was added followed by vortex for 10 seconds at max setting. The oligo functionalized nanoparticle stock prepared above was sonicated for 20 seconds. Oligo functionalized nanoparticle stock was added (2.5 μL) to the Eppendorf tube followed by 5 seconds vortex at max setting, 10 seconds sonication and 10 seconds vortex at max setting.
[0250] The prepared labelling solution was added to the hybridization chamber filling the chamber until full (45-50 μL). Adhesive plastic covers (3M VHB) were attached to the holes of the hybridization chamber. Next, the prepared slide was incubated for 1 hour in a oven at 37° C. After incubation, the plastic covers were removed using tweezers and the labelling solution was removed, emptying the hybridization chamber. The sample was then washed using the following procedure. 50 μL PBS-tween20 buffer was added to the hybridization chamber, the chamber was washed by removing and adding the liquid 10 times to the chamber using the pipette. The PBS-tween20 buffer was then discarded. The washing step was repeated 3×times.
[0251] Next, the hybridization chamber was detached form the superfrost-plus slide using tweezers. The slide was covered with a cardboard box and allowed to dry for 5 minutes in room temperature. Next, 7 μL slowfade (Gold antifade mountant, Invitrogen) was added to the marked circle and covered with coverglass (Menzel-Glaser 24×50 mm #1.5).
[0252] Image Acquisition
[0253] All fluorescent microscopy imaging was performed using a standard epifluorescent microscope (Zeiss Axio Imager.Z2) with an external LED light source (Lumencor SPECTRA X light engine). The microscope setup used a light engine with filter paddles (395/25, 438/29, 470/24, 555/28, 635/22, 730,50). Images were obtained with a sCMOS camera (2048×2048, 16 bit, ORCA-Flash4.0LT Plus, Hamamatsu) using objectives 20× (0.8 NA, air, 420650-9901) and 5× (0.16NA, air, 420630-9900). The setup used filter cubes for wavelength separation including quad band Chroma 89402 (DAPI, Cy3, Cy5) and quad band Chroma 89403 (Atto425, TexasRed, AlexaFluor750). All samples were mounted on an automatic multi-slide stage (PILine, M-686K011). The nanoparticles were imaged in the Cy3 and Cy5 channel using 100 ms exposure. The detection oligo was imaged in the AF750 channel using 200 ms exposure. The images were obtained using Z-stack with 5 μm height and 0.25 μm slice thickness resulting in 21 slices. All images were taken in ambient, dark microscopic room conditions.
[0254] Image Processing and Signal Decoding
[0255] A typical image and signal decoding procedure is shown in
[0256]
[0257] In one embodiment, to decode the nanoparticle type identity, the fluorescence intensity/profile was measured in respective channel for a spatially resolved signal spot containing a cluster of nanoparticles bound to the biomolecule (RCP). The method of analyzing a single spot and optically decoding the nanoparticle type identity is performed by drawing a line profile over one spot shown magnified in
[0258] In another embodiment, to decode the nanoparticle type identity, instead of drawing a line profile over one spot a circle was drawn around the spot. The max intensity was measured for each channel inside the circle and the background signal was subtracted by averaging the background signal with an equivalent spot placed on an area where there were no signal spots were found. In another embodiment, the background signal was averaged by using the min value inside the circle. In another embodiment, the background signal was averaged by drawing a second circle around the first circle, removing the pixel information from the first circle, and measuring the average intensity in the remaining pixel information from the larger circle.
[0259] Emission maps from the above mentioned 7-plex system can be plotted as shown in
[0260] This is further supported by the titration plots shown in
[0261] 14-Plex Detection System with 7-Plex Nanoparticle Library Co-Labelled with 2-Plex Molecular Probes
[0262] In another embodiment, a labelling solution was prepared with two detection oligos. 130.6 μL H2O was added to an Eppendorf tube (1.5 mL), 45 μL SSC buffer (4×, Invitrogen) followed by 10 seconds vortex of the solution at max setting. Next, 1.8 μL AF750-detection oligo (1 μM, SEQ ID No:11) and Atto425-detection oligo (1 μM, SEQ ID No: 12) was added followed by vortex for 10 seconds at max setting. The oligo functionalized nanoparticle stocks prepared above was sonicated for 20 seconds. Oligo functionalized nanoparticle stocks was added (7×2.5 μL) to the Eppendorf tube followed by 5 seconds vortex at max setting, 10 seconds sonication and 10 seconds vortex at max setting. The process of nanoparticle to RCP hybridization, image acquisition, processing and signal decoding was then applied according to above. The results are visualized in
[0263] In another embodiment, a 30-plex system is achieved by combining a NP library of 15-plex as mentioned above co-labelled with detection oligo (molecular probe) library of 2-plex.
[0264] The described procedure for oligo functionalization and subsequent hybridization to RCPs used the following sequences listed in the table below.
TABLE-US-00010 ID No. Nucleic acid type 5 DBCO oligo (SARS-COV-2) 5′-DBCO-TTTTTTTTTTTTCCTCAGTAATAGTGTCTTAC- 3′ 6 DBCO oligo (HIV) 5′-DBCO-TTTTTTTTTTTGCGTCTATTTAGTGGAGCC-3′ 7 Synthetic target HIV CTCTCTCTCTCTATACTATATGTTTTAGTTTATATT GTTTCTTTCCCCCTGGCCTTACCGAATTTT TTCCCATTTATCTAATTCTCCCCCGCT 8 Synthetic target SARS-COV-2 5′-Biotin- CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCGGT GTGACAAGCTACAACACGTTGTATGTTTGCGAGCAA 9 Padlock Probe HIV AAGGCCAGGGGGAAAG AGTAGCCGTGACTATCGACT TGCGTCTATTTAGTGGAGCC TTAAATGGGAAAAAATTCGGTT 10 Padlock probe SARS-COV-2 TGTTGTAGCTTGTCACACCGGTGTATGCA GCTCCTCAGTAATAGTGTCTTACGGCATCACTGGTTAC GTCTGTTGCTCGCAAACATACAACG 11 AF750-Detection oligo (SARS- 5′-TCCTCAGTAATAGTGTCTTACTTTT-AF750 COV-2) 12 Atto425-Detection oligo 5′-Atto425-CCTCAGTAATAGTGTCTTAC-3′
[0265] Nucleic acid sequences of DBCO oligos, synthetic targets and padlock probes used for procedures described in this document are listed in the table above.