Assays and apparatus for detecting electrochemical active markers in an electric field

Abstract

The invention provides a method of probing for a nucleic acid comprising: contacting a nucleic acid solution with an oligonucleotide probe labelled with an electrochemically active marker, providing conditions at which the probe is able to at least partially hybridize with any complementary target sequence which may be present in the nucleic acid solution, selectively degrading either hybridized, partially hybridized or unhybridized nucleic acid probe, and electrochemically determining information relating to the electrochemically active marker. The invention further provides novel molecules with use in methods of the invention.

Claims

1. A method of detecting a target nucleic acid sequence in a nucleic acid solution, comprising: contacting the nucleic acid solution with one or more oligonucleotide probes each labeled with a metallocene moiety, wherein each oligonucleotide probe is covalently linked to a metallocene moiety; providing conditions at which one or more of the oligonucleotide probes hybridize with a complementary target sequence present in the nucleic acid solution and form a double stranded hybridized nucleic acid, wherein each of the one or more oligonucleotide probes is complementary along its length to the target sequence; degrading the double stranded hybridized nucleic acid by digestion with a duplex specific nuclease to form at least one of a mononucleotide degraded probe labeled with the metallocene moiety and a dinucleotide degraded probe labeled with the metallocene moiety, wherein the duplex specific nuclease is capable of degrading the oligonucleotide probe only when the oligonucleotide probe is present in the double stranded hybridized nucleic acid and, in the presence of the double stranded hybridized nucleic acid, the duplex specific nuclease degrades the oligonucleotide probe to form at least one of a mononucleotide degraded probe labeled with the metallocene moiety and a dinucleotide degraded probe labeled with the metallocene moiety; and electrochemically detecting a signal based on redox characteristics of the mononucleotide probe labeled with the metallocene moiety, the dinucleotide degraded probe labeled with the metallocene moiety, and any unhybridized oligonucleotide probe in the solution, wherein the signal is influenced by at least the size of the probe to which the metallocene moiety is attached; and wherein the signal of the mononucleotide probe or the dinucleotide probe detects the target nucleic acid sequence in the nucleic acid solution.

2. The method of claim 1, wherein each of the one or more oligonucleotide probes is covalently linked to a metallocene moiety via a spacer comprising an aliphatic chain having 4 to 20 carbon atoms.

3. The method according to claim 1, wherein detecting the target sequence is used for the detection of nucleic acid polymorphisms.

4. The method according to claim 1, wherein the method detects an amplified target nucleic acid in the solution.

5. The method according to claim 1, wherein a single metallocene moiety is attached to the 5-terminal nucleotide of each of the one or more oligonucleotide probes.

6. The method according to claim 1, wherein a single metallocene moiety is attached to the 3-terminal nucleotide of each of the one or more oligonucleotide probes.

7. The method according to claim 1, wherein multiple metallocene moieties are attached along the length of each of the one or more oligonucleotide probes.

8. The method of claim 1, wherein the duplex specific nuclease is T7 exonuclease.

9. The method of claim 1, wherein the metallocene moiety is a ferrocene moiety.

10. The method according to claim 2, wherein the spacer is an aliphatic chain having 6 carbon atoms.

11. The method of claim 1, wherein detecting the target sequence is used for detection of allelic polymorphisms.

12. The method of claim 1, wherein detecting the target sequence is used for the detection of single nucleotide polymorphisms.

13. The method of claim 1, wherein detecting the target sequence is used for the quantification of nucleic acid species.

14. The method of claim 1, wherein detecting the target sequence is used for the quantification of gene expression.

15. The method of claim 1, wherein electrochemically detecting the signal of the mononucleotide probe, the dinucleotide probe, and any unhybridized oligonucleotide probe is by voltammetry.

16. The method of claim 1, wherein electrochemically detecting the signal of the mononucleotide probe, the dinucleotide probe, and any unhybridized oligonucleotide probe is by an amperometric technique.

17. The method of claim 1, wherein electrochemically detecting the signal of the mononucleotide probe, the dinucleotide probe, and any unhybridized oligonucleotide probe is by differential pulse voltammetry.

18. The method of claim 9, wherein the ferrocene moiety is a di-ferrocene moiety.

19. The method according to claim 9, wherein multiple oligonucleotide probes are each labeled with different derivatives of ferrocene.

20. The method according to claim 19, wherein the different derivatives of ferrocene have peaks at distinct voltages.

Description

(1) Certain illustrative embodiments of the invention will now be described in detail with reference to the accompanying drawings in which:

(2) FIG. 1 is a schematic representation of an electrochemical cell used in differential pulse voltammetry measurements described herein;

(3) FIGS. 2A, 2B, 2C and 2D are differential pulse voltammograms of ferrocene labelled BAPR oligonucleotide as described in Example 4(a) below;

(4) FIGS. 3A, 3B, 3C and 3D are differential pulse voltammograms of ferrocene labelled BAPR oligonucleotide as described in Example 4(b) below;

(5) FIGS. 4A, 4B, 4C and 4D are differential pulse voltammograms of ferrocene labelled T1BAPR oligonucleotide as described in Example 4(c) below;

(6) FIGS. 5A, 5B, 5C and 5D are differential pulse voltammograms of ferrocene labelled BAPR oligonucleotide as described in Example 4(d) below;

(7) FIGS. 6A, 6B, 6C and 6D are differential pulse voltammograms of ferrocene labelled GSDPR oligonucleotide as described in Example 4(e) below;

(8) FIGS. 7A, 7B, 7C and 7D are differential pulse voltammograms of ferrocene labelled MC11PR oligonucleotide as described in Example 4(f) below;

(9) FIGS. 8A and 8B are differential pulse voltammograms of unlabelled BAFR oligonucleotide as described in Example 4(g) below;

(10) FIGS. 9A and 9B are differential pulse voltammograms of control reactions for ferrocene labelled T1BAPR oligonucleotide as described in Example 4(h) below;

(11) FIGS. 10A, 10B, 10C and 10D are differential pulse voltammograms of PCR mixture containing labelled BAPR oligonucleotide as described in Example 5(a) below;

(12) FIGS. 11A, 11B and 11C are differential pulse voltammograms of another PCR mixture containing ferrocene labelled MC11PR oligonucleotide as described in Example 5(b) below;

(13) FIGS. 12A, 12B, 12C and 12D are differential pulse voltammograms of a PCR mixture containing ferrocene labelled T1BAPR oligonucleotide as described in Example 5(c);

(14) FIGS. 13A, 13B, 13C and 13D are differential pulse voltammograms of a PCR mixture containing ferrocene labelled GSDPR oligonucleotide as described in Example 5(d);

(15) FIGS. 14A and 14B are schematic representations of the Invader fluorogenic nucleic acid detection system adapted for use in a method of the invention;

(16) FIG. 15A illustrates the use of the methods of the invention in a T7 exonuclease assay;

(17) FIG. 15B illustrates the use of the methods of the invention in an assay incorporating a T7 exonuclease digestion of a labelled oligonucleotide probe annealed to PCR products;

(18) FIGS. 16A and 16B are differential pulse voltammograms illustrating T7 exonuclease substrate specificity (Example 9);

(19) FIGS. 17A and 17B are differential pulse voltammograms illustrating T7 exonuclease digestion of PCR product labelled with 5 ferrocenylated primer (Example 10(a));

(20) FIGS. 18A, 18B, 18C, 18D, 19A, 19B, 20A and 20B are differential pulse voltammograms illustrating T7 exonuclease digestion of Taqman (Trade MarkApplied Biosystems) probe annealed to PCR product (Example 10(b));

(21) FIGS. 21A and 21B are differential pulse voltammograms illustrating PCR amplification with Stoffel fragment (Example 10(c)); and

(22) FIGS. 22A and 22B are differential pulse voltammograms illustrating experiments with no T7 exonuclease (Example 10(d)).

(23) FIGS. 23A and 23B are differential pulse voltammograms illustrating the electrode potential of ferrocene carboxylic acid at 10 M and 1 M concentration respectively and FIG. 23C and FIG. 23D are differential pulse voltanunograms illustrating the electrode potential of 4-(3-ferrocenylureido)-1-benzoic acid at 10 M and 1 M concentration respectively.

(24) FIGS. 24A, 24B and 24C show differential pulse voltammograms of the products of nuclease digest reactions in which the BAPR oligonucleotide was labelled at the 5 end by ferrocene with a 12 carbon spacer moiety (2.5 M) and MC11w oligonucleotide was labelled at the 5 end by 4-(3-ferrocenylureido)-1-benzoic acid with a 12 carbon spacer moiety (1.5 M) (FIG. 24A), BAPR oligonucleotide was labelled at the 5 end by ferrocene with a 12 carbon spacer moiety only (2.5 M) (FIG. 24B), and MC11w oligonucleotide was labelled at the 5 end by 4-(3-ferrocenylureido)-1-benzoic acid with a 12 carbon spacer moiety only (1.5 M) (FIG. 24C).

(25) With reference to FIG. 1, an electrochemical cell 1 suitable for use in the cyclic voltammetry experiments described herein comprises a vessel 2, containing a background electrolyte solution 3, which is an aqueous 100 mM solution of ammonium acetate. Immersed in the solution 3 is a chamber 4, which receives both the sample to be tested and, immersed therein, a glassy carbon working electrode 5. A gold electrode may alternatively be used. Also immersed in the solution 3 is a counter-electrode 6 of platinum wire and a silver/silver chloride reference electrode 7 immersed in 4M potassium chloride solution, which solutions are in communication with others via a sintered disc.

(26) With reference to FIG. 15A and FIG. 15B, T7 exonuclease (sometimes referred to as T7 gene 6 exonuclease) is a duplex specific 5 to 3 exonuclease. The enzyme digests oligonucleotides annealed to a target region of DNA in order to produce mononucleotide, dinucleotide and shorter oligonucleotide fragments. The substrate specificity of the enzyme is such that oligonucleotide probes labelled with an electrochemical marker such as ferrocene at the 5 end can be digested. Digested ferrocene labelled probes can be detected by electrochemical methods, for example by differential pulse voltammetry. T7 exonuclease is not thermostable, and therefore is not stable under the thermal cycling conditions normally used in PCR.

(27) T7 exonuclease can be used in PCR based DNA detection in two ways. PCR products labelled at the 5 end with a marker such as ferrocene can be synthesized by using a 5 labelled primer. The T7 exonuclease subsequently added to the PCR mix digests the labelled PCR product. Non-amplified single strand primer will not be digested (FIG. 15A). In the second method, in order to provide sequence specific PCR product detection, an electrochemically labelled probe similar to a Taqman probe (Trade MarkApplied Biosystems) in that it is designed to hybridized to the target nucleic acid between the primer sequences, is used instead of labelled primers. The probe is introduced into the PCR mix after thermal cycling and allowed to anneal to the target. T7 exonuclease is then added and the probe is digested only if it has formed a duplex by annealing with a complimentary PCR product.

(28) The following Examples illustrate the invention:

(29) Materials and MethodsOligonucleotide Preparation and Assays

(30) Oligonucleotides were obtained from Sigma Gensosys. All oligonucleotides were obtained desalted and were used without further purification. N,N-Dimethylformamide (DMF) (99.8% A.C.S. reagent) and zinc acetate dihydrate (99.999%) were obtained from Aldrich.

(31) Potassium bicarbonate (A.C.S. reagent), potassium carbonate (minimum 99%), ammonium acetate (approximately 98%), magnesium acetate (minimum 99%), ammonium persulfate (electrophoresis reagent), N,N,N,N-tetramethylethylenediamine (TEMED) and molecular biology grade water were obtained from Sigma.

(32) NAP10 columns (G25 DNA grade Sephadex trade mark) were obtained from Amersham Biosciences.

(33) S1 Nuclease, dNTPs and human genomic DNA were obtained from Promega.

(34) AmpliTaq Gold, with 25 mM magnesium chloride and GeneAmp (trade mark) 10PCR Gold buffer supplied and Amplitaq DNA Polymerase, Stoffel Fragment, with 10 Stoffel buffer and 25 mM magnesium chloride supplied, was obtained from Applied Biosystems.

(35) T7 exonuclease was obtained from New England Biolabs.

(36) Incubations were performed using a PTC-100 Programmable Thermal Controller (MJ Research Inc.). Absorbance measurements at 260 nm were performed using a Cary 100 Bio spectrophotometer (Varian Ltd.).

(37) Polyacrylamide gels were prepared with PratoGel (National Diagnostics) and stained with SYBR Gold (Molecular Probes Inc.).

(38) Agarose gels were prepared with SeaKem LE agarose (BioWhittaker Molecular Applications) and stained with ethidium bromide (Aldrich). Gels were electrophoresed in 0.5 Tris/borate/EDTA (TBE) buffer (Sigma). All solutions were prepared with autoclaved deionised water (WaterPro system, Labconco).

(39) Oligonucleotide Sequences

(40) The oligonucleotide sequences of the glucose-6-phosphatase and medium chain acyl-CoA dehydrogenase primers and probes were as disclosed in Kunihior Fujii, Yoichi Matsubara, Jun Akanuma, Kazutoshi Takahashi, Shigeo Kure, Yoichi Suzuki, Masue Imiazurni, Kazuie linuma, Osamu Sakatsume, Piero Rinaldo, Kuniaki Narisawa; Human Mutation; 15; 189-196; (2000).

(41) The oligonucleotide sequence of the beta actin primers and probe were as disclosed in Agnetha M Josefsson, Patrik K E Magnusson, Nathelie Ylitalo, Per Sorensn, Pernialla Qwarforth-Tubbin, PerKragh Andersen, Mads Melbye, Hans-Olov Adami, Ulf B Gyllensten; Lancet; 355; 2189-2193; (2000).

(42) The oligonucleotide sequence of the HFE gene primers and probe were as disclosed in Luis A. Ugozzoli, David Chinn, Keith Hamby, Analytical Biochemistry; 307; 47-53 (2002).

(43) TABLE-US-00001 ACTB( actin) Probe (SEQIDNO:1) BAPR:ATGCCCTCCCCCATGCCATCCTGCGT (SEQIDNO:2) C9-T1BAPR:T(C9)GCCCTCCCCCATGCCATCCTGCGT (T(C9)= aminomodifiedthyminewithC9linker, FormulaIV) Primers (SEQIDNO:3) BAF:CAGCGGAACCGCTCATTGCCAATGG (SEQIDNO:4) BAR:TCACCCACACTGTGCCCATCTACGA (SEQIDNO:5) BAFR:CAGGTCCCGGCCAGCCAG C282Y(HFEgene,C282Ymutation) Probe (SEQIDNO:6) C282YP:ATATACGTGCCAGGTGGA Primers (SEQIDNO:7) C282YF:CTGGATAACTTGGCTGTAC (SEQIDNO:8) C282YR:TCAGTCACATACCCCAGAT H63D(HFEgene,H63Fmutation) Probe (SEQIDNO:9) H63DP:ATATACGTGCCAGGTGGA Primers (SEQIDNO:10) H63DF:CTTGGTCTTTCCTTGTTTGAAG (SEQIDNO:11) H63DR:ACATCTGGCTTGAAATTCTACT CFTR(cysticfibrosistransmembraneconductance regulator) Primers (SEQIDNO:12) CFT01:AGGCCTAGTTGTCTTACAGTCCT (SEQIDNO:13) CFT03:TGCCCCCTAATTTGTTACTTC G6PC(glucose-6-phosphatase) Probe (SEQIDNO:14) GSDPR:TGTGGATGTGGCTGAAAGTTTCTGAAC Primers (SEQIDNO:15) GSDw:CCGATGGCGAAGCTGAAC (SEQIDNO:16) GSDcom:TGCTTTCTTCCACTCAGGCA ACADM(mediumchainacyl-CoAdehydrogenase) Probe (SEQIDNO:17) MC11PR:CTAGAATGAGTTACCAGAGAGCAGCTTGG Primers (SEQIDNO:18) MC11w:GCTGGCTGAAATGGCAATGA (SEQIDNO:19) MC11com:CTGCACAGCATCAGTAGCTAACTGA Hairpinoligonucleotide (SEQIDNO:20) reHP:CAGAATACAGCAGGTGCTCGCCCGGGCGAGCAC CTGTATTCTG Singlestrandoligonucleotide (SEQIDNO:21) reBAF:CAGAATACAGCAGGTTCACCCACACTGTGCCCA TCTACGA

(44) The oligonucleotide for use in examples 7 and 8 were C12 amino modified at the 5 end. The olignucleotides for use in the other examples were unmodified.

(45) Materials and MethodsElectrochemical Detection

(46) The following electrodes and low volume cell were obtained from BAS, Congleton, Cheshire, UK:

(47) Glassy carbon working electrode (catalogue number MF-2012) was used in examples 4 and 5. A Gold working electrode (catalogue number MF-2014) was used in examples 8 to 10.

(48) Silver/silver chloride reference electrode (catalogue number MF-2079)

(49) Platinum wire counter (auxiliary) electrode (catalogue number MW-4130).

(50) Low volume cell (catalogue number MF-2040) comprising glass voltammetry vial and glass sample chamber, with replaceable vycor tip.

(51) An AutoLab electrochemical workstation (either PGSTAT30 with frequency response analyzer or AutoLab type II manufactured by Eco Chernie B.V) was obtained from Windsor scientific Limited.

EXAMPLE 1

(52) This Example describes the cyclic voltammetry method used in Examples 3 to 5 and 8 to 10 below.

(53) The low volume cell of FIG. 1 was filled with approximately 10 ml ammonium acetate solution (100 mM).

(54) A 200 l aliquot of the sample for analysis was placed in the glass sample chamber 4 which was then placed in the low volume cell along with the reference 7 and counter electrodes 6. The electrodes were connected to an Autolab electrochemical workstation and differential pulse voltammetry carried out using the parameters described below. Prior to analysis the working electrode was polished (using BAS polishing kit catalogue number MF-2060) followed by conditioning. Electrode conditioning consisted of cyclic voltammetry, sweeping between +/1 volt in the appropriate background buffer.

(55) Parameters for Differential Pulse Voltammetry

(56) TABLE-US-00002 TABLE 1 Parameters used in Examples 4 and 5 Parameter: Cathodic Anodic Sweep Conditioning potential (V) 0 0 Conditioning duration (s) 0 0 Deposition potential (V) 0.8 0.1 Deposition duration (s) 5 5 Equilibration time (s) 0 0 Modulation time (s) 0.02 0.02 Interval time (s) 0.1 0.1 Initial potential (V) 0.75 0.1 End potential (V) 0.1 0.7 Step potential (V) 0.005 0.005 Modulation amplitude (V) 0.1 0.1

(57) TABLE-US-00003 TABLE 2 Parameters used in Example 8 Parameter: Cathodic Anodic Sweep Conditioning potential (V) 0 0 Conditioning duration (s) 0 0 Deposition potential (V) 0 0 Deposition duration (s) 0 5 Equilibration time (s) 0 0 Modulation time (s) 0.04 0.04 Interval time (s) 0.1 0.1 Initial potential (V) 0.1 .0.3 End potential (V) 0.3 0.1 Step potential (V) 0.0003 0.0003 Modulation amplitude (V) 0.05 0.05

(58) TABLE-US-00004 TABLE 3 Parameters used in Examples 9 and 10 Parameter: Anodic sweep Conditioning potential (V) 0 Conditioning duration (s) 10 Deposition potential (V) 0 Deposition duration (s) 0 Equilibration time (s) 0 Modulation time (s) 0.04 Interval time (s) 0.1 Initial potential (V) 0.1 End potential (V) 0.7 Step potential (V) 0.003 Modulation amplitude (V) 0.05

EXAMPLE 2

Synthesis of N-Hydroxysuccinimide Ester of Ferrocenecarboxylic Acid

(59) Ferrocenecarboxylic acid (303 mg, 1.32 mmol) and N-hydroxysuccinimide (170 mg, 1.47 mmol) were dissolved in dioxane (15 ml) and added with stirring to a solution of dicyclohexylcarbodiimide (305 mg, 1.48 mmol) in dioxane (3 ml). The mixture was stirred at room temperature for 24 hours during which time a precipitate was formed. The precipitate was removed by filtration, solvent was removed from the filtrate in vacuo and the resulting solid purified by silica gel column chromatography, eluting with 8:2 petrol:ethyl acetate. Yield 320 mg, 74%.

EXAMPLE 3

Synthesis of Ferrocenyl Oligonucleotides

(60) Lyophilised amino-modified oligonucleotide was rehydrated in the correct volume of K.sub.2CO.sub.3/KHCO.sub.3 buffer (500 mM, pH 9.0) to give an oligonucleotide concentration of 0.5 nmoll.sup.1. Amino-modified oligonucleotide (40 l, 0.5 nmoll.sup.1) was added slowly with vortexing to a solution of the N-hydroxysuccinimide ester of ferrocenecarboxylic acid in DMF (40 l, 375 mM). The solution was shaken at room temperature overnight. It was then diluted with ammonium acetate (920 l, 100 mM, pH 7.0) and purified using two NAP 10 columns, eluting firstly with ammonium acetate (100 mM, pH 7.0), and then with autoclaved deionised water. Ferrocenylated oligonucleotides were partially purified by NAP 10 column to remove salt and low molecular weight ferrocene species to give a mixture of ferrocene labelled and unlabelled oligonucleotides. No further purification was carried out before use. Amino-modified oligonucleotides possessing four different linker structures: C7, C6, C12 and T(C9), varying in structure and point of attachment, were used in labeling reactions. C6, C12 and T(C9) linkers were attached at the 5 end of the oligonucleotide, via the terminal phosphate ester or the base. The C7 linker was attached via the terminal phosphate ester at the 3 end of the oligonucleotide. The label structures are given in Formulae I to IV. Oligonucleotide concentration of the eluent was determined by measuring its absorbance at 260 nm. Presence of the ferrocene label was confirmed by voltammetric analysis.

EXAMPLE 4

S1 Nuclease Digestion

(61) Olignucleotide digestion reactions (100 l) contained oligonucleotide (3.5-9 M concentrations detailed below), ammonium acetate (250 mM, pH 6.5), zinc acetate (4.5 mM) and S1 Nuclease (0.4 Ul.sup.1). Reactions were incubated at 37 C. for 1 hour. Complete digestion of the oligonucleotide was confirmed by polyacrylamide gel analysis of a 10 l aliquot of the crude reaction mix. Multiple reactions were pooled prior to voltammetric analysis, to give a final volume of 200 l. By way of comparison, no-enzyme reactions were performed as described above, omitting S1 Nuclease from the reaction mixture. Heated enzyme controls were performed as described above, using S1 Nuclease that had previously been thermally denatured by heating at 95 C. for 15 minutes.

(62) In the following, the reactants and conditions are as described above, and the voltammetry conditions are as given in Table 1 except where otherwise stated.

EXAMPLE 4(A)

(63) Oligonucleotide: BAPR oligonucleotide labelled at 3 end by ferrocene with a 7-carbon spacer moiety (Formula I).

(64) Concentration of oligonucleotide: 7.0 M

(65) Voltammetry conditions: As in Table 1 except that the interval time was 0.09 s and the modulation time 0.5 s.

(66) The results are shown in FIG. 2A (cathodic sweep of no-enzyme control), FIG. 2B (cathodic sweep of solution including S1 nuclease), FIG. 2C (anodic sweep of no-enzyme control) and FIG. 2D (anodic sweep of solution including S1 nuclease). The measured peak values, peak positions and % peak enhancement for the solution including S1 nuclease (that is, with digested oligonucleotide) as compared the no-enzyme control are given in Table 2.

EXAMPLE 4(B)

(67) Oligonucleotide: BAPR oligonucleotide labelled at 5 end by ferrocene with a 6-carbon spacer moiety (Formula II).

(68) Concentration of oligonucleotide: 7.0 M

(69) Voltammetry conditions: As in Table 1 except that the interval time was 0.09 s and the modulation time 0.5 s.

(70) The results are shown in FIG. 3A (cathodic sweep of no-enzyme control), FIG. 3B (cathodic sweep of solution including S1 nuclease), FIG. 3C (anodic sweep of no-enzyme control) and FIG. 3D (anodic sweep of solution including S1 nuclease). The measured peak values, peak positions and % peak enhancement for the solution including S1 nuclease (that is, with digested oligonucleotide) as compared the no-enzyme control are given in Table 2.

EXAMPLE 4(C)

(71) Oligonucleotide: T1BAPR oligonucleotide labelled at 3 end base by ferrocene with a 9-carbon spacer moiety (Formula IV).

(72) Concentration of oligonucleotide: 8.8 M

(73) Voltammetry conditions: As in Table 1

(74) The results are shown in FIG. 4A (cathodic sweep of no-enzyme control), FIG. 4B (cathodic sweep of solution including S1 nuclease), FIG. 4C (anodic sweep of no-enzyme control) and FIG. 4D (anodic sweep of solution including S1 nuclease). The measured peak values, peak positions and % peak enhancement for the solution including S1 nuclease (that is, with digested oligonucleotide) as compared the no-enzyme control are given in Table 2.

EXAMPLE 4(D)

(75) Oligonucleotide: BAPR oligonucleotide labelled at 5 end by ferrocene with a 12-carbon spacer moiety (Formula III).

(76) Concentration of oligonucleotide: 7.0 M.

(77) Voltammetry conditions: As in Table 1 except that the interval time was 0.09 s and the modulation time 0.5 s.

(78) The results are shown in FIG. 5A (cathodic sweep of no-enzyme control), FIG. 5B (cathodic sweep of solution including S1 nuclease), FIG. 5C (anodic sweep of no-enzyme control) and FIG. 5D (anodic sweep of solution including S1 nuclease). The measured peak values, peak positions and % peak enhancement for the solution including S1 nuclease (that is, with digested oligonucleotide) as compared the no-enzyme control are given in Table 2.

EXAMPLE 4(E)

(79) Oligonucleotide: GSDPR oligonucleotide labelled at 5 end by ferrocene with a 12-carbon spacer moiety (Formula III).

(80) Concentration of oligonucleotide: 3.5 M.

(81) Voltammetry conditions: As in Table 1.

(82) The results are shown in FIG. 6A (cathodic sweep of no-enzyme control), FIG. 6B (cathodic sweep of solution including S1 nuclease), FIG. 6C (anodic sweep of no-enzyme control) and FIG. 6D (anodic sweep of solution including S1 nuclease). The measured peak values, peak positions and % peak enhancement for the solution including S1 nuclease (that is, with digested oligonucleotide) as compared the no-enzyme control are given in Table 2.

EXAMPLE 4(F)

(83) Oligonucleotide: MC11PR oligonucleotide labelled at 5 end by ferrocene with a 12-carbon spacer moiety (Formula III).

(84) Concentration of oligonucleotide: 3.5 M.

(85) Voltammetry conditions: As in Table 1.

(86) The results are shown in FIG. 7A (cathodic sweep of no-enzyme control), FIG. 7B (cathodic sweep of solution including S1 nuclease), FIG. 7C (anodic sweep of no-enzyme control) and FIG. 7D (anodic sweep of solution including S1 nuclease). The measured peak values, peak positions and % peak enhancement for the solution including S1 nuclease (that is, with digested oligonucleotide) as compared the no-enzyme control are given in Table 2.

EXAMPLE 4(G)

Comparison

(87) Oligonucleotide: BAFR, unlabelled.

(88) Concentration of oligonucleotide: 8.8 M.

(89) Voltammetry conditions: As in Table 1

(90) The results are shown in FIG. 8A (cathodic sweep) and FIG. 8B (anodic sweep). No peak was observed in either sweep. CL EXAMPLE 4(H)

Comparison

(91) Oligonucleotide: T1BAPR oligonucleotide labelled at 5 end base by ferrocene with a 9-carbon spacer moiety (Formula IV).

(92) Concentration of oligonucleotide: 8.8 M.

(93) Voltammetry conditions: As in Table 1.

(94) The results are shown in FIG. 9A (anodic sweep of no-enzyme control) and FIG. 9B (anodic sweep of heated enzyme control including S1 nuclease). In FIG. 9A, a peak height of 60.6 A (peak position 424 mV) was recorded, whilst in FIG. 9B, a peak height of 39.9 A (peak position 409 mV) was recorded.

(95) Ferrocene related peaks were observed at 300-500 mV. No peaks were observed in this range when non-ferrocenylated oligonucleotides were analysed (FIGS. 8A and 8B). Comparison of digested ferrocene labelled oligonucleotides and no-enzyme controls showed that an increase in peak height was obtained on digestion of the oligonucleotide (Table 4).

(96) In order to confirm that the observed changes were not due to the presence of enzyme, or components of the enzyme storage buffer, digestion experiments were also performed using heat-denatured enzyme (Example 4(h)). No significant changes to the ferrocene signal were observed when comparing heat denatured enzyme and no enzyme controls.

(97) Digestion experiments of two additional oligonucleotide sequences with the C12 ferrocene-oligonucleotide linker were performed; Ferrocene-C12-MC11PR (FIG. 11B) and Ferrocene-C12-GSDPR (FIGS. 6B and 6D). An increase in peak height of the ferrocene related signal of digested oligonucleotide was observed for each sequence.

(98) TABLE-US-00005 TABLE 4 Positions and heights for ferrocene related peaks on anodic and cathodic differential pulse voltammograms % increase Undigested Digested in peak Peak Peak Peak Peak height upon Oligo position Height Position Height digestion Cathodic Sweeps BAPR C7 41 424 10.16 218 BAPR C6 42 444 8.87 274 T1BAPR 51 533 456.5 485 BAPR 500 4.71 GSDPR 53 554 65.43 215 MC11PR 55 564 49 224 Anodic Sweeps BAPR C7 39 3.39 394 9.18 266 BAPR C6 39 1.63 419 10.3 632 T1BAPR 43 82.8 444 818 988 BAPR 494 6.7 GSDPR 43 62.9 394 359 571 MC11PR 42 60.1 394 196 326

EXAMPLE 5

PCR

(99) PCR amplification was performed from human genomic DNA (40 ng per 100 l reaction), or gel purified PCR amplicons. PCR amplicons used for subsequent amplifications were purified by agarose gel with Nucleospin Extract kits (Macherey-Nagel) following the protocol supplied. All ferrocenyl oligonucleotide probes were 3 phosphorylated.

(100) Primers, template and probe used for individual reactions are detailed above.

(101) 100 l reactions contained Tris HCl (15 mM, pH 8.0), potassium chloride (50 mM), magnesium chloride (3.5 mM), dATP, TTP, dCTP, dGTP (200 M each), forward primer (1.0 M), reverse primer (1.0 M), ferrocenyl oligonucelotide probe (0.9 M), AmpliTaq Gold (0.04 Ul.sup.1). Samples were incubated at 95 C. for 10 minutes (initial denaturation and enzyme activation) followed by 40 cycles of denaturation at 95 C. for 15 s, and primer annealing and extension at 60 C. for 1 min.

(102) Fifteen 100 l reactions were prepared and pooled. The crude reaction mixture was then concentrated to 200 l total volume prior to voltammetric analysis.

(103) In the following, the reactants and conditions are as described above and the voltammetry conditions are as given in Table 1 unless otherwise stated.

EXAMPLE 5(A)

(104) Oligonucleotide: BAPR oligonucleotide labelled at 5 end with a 12-carbon spacer moiety (Formula III).

(105) Positive reaction: ( actin) template: actin PCR amplicon; primers: BAF, BAR.

(106) Negative reaction: (cystic fibrosis transmembrane conductance regulator) template: cystic fibrosis PCR amplicon; primers: CFT 01, CFT 03.

(107) Voltammetry conditions: As in Table 1.

(108) The results were as follows:

(109) FIG. 10A negative reaction, cathodic sweep, no peak observed

(110) FIG. 10B positive reaction, cathodic sweep, peak position: 493 mV, peak height: 19.4 nA.

(111) FIG. 10C negative reaction, anodic sweep, no peak observed.

(112) FIG. 10D positive reaction, anodic sweep, peak position: 373 mV, peak height: 27.3 nA. CL EXAMPLE 5(B)

(113) Oligonucleotide: MC11PR oligonucleotide labelled at 5 end with a 12-carbon spacer moiety (Formula III).

(114) Positive reaction: (Medium chain acyl-CoA dehydrogenase) template: MCAD PCR amplicon or genomic template; primers: MC11w, MC11com;

(115) Negative reaction: (glucose-6-phosphatase) template: Glucose-6-Phosphatase PCR amplicon; primers: GSDw, GSDcom;

(116) FIG. 11A negative reaction, anodic sweep, peak position: 429 mV, peak height: 1.84 nA.

(117) FIG. 11B positive reaction (PCR amplicon template), anodic sweep, peak position: 388 mV, peak height: 7.62 nA.

(118) FIG. 11C positive reaction (genomic template), anodic sweep, peak position: 409 mV, peak height: 8.11 nA. CL EXAMPLE 5(C)

(119) Oligonucleotide: T1BAPR oligonucleotide labelled at 5 end with a 9-carbon spacer moiety.

(120) Positive reaction: ( actin) template: human genomic DNA; primers:

(121) BAF, BAR

(122) Negative reaction: (glucose-6-phosphatase) template: human genomic DNA; primers: GSDw, GSDcom.

(123) Voltammetry conditions: as in Table 1.

(124) The results were as follows:

(125) FIG. 12A: negative reaction, anodic sweep.

(126) FIG. 12B: positive reaction, anodic sweep, peak position: 429 mV, peak height 36 nA.

(127) FIG. 12C: negative reaction cathodic sweep.

(128) FIG. 12D: positive reaction cathodic sweep, peak position: 498 mV, peak height: 14 nA. CL EXAMPLE 5(D)

(129) Oligonucleotide GSDPR labelled at 5 end with a 12 carbon spacer moiety.

(130) Positive reaction: (glucose-6-phosphatase) template: human genomic DNA; primers: GSDw, GSDcom.

(131) Negative reaction: ( actin) template: human genomic DNA; primers: BAF, BAR.

(132) FIG. 13A: negative reaction, anodic sweep.

(133) FIG. 13B: positive reaction, anodic sweep, peak, position: 439 mV, peak height: 23 nA.

(134) FIG. 13C: negative reaction cathodic sweep.

(135) FIG. 13D: positive reaction cathodic sweep.

(136) In this example, to demonstrate the sequence specific detection of PCR products with ferrocenylated oligonucleotide probes, probe and primer sequences from previously optimized fluorogenic 5 nuclease assays were used. PCR amplification from beta actin glucose-6-phosphatase and medium chain acyl-CoA dehydrogenase genes was performed using either purified amplicon or human genomic DNA template. In all PCR experiments probes with C12 ferrocene linkers attached at the 5 end were used. The 3 end of all PCR experiments probes were extension blocked by phosphorylation.

(137) Ferrocenyl oligonucleotide probes were added to PCR mixes which amplified complementary targets (positive reactions) and non-complementary targets (negative reactions). To improve detection of the ferrocene species, reactions were combined and concentrated before voltammetric analysis.

(138) Voltammetric analysis was performed on the crude PCR mixes. In each case a ferrocene related signal is observed for positive reactions (containing digested probe). No signal is observed for negative reactions (containing undigested probe). CL EXAMPLE 6A

Synthesis of Ferrocene Carbonyl Azide

(139) Ferrocene carbonyl azide was prepared from ferrocenecarboxylic acid by reaction with oxalyl chloride and sodium azide.

EXAMPLE 6B

Synthesis of N-Hydroxysuccinimide Ester of 4-(3-Ferrocenylureido)-1-Benzoic Acid

(140) ##STR00006##

(141) To a purged round-bottom flask was charged ferrocene carbonyl azide (300 mg, 1.18 mmol, 1.00 equiv.), 4-aminobenzoic acid (244 mg, 1.78 mmol, 1.50 equiv.) and 1,4-dioxane (40 ml) under nitrogen. The reaction mixture was stirred under nitrogen in a 100 C. bath for 2 hr 50 min and then allowed to cool to room temperature. 2M HCl (100 ml) was charged to the reaction mixture and the product was extracted into ethyl acetate (150 nil). This phase was washed with 2M HCl (100 ml), dried with sodium sulphate and concentrated in vacuo to afford the product. Further drying in a vacuum oven yielded as orange crystals (413 mg 96%). .sup.1H-NMR (300 MHz, d.sub.6-DMSO) 3.96 (2H, b, Hc), 4.14 (5H, s, Ha), 4.53 (2H, b, Hb), 7.54 (2H, m, Hf), 7.85 (2H, in, Hg), 7.98 (1H, s, Hd), 8.87 (1H, s, He) 12.57 (1H, s, Hh).sup.13C-NMR (75.5 MHz, d.sub.6-DMSO) 61.0 64.1 66.7 68.1 (Ca, d), 117.2 (Cg), 123.5 (Cj), 130.9 (Ch), 144.6 (Cf), 152.8 (Ce). CL EXAMPLE 6C

Synthesis of N-Hydroxysuccinimide Ester of 4-(3-Ferrocenylureido)-1-Benzoic Acid

(142) Dicyclohexylcarbodiimide (DCC) (194 mg, 0.939 mmol, 1.14 equiv.) was dissolved in anhydrous 1,4-Dioxane (2 ml) and charged to a purged round-bottom flask, under nitrogen. N-hydroxysuccinimide (108 mg, 0.939 mmol, 1.14 equiv.) was charged. 4-(3-Ferrocenylureido)-1-benzoic acid (300 mg, 0.823 mmol 1.0 equiv.) was dissolved in anhydrous 1,4-Dioxane (13 ml) and charged dropwise to the flask. The solution was stirred at room temperature for 23 hr. A small amount of light brown solid was removed from the red/orange reaction mixture by Buchner filtration. Water (100 ml) and ethyl acetate (50 ml) were charged to the reaction mixture. The ethyl acetate phase was separated and the aqueous was extracted with ethyl acetate (100 ml). The ethyl acetate phases were combined, dried with sodium sulphate and concentrated in vacuo to afford the crude product as an orange oil, which was purified using silica flash chromatography with a gradient system from ethyl acetate 60/petroleum ether (bp 40-60 C.) 40 to ethyl acetate. Drying in a vacuum oven yielded N-hydroxysuccinimide ester of 4-(3-ferrocenylureido)-1-benzoic acid as fine orange crystals (237 mg, 66%). R.sub.f (5:1 ethyl acetate/petroleum ether (bp 40-60 C.)=0.41 .sup.1H-NMR (300 MHz, d6-DMSO) 2.88 (4H, s, Hh), 3.98 (2H, t, J=1.8 Hz, Hc), 4.16 (5H, s, Ha), 4.55 (2H, t, J=1.8 Hz, Hb), 7.68 (2H, m, Hf), 8.00 (2H, m, Hg), 8.11 (1H, s, Hd), 9.16 (1H, s, He). .sup.13C-NMR (75.5 MHz, d.sub.6-DMSO) 25.9 (Cl), 61.1 64.2 (Cb and Cc), 69.1 (Ca), 117.7 (Cg), 131.9 (Ch), 170.9 (Ck). MS (FAB+m/z) 462.07 [M+H].

EXAMPLE 6D

Synthesis of 3.5-di(3-ferrocenylureido)-1-benzoic Acid

(143) ##STR00007##

(144) To a purged round-bottom flask was charged ferrocene carbonyl azide (800 mg, 3.14 mmol, 2.5 equiv.), 3,5-diaminobenzoic acid (194 mg, 1.25 mmol, 1.00 equiv.) and 1,4-dioxane (60 ml) under nitrogen. The reaction mixture was stirred under nitrogen in a 100 C. bath for 1 hr and then allowed to cool to room temperature. Water (300 ml) and ethyl acetate (150 ml) were charged to the reaction mixture. To improve separation the aqueous phase was acidified with HCl. The ethyl acetate phase was washed with water (100 ml) and on standing solid began to precipitate. The solution was concentrated in vacuo to afford the crude product as an orange oil, which was dried with a toluene azeotrope (100 ml), to yield a light orange solid. The product was purified using silica flash chromatography using gradient system from DCM 90/MeOH 10 to DCM 50/MeOH 50. Drying in a vacuum oven yielded (19) as orange crystals (205 mg, 27%). .sup.1H-NMR (300 MHz, d6-DMSO) 3.95 (4H, b, Hc), 4.14 (10H, s, Ha), 4.54 (4H, b, Hb), 7.69 (2H, s, Hf), 7.81 (1H, s, Hg), 8.08 (2H, s, Hd), 8.94 (2H, s, He). MS (FAB+m/z) 607.07 [M+H]. CL EXAMPLE 7

Synthesis of 4-(3-ferrocenylureido)-1-benzoic Acid Oligonucleotides

(145) Lyophilised amino-modified oligonucleotide was rehydrated in the correct volume of K.sub.2CO.sub.3/KHCO.sub.3 buffer (500 mM, pH 9.0) to give an oligonucleotide concentration of 0.5 nmoll.sup.1. Amino-modified oligonucleotide (40 l, 0.5 nmoll.sup.1) was added slowly with vortexing to a solution of the ferrocene activated ester in DMSO (40 l, 375 mM). The solution was shaken at room temperature overnight, it was then diluted with ammonium acetate (920 l, 100 mM, pH 7.0) and purified using two NAP 10 columns (following the protocol supplied), eluting firstly with ammonium acetate (100 mM, pH 7.0), and then with autoclaved deionised water. Oligonucleotide concentration of the eluent was determined by measuring its absorbance at 260 nm. Presence of the ferrocene label was confirmed by voltammetric analysis.

EXAMPLE 8

S1 Nuclease and PCR with 4-(3-ferrocenylureido)-1-benzoic Acid Labelled Substrates/Probes

(146) By use of 4-(3-ferrocenylureido)-1-benzoic acid labelled substrates/probes and the voltammetry parameters as set out in table 2, Examples 4 and 5 were repeated with the concentrations of all reagents as described in those examples. The peak potential of the 4-(3-ferrocmylureido)-1-benzoic acid nucleotides is lower than that of the ferrocene labelled nucleotides. That increases the sensitivity with which the electrochemical marker can be detected. In the Example 8 experiments it was, accordingly, not necessary to carry out the sample concentration step used in Example 4 and 5 and the method protocol was significantly simplified. The results for Example 8 (not shown) demonstrate that good sensitivity is observed without the sample concentration step.

EXAMPLE 9

T7 Exonuclease Substrate Specificity

(147) 200 l of hairpin oligonucleotide and 200 l of single stranded oligonucleotide were added to separate reaction tubes at a concentration of 7 M in 1T7 reaction buffer. T7 enzyme was added to each tube (5 l, 2 Ul.sup.1) and the mixtures were incubated for 1 hour at 25 C. Both oligos were previously labelled with Ferrocene via a C12 linker.

(148) The results were as follows:

(149) FIG. 16A: Line Adigestion of hairpin oligonucleotide duplex.

(150) FIG. 16A: Line Bhairpin oligonucleotide duplex no enzyme control.

(151) FIG. 16B: Line Adigestion of single stranded oligonucleotide.

(152) FIG. 16B: Line Bsingle stranded oligonucleotide no enzyme control.

EXAMPLE 10

PCR Amplification with T7 Exonuclease Digestion

EXAMPLE 10(A)

(153) PCR Amplification with 5 Ferrocenylated Primer and T7 Exonuclease Digestion

(154) PCR amplification was performed from human genomic DNA (40 ng per 100 l reaction).

(155) Primers, template and probe used for individual reactions are detailed in the results section. 100 l reactions contained Tris Ha (15 mM, pH 8.0), potassium chloride (50 mM), magnesium chloride (3.5 mM), dATP, TTP, dCTP, dGTP (200 M each), 5 ferrocenylated forward primer (0.5 M), reverse primer (0.5 M), Amplitaq Gold DNA Polymerase (0.1 Ul.sup.1), BSA (0.1 mgl.sup.1). Samples were incubated at 95 C. for 10 minutes (initial denaturation and enzyme activation) followed by 40 cycles of denaturation at 95 C. for 15 s, and primer annealing and extension at 60 C. for 1 min. Samples were immediately cooled to 25 C. and incubated at 25 C. for 5 minutes. T7 exonuclease (5 l, 2 Ul.sup.1) was added to the crude PCR mix and samples incubated for a further 20 minutes.

(156) Two 100 l reactions were prepared and pooled prior to voltammetric analysis.

(157) The results were as follows:

(158) Forward primer: MWllw ferrocenylated via a C12 linker

(159) Reverse primer: MCllcom

(160) FIG. 17A: Line AMCAD PCR amplification positive PCR

(161) FIG. 17A: Line BMCAD PCR no Taq negative control

(162) FIG. 17B: Lines A and Bas FIG. 17A but with baseline corrected data

EXAMPLE 10(B)

(163) PCR Amplification with Unmodified Primers, End Point Probe Annealing and T7 Exonuclease Digestion

(164) PCR amplifications were performed as described above. On completion of the PCR, samples were heated to 95 C. for 2 minutes, during this time ferrocenylated oligonucleotide probe was added (0.5 M final concentration). Samples were cooled to 25 C. and incubated at 25 C. for 5 minutes. T7 exonuclease (5 l, 2 Ul.sup.1) was added to the crude PCR mix and samples incubated for a further 20 minutes.

(165) Two 100 l reactions were prepared and pooled prior to voltammetric analysis.

(166) The results were as follows:

(167) Beta Actin PCR Amplification

(168) Line A shows positive PCR target amplification reaction and line B shows non-target amplification control throughout

(169) Probe: BAPR ferrocenylated via a C12 linker

(170) Forward target amplification primer: BAF

(171) Reverse target amplification primer: BAR

(172) Forward non-target amplification primer: GSDF

(173) Reverse non-target amplification primer: GSDR

(174) FIG. 18A: normal data, anodic sweep

(175) FIG. 18B: baseline corrected data, anodic sweep

(176) HFE Gene PCR Amplification

(177) Line A shows positive PCR target amplification reaction and line B shows non-target amplification control throughout

(178) Probe: H63DP ferrocenylated via a C12 linker

(179) Forward target amplification primer: H63DF

(180) Reverse target amplification primer: H63DR

(181) Forward non-target amplification primer: C282YF

(182) Reverse non-target amplification primer: C282YR

(183) FIG. 19A: normal data, anodic sweep

(184) FIG. 19B: baseline corrected data, anodic sweep

(185) HFE Gene PCR C282Y Mutation Amplification

(186) Line A shows positive PCR target amplification reaction and line B shows non-target amplification control throughout

(187) Probe: C282YP ferrocenylated via a C12 linker

(188) Forward target amplification primer: C282YF

(189) Reverse target amplification primer: C282YR

(190) Forward non-target amplification primer: H63DF

(191) Reverse non-target amplification primer: H63DR

(192) FIG. 20A: normal data, anodic sweep

(193) FIG. 20B: baseline corrected data, anodic sweep

EXAMPLE 10(C)

(194) PCR amplification with unmodified primers, end point probe annealing and T7 exonuclease digestion: Stoffel Fragment.

(195) PCR, probe annealing and T7 exonuclease digestion was performed as described in the above section, substituting Amplitaq Gold DNA Polymerase and supplied buffer with Amplitaq DNA Polymerase Stoffel Fragment and supplied buffer.

(196) The results were as follows:

(197) HFE Gene PCR Amplification

(198) Line A shows positive PCR target amplification reaction and line B shows non-target amplification control throughout

(199) Probe: C282YP ferrocenylated via a C12 linker

(200) Forward target amplification primer: C282YF

(201) Reverse target amplification primer: C282YR

(202) Forward non-target amplification primer: H63DF

(203) Reverse non-target amplification primer: H63DR

(204) FIG. 21A: normal data, anodic sweep

(205) FIG. 21B: baseline corrected data, anodic sweep

EXAMPLE 10(D)

(206) PCR amplification with unmodified primers, end point probe annealing and T7 exonuclease digestion: No T7 exonuclease control.

(207) PCR and probe annealing was performed as described in example 9c, using Amplitaq Gold DNA polymerase. No T7 exonuclease was added to the PCR mix.

(208) The results were as follows:

(209) HFE Gene PCR Amplification

(210) Line A shows positive PCR target amplification reaction and line B shows non-target amplification control throughout

(211) Probe: C282YP ferrocenylated via a C12 linker

(212) Forward target amplification primer: C282YF

(213) Reverse target amplification primer: C282YR

(214) Forward non-target amplification primer: H63DF

(215) Reverse non-target amplification primer: H63DR

(216) FIG. 22A: normal data, anodic sweep

(217) FIG. 22B: baseline corrected data, anodic sweep

EXAMPLE 11

Differential Pulse Voltammogram Analysis of Ferrocene Carboxylic Acid and 4-(3-ferrocenylureido)-1-benzoic Acid

(218) Solutions of ferrocene carboxylic acid and 4-(3-ferrocenylureido)-1-benzoic acid were prepared at 10 M and 1 M concentration in 100 mM aqueous sodium chloride with 10% DMSO. 200 l sample volumes were used for differential pulse analysis in an apparatus as described in Example 1 with a gold working electrode. The differential pulse conditions were as in Table 3. FIGS. 23A and 23B show the voltammograms for ferrocene carboxylic acid at 10 M and 1 M respectively, and

(219) FIGS. 23C and 23D show the voltammograms for 4-(3-ferrocenylureido)-1-benzoic acid at 10 M and 1 M respectively.

EXAMPLE 12

Differential Pulse Voltammogram Analysis of S1 Nuclease Digestion of a Mixture of Ferrocenylated Oligonucleotides

(220) Three oligonucleotide digestion reactions were carried out as detailed above in Example 4.

(221) In reaction (a) the substrates were BAPR oligonucleotide labelled at the 5 end by ferrocene with a 12 carbon spacer moiety (2.5 M) and MCllw oligonucleotide labelled at the 5 end by 4-(3-ferrocenylureido)-1-benzoic acid with a 12 carbon spacer moiety (1.5 M). In reaction (b), the substrate was BAPR oligonucleotide labelled at the 5 end by ferrocene with a 12 carbon spacer moiety only (2.5 M). In reaction (c), the substrate was MC11w oligonucleotide labelled at the 5 end by 4-(3-ferrocenulureido)-1-benzoic acid with a 12 carbon spacer moiety only (1.5 M).

(222) After completion of each digestion reaction, the reaction mixtures were analysed by differential pulse voltammetry under the conditions detailed in table 3, except that the end potential was 0.5V. A gold working electrode was used. The voltammograms are presented in FIGS. 24A, 24B, and 24C, respectively. Data is presented with baseline correction. As is seen in the figures, the 4-(3-ferrocenylureido)-1-benzoic acid label has a peak in the differential pulse voltammogram at around 130 mV whilst the ferrocene label has a peak at around 370 mV. The peaks are sufficiently far apart to be resolvable in a mixture as seen in FIG. 24A. The resolvability of the two peaks makes the two labels suitable for use in a multiplex experiment in which two different target sequences are simultaneously probed in the same reaction mixture.