Endogenous Labelling of Extracellular Vesicles

Abstract

The present invention relates to neutralizing antibodies and fragments thereof directed against Platelet Factor-4 variant 1 (PF4v1) and their use for treating pathologies that require induction of angiogenesis or diseases associated with patho-logical angiogenesis.

Claims

1. (canceled)

2. (canceled)

3. A process for labelling extracellular vesicles, the process comprising incubating cells in a culture medium in the presence of a fluorophore whereby the fluorophore is taken up by the cells; and extracellular vesicles are secreted from the cells together with the fluorophore to yield fluorophore labelled extracellular vesicles; and isolating the fluorophore labelled extracellular vesicles.

4. The process of claim 3, wherein isolating the fluorophore labelled extracellular vesicles comprises removal of the culture medium and optionally rinsing.

5. The process of claim 3, wherein isolating the fluorophore labelled extracellular vesicles comprises centrifugation, use of a density gradient, filtration, microfluidics techniques, precipitation kits, isolation by nanowired-on-microcapillary trapping, acoustic sorting, immunoaffinity based isolation, column chromatography and/or flow cytometry based sorting.

6. The process of claim 5, wherein isolating the fluorophore labelled extracellular vesicles comprises differential centrifugation steps and/or flow cytometry based sorting.

7. The process of claim 3, wherein the cells are (i) animal cells or (ii) bacterial cells.

8. The process of claim 3, further comprising an initial step of growing cells in a cell culture medium in the absence of a fluorophore, thereby providing the cells.

9. The process of claim 3, comprising a subsequent step of tracking the isolated fluorophore labelled extracellular vesicles in vitro.

10. The isolated extracellular vesicle that is endogenously labelled with a fluorophore, produced by the process of claim 3.

11. An isolated extracellular vesicle that is endogenously labelled with a fluorophore.

12. A method of medical treatment employing an extracellular vesicle that is endogenously labelled with a fluorophore, the method comprising administering the extracellular vescicle to a subject in need thereof

13. The method of claim 12, wherein the medical treatment is treatment of cancer.

14. The method of claim 12, wherein the extracellular vesicle is an isolated extracellular vesicle.

15. The process of claim 3, wherein the extracellular vesicles comprise (i) exosomes or (ii) microvesicles or (iii) apoptotic bodies.

16. The process of claim 3, wherein the fluorophore comprises thiazole orange, pyrene, xanthene, anthracene, cyanine, anthraquinone, or acridine, or derivatives thereof.

17. The process or of any one of the preceding claims, wherein the fluorophore comprises a compound having the general structure: ##STR00001## wherein Y is N or CH; R.sup.1 and R.sup.2, which may be the same or different, are each independently H; or are a substituted or unsubstituted, saturated or unsaturated, cyclic moiety; a substituted or unsubstituted, saturated or unsaturated heterocyclic moiety; or a substituted or unsubstituted, saturated or unsaturated, straight or branched chain alkyl moiety; R.sup.3 and R.sup.4, which may be the same or different, are each a substituted or unsubstituted, saturated or unsaturated, cyclic moiety; a substituted or unsubstituted, saturated or unsaturated heterocyclic moiety; or a substituted or unsubstituted, saturated or unsaturated, straight or branched chain alkyl moiety; and each of X.sup.1 and X.sup.2, is a halide selected from fluoride, chloride, bromide and iodide, or is O—Z, wherein Z is a substituted or unsubstituted alkyl or aryl group.

18. The process or cxtraccllular vesicle of claim 17, wherein the fluorophore comprises a compound having a structure selected from the group consisting of: ##STR00002## ##STR00003##

19. The process of claim 17, wherein the fluorophore comprises a compound having a structure selected from the group consisting of: ##STR00004##

20. The process of any, wherein the fluorophore is a hydrophobic fluorophore that is incorporated into an environment-responsive particle.

21. The process of claim 20, wherein the environment-responsive particle comprises a core and a shell around the core, the core comprising the hydrophobic fluorophore and the shell comprising a plurality of di-block copolymers and/or tri-block copolymers, each di-block copolymer having a hydrophobic block and a hydrophilic block and each tri-block copolymer having a hydrophobic block and two hydrophilic blocks in a hydrophilic-hydrophobic-hydrophilic block sequence, wherein the shell is formed around the core due to hydrophobic interactions between the hydrophobic fluorophore and the hydrophobic blocks of the plurality of di-block copolymers and/or tri-block copolymers.

22. The isolated extracellular vesicle of claim 11, wherein the fluorophore comprises a compound having the general structure: ##STR00005## wherein Y is N or CH; R.sup.1 and R.sup.2, which may be the same or different, are each independently H; or are a substituted or unsubstituted, saturated or unsaturated, cyclic moiety; a substituted or unsubstituted, saturated or unsaturated heterocyclic moiety; or a substituted or unsubstituted, saturated or unsaturated, straight or branched chain alkyl moiety; R.sup.3 and R.sup.4, which may be the same or different, are each a substituted or unsubstituted, saturated or unsaturated, cyclic moiety; a substituted or unsubstituted, saturated or unsaturated heterocyclic moiety; or a substituted or unsubstituted, saturated or unsaturated, straight or branched chain alkyl moiety; and each of X.sup.1 and X.sup.2, is a halide selected from fluoride, chloride, bromide and iodide, or is O—Z, wherein Z is a substituted or unsubstituted alkyl or aryl group.

Description

FIGURES

[0139] FIG. 1 shows differences between the two chemokines PF4 and PF4v1. PF4 and PF4 v1 differ by only 3 amino acids. However PF4v1 (V1) inhibits much more potently proliferation of endothelial cells than PF4. FIG. 1A shows the comparison of the amino acid sequence of PF4v1 and PF4. FIG. 1B is a graph showing the comparison of the effect of PF4v1 and PF4 on cell proliferation. FIG. 1C presents the different PF4v1/PF4 mutants generated. Results are the means±s.e.m. of three independent experiments performed in triplicate.

[0140] FIG. 2 shows the obtention of MabV1, a monoclonal antibody against PF4v1. FIG. 2A shows the fusion PF4v1 peptide which was used for immunizing mice. FIG. 2B Mouse monoclonal antibody for PF4v1 (MabV1, clone 9E11-2D5-2G1) is tested by Dot Blot using PF4 and PF4v1 proteins. Monoclonal Anti-PF4 (Mab PF4) that recognizes both proteins is used as control. FIG. 2C presents a Biacore analysis, antibodies are immobilized, and then PF4 and PF4v1 (V1) are injected at different concentrations.

[0141] FIG. 3 shows the epitope characterization of MabV1. FIG. 1A presents a Dot-blot of PF4v1/PF4 mutant proteins using MabV1. Mab PF4 is a control antibody that recognizes PF4 and PF4v1.FIG. 3B represents specific ELISA with Mabv1 using PF4v1, PF4, or mutant proteins. MabV1 is immobilized on ELISA plates and polyclonal anti-PF4 antibody (detects all variants) is used for detection. Proteins are all tested at the same concentration (1 ng/ml). Results are the means±s.e.m. of two independent experiments performed in triplicate and expressed as 100% of V1 P<0.01 for V1-E and F4+H versus V1.

[0142] FIG. 4 shows the inhibitory activity of MabV1. MabV1 (1 μg/ml) is added in the proliferation assay using FGF-2 stimulated bovine aortic endothelial cells (BAE).

[0143] The inhibition of proliferation by PF4v1 is specifically blocked by Mabv1. Results are the means±s.e.m. of three independent experiments performed in triplicate.

[0144] FIG. 5: Induction of Tumor Growth by Treatment of Bxpc3 Xenografted Mice with the Blocking Antibody Mabv1

[0145] Mice (Rag Gamma, n=32, two independent experiments) were sc injected with 3×10.sup.6 BxPC3 cells and divided in two groups which received 50 μg IgG control antibody (group control, n=16) or 50 μg of blocking antibody MabV1 (group MabV1, n=16). Traitement started at 14 days and antibodies were iv injected twice a week.

[0146] Tumor dimensions were measured each week and tumor volumes were calculated using the formula: (4/3) ab.sup.2 (where a and b are the largest and the smallest radius respectively) (A). On day 46, tumors were resected, and the dimensions were measured to determine the tumor volume more exactly (B), which was calculated by the formula: (4 abc)/3 (a, b, or c, measured radii). Points/Columns, mean tumor sizes (mm3); bars, SEM. (*, p<0.05; **, p<0.01, Mann-Whitney test). Representative transplanted tumors treated with control antibody (top) and MabV1 (bottom) (C). Mice injected with the blocking antibody have larger, cystic tumors. In the control group, the cystic cavity is filled with clear serous fluid, whereas in the group injected with the blocking antibody, the liquid is haemorrhagic and the cavity is filled with serous walls (D). Blood vessels were visualized in frozen tissue sections by staining with anti-CD31 followed by a faint counterstain with Mayer's hematoxylin (E).

[0147] FIG. 6: Clearance profile of MabV1-IRDye™ 800CW from a tumor-negative mouse over a 15-days period. Sterile-filtered MabV1 conjugated to IRDye™ 800CW (25 μg per animal) was injected into the tail vein. Images were then collected at the indicated time points on the Odyssey Imaging System (Licor). Images were normalized to the same LUT with a common minimum and maximum value for visual presentation. (1-400 for whole body A 1-1000 for organes B).

[0148] FIG. 7 : Plasma concentration of MabV1 conjugated to IRDye or to biotine at different times post-injection.

[0149] Blood was collected directly from heart of mice injected with 25 μg of MabV1 labeled with IRDye (Red lines) or with Biotin (blue lines) at different times post-injection (A short period until 72 hours, B long period until 4 weeks). Blood was centrifugated and plasma concentration of MabV1 was assayed by a direct ELISA test.

[0150] FIG. 8: Determination of tissue concentration of MabV1 in different organes:

[0151] Organs were removed from mice injected with IRDye 800CW labeled MabV1 at different times and immediately after imaging were homogenized for determination of MabV1 concentration by a direct ELISA assay.

[0152] FIG. 9 : Targeting of Lung metastasis targeting of MabV1 conjugated to IRdye 800.

[0153] Labeled Mabv1 is injected in mice that were iv injected with BXPC3 tumors and lung metastasis (green) are visualized with Odyssey infrared imager (LiCor).

EXAMPLES

Example 1: Characterization of a Monoclonal Antibody Specific for PF4v1 (MabV1)

Material & Methods

[0154] Cell culture: BAE cells were grown in DMEM (Invitrogen, Cergy Pontoise, France) containing antibiotics, 1% glutamine, and 10% fetal calf serum or 10% calf serum and were maintained in a 37° C. and 10% CO.sub.2.

[0155] Plasmids: The coding regions of human PF4/CXCL4 and PF4v1/CXCL4L1 cDNA were cloned from pCDNA-PF4 and pCDNA-PF4v1 in two consecutive steps. First, rather long PF4 and PF4v1 cDNA fragments were amplified by primers binding PF4 and PF4v1 (Full-PF4s and Full-PF4v1as forward primers; Full-PF4as and Full-PF4v1as as backward primers, Table 2). The amplicons (306 and 315 bp) were cloned into the pSC-A vector (Stratagene). The reconstructed plasmids were verified by DNA sequencing. These constructs were used as a template to amplify the coding region of the mature PF4 and PF4v1 proteins (PF4s and PF4v1s as forward primers; PF4as and PF4v1as as backward primers, Table 2). The purified PCR product was digested with BamH1 and Xho1 restriction enzymes and inserted into the plasmid pGEX-6P-2 (Amersham Biosciences) to generate the pGEX-PF4 and pGEX-PF4v1 expression vectors. Finally, automated DNA Sequencing Analysis checked the nucleotide sequence of the selected clones.

TABLE-US-00002 TABLE 2 Primers used in PCR and QuikChange II XL. 5′.fwdarw.3′ Full-PF4s SEQ ID No: 2 AAAAAACTCAAGATCTGGTACCATGAGCTCCGCAGC Full-PF4as SEQ ID No: 3 AAAAAACCGCGGCCGCGGATCCCCCTAACTCTCCAAAAGTT Full-PF4v1s SEQ ID No: 4 AAAAAACTCAAGATCTGGTACCATGAGCTCCGCAGC Full-PF4v1as SEQ ID No: 5 AAAAAACCGCGGCCGCGGATCCCCCTAACTCTCCAAATGTT PF4s SEQ ID No: 6 AAACAATTGGTCATATGGAAGCTGAAGAAGATGGGGA PF4as SEQ ID No: 7 AAAAAACCGCGGCCGCGGATCCCCCTAACTCTCCAAAAGTT PF4v1s SEQ ID No: 8 AAACAATTGGTCATATGGAAGCTGAAGAAGATGGGGA PF4v1as SEQ ID No: 9 AAAAAACCGCGGCCGCGGATCCCCCTAACTCTCCAAATGTT M1s SEQ ID No: 10 GCTTGGATCTGCAAGCCCCGCTGTACAAGAAAATCATTAA Mlas SEQ ID No: 11 TTAATGATTTTCTTGTACAGCGGGGCTTGCAGATCCAAGC M2s SEQ ID No: 12 GCTGTACAAGAAAATCATTAAGAAACATTTGGAGAGTTAG M2as SEQ ID No: 13 CTAACTCTCCAAATGTTTCTTAATGATTTTCTTGTACAGC M3s SEQ ID No: 14 GCTGTACAAGAAAATCATTAAGGAACTTTTGGAGAGTTAG M3as SEQ ID No: 15 CTAACTCTCCAAAAGTTCCTTAATGATTTTCTTGTACAGC M23s SEQ ID No: 16 GCTGTACAAGAAAATCATTAAGAAACTTTTGGAGAGTTAG M23as SEQ ID No: 17 CTAACTCTCCAAAAGTTTCTTAATGATTTTCTTGTACAGC

[0156] Construction of recombinants pGEX-PF4v1 variants expression vectors: The pGEX-PF4v1 expression vector was used as the DNA template for site-directed mutagenesis procedure using QuikChange II XL kit (Stratagen) (Table 2). Finally, screening of pGEX-PF4v1 mutants clones were performed by DNA sequencing analysis as described earlier.

[0157] Production of recombinants PF4v1and variants in E. coli: E. coli BL21 (DE3) transformed with the pGEX-6P-2 (GST-fusion expression vector, Amersham) recombinant vector containing the different cDNAs described before, were grown in 100 ml LB with 100 μg/ml ampicillin. After the OD.sub.600nm reached 0.3-0.5, the expression of the fusion protein was induced by the addition with shaking of 0.5 mmol/L isopropyl-1-thio-β-D-galactopyranoside (IPTG) (Euromedex). Cultures were grown overnight at 220 rpm and 25° C. The IPTG-induced test cultures and the IPTG-induced control culture containing the empty vector pGEX-6P-2 were collected by centrifugation at 5000 r/min for 15 minutes at 4° C. The pellets were resuspended in 10 volumes of lysis buffer containing PBS 1X (10 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4, 140 mM NaCl, 2.7 mM KCI, pH 7.3, Lonza), 1 mg/ml lysozyme (Sigma) and cocktail inhibitor protease (Roche). Cells were lysed by freeze/thaw, using liquid nitrogen, followed by sonication (six 30-s sonication steps) in an ice bath. For complete fragmentation of DNA, 5 g/ml DNase I (Sigma) was added and stirred on ice for 15 min. The cell debris was removed by centrifugation at 12 000 r/min for 30 minutes at 4° C. and the supernatant was collected.

[0158] Affinity chromatography step for GST-PF4v1 recombinant protein purification: The supernatant containing the soluble GST-PF4v1 or GST-PF4 (or an another variant) recombinant protein was loaded on a GSTrap HP affinity column (5 ml; Amersham Biosciences) pre-equilibrated with PBS IX at a flow rate of 1 ml/min at room temperature. The bound material was washed with PBS IX until the absorbance at an OD of 280 nm returned to baseline. Once the baseline was stable, elution of the bound GST-PF4v1 recombinant protein was carried out using ten column volumes of elution buffer (PBS IX, 20 mM reduced glutathione, pH 8.0) at a 1 ml/min flow rate. The eluted fractions containing the GST-PF4v1 recombinant protein were pooled. The purification stages and affinity chromatographic profiles were analyzed by Coomassie Blue-stained (Biorad) SDS-PAGE gels and by western blot analysis.

[0159] Cell viability assay: BAE cells were plated for 24 h in flat-bottomed 96-well plates at 5×10.sup.3 cells/well. Following overnight serum starvation, cells were treated in triplicate for 48 h with 10 ng/ml of recombinant FGF2 and in the presence or absence of different concentrations of recombinants proteins. Cell viability was measured at 490 nm using the CellTiter 96 AQ.sub.ueous One Solution cell proliferation assay (Promega Corp.) following the manufacturer's instructions.

[0160] SPR (surface plasmon resonance): Real-time binding experiments were performed with a BIAcore 3000 biosensor instrument (BIAcore AB) and quantified in terms of resonance units (RU) (1000 RU=1 ng of protein bound/mm.sup.2 of flow cell surface) (Ferjoux et al, 2003). Antibodies were immobilized on a carboxymethylated dextran chip (chip CMS, BlAcore AB). Antibodies (10000 RU) were crosslinked on flow cell 2 and flow cell 3, whereas flow cell 1 was activated and deactivated as a nonspecific interaction reference. Soluble ligands (500-1000 nM) were injected at a flow rate of 30 μl/min, exposed to the surface for 600 s (association phase) followed by a 300 s flow running during which the dissociation occurred. Sensorgrams are representative of specific interactions (differential response) where non-specific binding that occurred on flow cell 1 was deduced from binding that occurred on flow cell 2 and 3. Results are expressed as resonance units (RU) as a function of time in seconds.

[0161] ELISA: PF4, PF4v1 and variants were measured using the commercial PF4-ELISA kits (R&D Systems). PBS was used as blank. After protein quantification, the recombinants proteins were measured again using the commercial PF4-ELISA except that the first mouse monoclonal PF4 antibody was substituted by the mouse monoclonal PF4v1 antibody (clone 9E11-2D5-2G1). Assays were performed in triplicate and results analyzed using the Softmax Pro4.0 software (Molecular Devices).

[0162] Dot blot analysis: Mouse monoclonal antibody for PF4v1 (MabV1, clone 9E11-2D5-2G1) was tested and its epitope was evaluated by performing a dot blot analysis using recombinants proteins PF4 and PF4v1. 0.5 μg of protein were spotted onto a nitrocellulose membrane using a microfiltration blotting apparatus. After washing twice with TBST for 5 min, the membrane was incubated with 3% nonfat milk TBST for 30 min. After washing three times with TBST for 5 min, the membrane was incubated with specific antibodies at a dilution of 1:1000. The following antibodies were used: anti-PF4 monoclonal antibody (mAb; R&D Systems, Minneapolis, Minn., clone 170106, 7 μg/mL), anti-PF4v1 monoclonal antibody (MabV1, clone 9E11-2D5-2G1). HRP-labeled secondary antibodies were revealed by the ECL system.

[0163] Statistical analysis: Experiments were performed at least three times. Statistical analysis was performed by unpaired t-test. All values are mean±s.e.m.

Results

[0164] There is only three amino acid difference in the C-terminal region between PF4 and PF4v1 (FIG. 1). When tested for biological activity (proliferation assay on bovine aortic endothelial cells), PF4v1 is 50 times more active. We have generated several mutants for PF4 and PF4v1 that were tested for antibody reactivity.

[0165] We then generated a monoclonal antibody specific for PF4v1 (MabV1) (FIG. 2). A PF4v1 fusion peptide was used for immunizing mice. We then tested the hybridoma supernatants for reactivity against PF4 or PF4v1 by dot blot (MabV1, clone 9E11-2D5-2G1). As seen in FIG. 3b the monoclonal antibody from clone 9E11-2D5-2G1 only cross reacted with PF4v1 but not with PF4. On the other hand, the anti-PF4 anti-body cross reacted with both PF4 and PF4v1. We next performed Biacore analysis. The antibodies are immobilized and then PF4 and PF4v1 are injected at different concentrations. As seen the monoclonal antibody against PF4v1 only recognizes PF4v1 but not PF4.

[0166] We next characterized the reactivity of the monoclonal antibody (FIG. 3). Dot-blot of PF4v1/PF4 mutant proteins were performed using MabV1. Mab PF4 was used as a control which recognizes both PF4 and PF4v1. As seen in FIG. 3 when Histidine is mutated in PF4v1 the antibody does not recognize the molecule any more. On the contrary, when Histidine is introduced instead of Leucine in PF4 the antibody recognizes again the mutated PF4.

[0167] We next studied the neutralizing activity of MabPF4v1 (FIG. 4). MabV1 (1 μg/ml) was added in the proliferation assay using FGF-2-stimulated bovine aortic endothelial cells (BAE). As seen in FIG. 4, inhibition of proliferation by PF4v1 is specifically blocked by MabV1. This indicates that MabV1 blocks the function of PF4v1.

Example 2: In Vivo Studies Using Mabv1 for Targeting Tumors

Material & Methods

Labeling of MabV1 with IRdye

[0168] Monoclonal antibody against CXCL4L1 (MabV1) was labeled with IRDye 800CW (Protein Labeling Kit-HighMW#928-38040, LI-COR®, Lincoln, Nebr.) following the manufacturer's instructions. The conjugate was dialyzed extensively against phosphate buffered saline to remove excess of nonreacted dye. The labeled MabV1 bound 2 dye molecules per mole of protein and do not lose its initial activity. The IRdye-MabV1 was used in studies of its bio-distribution, pharmacokinetics and tolerance in mice and also in the study of targeting tumors expressing CXCL4L1.

Labeling of MabV1 with Biotin

[0169] MabV1 antibody is labeled with biotin using the kit sulfo-NHS-LC-Biotin (PIERCE, Rockford, Ill.) and following the manufacturer's instructions.

Clearance Kinetic of MabV1 Conjugated to IRDye

[0170] To determine the clearance rate and possible non-specific binding of the antibody, Rag Gamma mice (n=50) received an IV injection of 25 μg of IRdye-MabV1into the tail vein. At different times post-injection animals were imaged with the Odyssey Imaging System (LI-COR®) equipped with the MousePOD™ and until there was no detectable signal above background. After imaging, blood was collected intracardially and the organs were removed, scanned on the Odyssey Imaging System and homogenized for determination of of MabV1 concentration by an indirect ELISA assay.

Indirect ELISA Assay

[0171] Recombinant CXCL4L1 protein diluted in a coating solution is immobilized on a microplate. After several steps of washing and blocking, plasma samples and organs lysates are added to the plate. For samples containing MabV1 conjugated to biotin, the result is obtained directly after adding streptavidin-HRP and a substrate solution (TMB) on a microplate reader set to 450 nm. While for samples containing MabV1 an additional step with a biotinylated anti-mouse antibody is required.

Mice Treament

[0172] Rag Gamma mice were subcutaneously injected with 3.10.sup.6 BxPC3 cells and divided in two groups which received 50 μg IgG control antibody (group control, n=16) or 50 μg of blocking antibody MabV1 (group MabV1, n=16). Treatment started at 14days and antibodies were iv injected twice a week. Tumor dimensions were measured each week and tumor volumes were calculated using the formula: (4/3) ab2 (where a and b are the largest and the smallest radius respectively). Mice were sacrificed at 7 weeks, tumors were resected, measured and stored in liquid nitrogen before immunohistochemistry studies.

[0173] In Vivo Tumor Targeting

[0174] IRdye-MabV1 antibody was injected into the tail vein of mice with subcutaneous BxPC3 tumors. 6 days after injection, animals were euthanized and the tissues were removed and imaged on the Odyssey Imaging System. Immediately after imaging organs were frozen and cut into 10 and 40 μm sections for immunohistochemistry studies and odyssey imaging respectively.

Results

[0175] The inventors have shown that the antibody according to the invention (MabV1) blocks the function of PF4v1 in vivo and is able to induce angiogenesis in vivo (FIG. 5).

[0176] Clearance of MabV1 and conjugated MabV1 was analyzed in vivo (FIGS. 6 to 8). Furthermore, the inventors have shown that MabV1 is able to target tumors in vivo. This provides an indication that, when coupled to a cytotoxic agent, the antibody of the invention can be useful in the treatment of a disease associated with pathological angiogenesis such as cancer.

REFERENCES

[0177] Auguste P, Lemiere, S, Larrieu-Lahargue, F, Bikfalvi A. Cirtical Reviews in Oncology/Hematology. 2005 54:53-61.

[0178] Bikfalvi A, Bicknell, R. Recent advances in angiogenesis, anti-angiogenesis

[0179] and vascular targeting. Trends in Pharmacological Sciences. 2002 Dec; 23: 576-582.

[0180] Brady G, Jantzen H M, Bernard H U, Brown R, Schutz G, Hashimoto-Gotoh T. New cosmid vectors developed for eukaryotic DNA cloning. Gene. 1984 Feb;27(2):223-32.

[0181] Edge A S, Faltynek C R, Hof L, Reichert L E Jr, Weber P. Deglycosylation of glycoproteins by trifluoromethanesulfonic acid. Anal Biochem. 1981 Nov 15;118(1):131-7.

[0182] Don E. Eslin, Chunyan Zhang, Kathleen J. Samuels, Lubica Rauova, Li Zhai, Stefan Niewiarowski, Douglas B. Cines, Mortimer Poncz, and M. Anna Kowalska, Blood, 15 Nov. 2004, Vol. 104, No. 10, pp. 3173-3180.

[0183] Eisman R, Surrey S, Ramachandran B, Schwartz E, Poncz M. Structural and functional comparison of the genes for human platelet factor 4 and PF4alt. Blood 1990; 76: 336-344.

[0184] Gillies S D, Morrison S L, Oi V T, Tonegawa S. A tissue-specific transcription enhancer element is located in the major intron of a rearranged immunoglobulin heavy chain gene. Cell. 1983 Jul;33(3):717-28.

[0185] Kuwana Y, Asakura Y, Utsunomiya N, Nakanishi M, Arata Y, Itoh S, Nagase F, Kurosawa Y. Expression of chimeric receptor composed of immunoglobulin-derived V regions and T-cell receptor-derived C regions. Biochem Biophys Res Commun. 1987 Dec 31; 149(3):960-8.

[0186] Maione T E, Gray G S, Petro J, Hunt A J, Donner A L, Bauer S I, Carson H F, Sharpe RJ. Inhibition of angiogenesis by recombinant human platelet factor-4 and related peptides. Science 1990; 247: 77-79.

[0187] Mason J O, Williams G T, Neuberger M S. Transcription cell type specificity is conferred by an immunoglobulin VH gene promoter that includes a functional consensus sequence. Cell. 1985 Jun;41(2):479-87.

[0188] Miyaji H, Mizukami T, Hosoi S, Sato S, Fujiyoshi N, Itoh S. Expression of human beta-interferon in Namalwa KJM-1 which was adapted to serum-free medium. Cytotechnology. 1990 Mar;3(2):133-40.

[0189] Mizukami T, Itoh S. A new SV40-based vector developed for cDNA expression in animal cells. J Biochem (Tokyo). 1987 May;101(5):1307-10.

[0190] Morrison S L, Johnson M J, Herzenberg L A, Oi V T. Chimeric human antibody molecules: mouse antigen-binding domains with human constant region domains. Proc Natl Acad Sci U S A. 1984 Nov;81(21):6851-5.

[0191] Neuberger M S, Williams G T, Fox R O. Recombinant antibodies possessing novel effector functions. Nature. 1984 Dec 13-19;312(5995):604-8.

[0192] O′Hare K, Benoist C, Breathnach R. Transformation of mouse fibroblasts to methotrexate resistance by a recombinant plasmid expressing a prokaryotic dihydrofolate reductase. Proc Natl Acad Sci U S A. 1981 Mar;78(3):1527-31.

[0193] Padlan E A. A possible procedure for reducing the immunogenicity of antibody variable domains while preserving their ligand-binding properties. Mol Immunol. 1991 Apr-May;28(4-5):489-98.

[0194] Pellagatti, A, Cazzola, M, Giagounidis A, Malcovati, L, Della Porta M, Killick S, Campbell, L, Wang, L, Langford, C, Fidler, C, Oscier, D, Aul, C, Wainscoat, J, Boultwood, J. Gene expression profiles of CD34+ cells in myelodysplastic syndromes: involvement of interferon-stimulated genes and correlation to FAB subtype and karyotype. Blood. 2006, 108(1):337-345

[0195] Riechmann L, Clark M, Waldmann H, Winter G Reshaping human antibodies for therapy. Nature. 1988 Mar 24;332(6162):323-7.

[0196] Roguska M A, Pedersen J T, Keddy C A, Henry A H, Searle S J, Lambert J M, Goldmacher V S, Blattler W A, Rees A R, Guild B C. Humanization of murine monoclonal antibodies through variable domain resurfacing. Proc Natl Acad Sci U S A. 1994 Feb 1;91(3):969-73.

[0197] Shitara K, Nakamura K, Tokutake-Tanaka Y, Fukushima M, Hanai N. A new vector for the high level expression of chimeric antibodies in myeloma cells. J Immunol Methods. 1994 Jan 3;167(1-2):271-8.

[0198] Struyf S, Burdick M D, Proost P, Van Damme J, Strieter R M. Platelets release CXCL4L1, a nonallelic variant of the chemokine platelet factor-4/CXCL4 and potent inhibitor of angiogenesis. Circ Res. 2004 Oct 29; 95(9): 855-7.

[0199] Struyf S, Burdick M D, Peeters E, Van den Broeck K, Dillen C, Proost P, Van Damme J, Strieter R M. Platelet factor-4 variant chemokine CXCL4L1 inhibits melanoma and lung carcinoma growth and metastasis by preventing angiogenesis. Cancer Res. 2007 Jun 15; 67(12):5940-8.

[0200] Studnicka G M, Soares S, Better M, Williams R E, Nadell R, Horwitz A H. Human-engineered monoclonal antibodies retain full specific binding activity by preserving non-CDR complementarity-modulating residues. Protein Eng. 1994 Jun;7(6):805-14.

[0201] Thotakura N R, Bahl O P. Enzymatic deglycosylation of glycoproteins. Methods Enzymol. 1987;138:350-9.

[0202] Urlaub G, Chasin L A. Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity. Proc Natl Acad Sci U S A. 1980 Jul;77(7):4216-20.