METHOD FOR DIAGNOSING DISEASES USING MULTIPLEX FLUORESCENCE AND SEQUENCING

Abstract

The present invention relates to methods for diagnosing a disease by determining via multiplex fluorescence in situ hybridization (FISH) whether or not mRNA species and/or at least one miRNA species of disease-associated biomarkers ar present in a sample obtained from a subject, and by determining by multiplex sequencing whether or not said mRNA species of disease-associated biomarkers and/or said miRNA species of disease-associated biomarkers of step (a) are present in said sample. The present invention also relates to kits for performing the methods for diagnosis as described and provided herein as well as use of such kits for performing the methods for diagnosis as described and provided herein.

Claims

1. A method for diagnosing a disease, said method comprising: (a) determining by multiplex fluorescence in situ hybridization (FISH) whether or not mRNA species and/or at least one miRNA species of disease-associated biomarkers are present in a sample obtained from a subject; and (b) determining by multiplex sequencing whether or not said mRNA species of disease-associated biomarkers and/or said miRNA species of disease-associated biomarkers in step(a) are present in said sample wherein that part of said sample in which said mRNA species and/or at least one miRNA species of disease-associated biomarkers was determined in step(a) to be present is subject to laser capturing prior to performing step(b).

2. The method of claim 1, wherein step(a) further comprises determining by multiplex FISH whether or not snRNA species and/or scRNA species of disease-associated biomarkers are present in said sample.

3. The method of any one of the preceding claims, wherein step(b) further comprises determining by multiplex sequencing whether or not snRNA and/or scRNA species of disease-associated biomarkers are present in said sample.

4. The method of any one of the preceding claims, wherein the presence of said disease-associated biomarkers in step(a) and step(b) is indicative of said disease.

5. The method of any one of the preceding claims, wherein said method allows the diagnosis of a disease on the presence or absence of said disease-associated biomarkers.

6. The method of any one of the preceding claims, wherein said disease is cancer.

7. The method of claim 6, wherein said cancer is breast cancer.

8. The method of any one of the preceding claims, wherein said mRNA is selected from the group consisting of HER2, ER, PR, NUPR1, CSF1, GRB7, Ki-67, STK15, Survivin, Cyclin B1, MYBL2, ER, PR, Bcl2, SCUBE2, Stromelysin 3, Cathepsin L2, GSTM1, BAG1, and CD68.

9. The method of any of the preceding claims, wherein said miRNA is selected from the group consisting of miR-21, miR-29a, miR-221, and miR-375.

10. The method of any one of the preceding claims, wherein said snRNA is U2 snRNA.

11. The method of any one of the preceding claims, wherein said scRNA is 7SL scRNA.

12. The method of any one of the preceding claims, wherein additionally one or more RNAs selected from the group consisting of 28S rRNA, poly(A) RNA, Beta-actin, GAPDH, RPLPO, GUS, TFRC are determined by FISH as control.

13. The method of any one of the preceding claims, wherein said laser capturing is laser capture microdissection.

14. The method of any one of the preceding claims, wherein said sample is a tissue section sample.

15. The method of any one of the preceding claims, wherein said sample is formaldehyde-fixed.

16. The method of any one of the preceding claims, wherein said sample is paraffin embedded.

17. The method of any one of the preceding claims, wherein said sample is obtained by microtome sectioning of a paraffin embedded sample.

18. The method of claim 17, wherein said sample obtained by microtome sectioning is after obtainment incubated at a temperature between 25° C. to 0° C.

19. The method of any one of the preceding claims, wherein said paraffin embedded sample is deparaffinized prior to step(a).

20. The method of any one of the preceding claims, wherein said sample is fixed prior to step(a).

21. The method of claim 20, wherein said sample is fixed by treatment with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) or 5-ethylthio-1H-tetrazole (ETT).

22. The method of any one of the preceding claims, wherein fluorescence signals are detected by microscopy when multiplex FISH is performed.

23. The method of any one of the preceding claims, wherein for fluorescence in situ hybridization (FISH) of RNA probes are used which are conjugated by click chemistry.

24. The method of any one of the preceding claims, wherein said sample is stained with hematoxylin and eosin after FISH of RNA was performed.

25. The method of any one of the preceding claims, wherein RNA is extracted from said sample when multiplex sequencing of RNA is performed.

26. The method of any one of the preceding claims, wherein prior to performing step(a) and/or step(b) of said method, said sample is checked for the ratio between polyA mRNA and 28S rRNA.

27. The method of any one of the preceding claims, wherein prior to performing step(a) and/or step(b) of said method, said sample is checked whether the ratio between polyA mRNA and 28S rRNA is 1:1 or greater than 1:1, preferably 1.05:1, 1.1:1, 1.15:1, 1.2:1.

28. The method of any one of the preceding claims, wherein for multiplex sequencing of RNA a cDNA library is prepared by using 3′adapter molecules comprising a barcode.

29. The method of claim 28, wherein said 3′-adapter molecules comprising a barcode are preadenylated.

30. The method of claim 28 or 29, wherein said 3′-adapter molecules comprising a barcode are a collection.

31. The method of any one of claims 28 to 30, wherein said 3′-adapter molecules comprising a barcode are pooled.

32. A kit for performing the method of any one of the preceding claims.

33. The kit of claim 32, comprising glass slides, preferably positively charged glass slides, frame slides, frame slides with PET membrane, or glass slides with membrane.

34. The kit of claim 32 or 33, comprising formaldehyde and/or paraffin,

35. The kit of any one of claims 32 to 34, comprising probes for fluorescence in situ hybridization of RNA and/or 3-adapter molecules comprising a barcode for preparing a cDNA library from RNA.

36. The kit of claim 35, wherein said 3-adapter molecules comprising a barcode are preadenylated.

37. The kit of claim 35 or 36, wherein said 3-adapter molecules comprising a barcode are a collection.

38. The kit of any one of claims 35 to 37, wherein said 3-adapter molecules comprising a barcode are unpooled.

39. The kit of any one of claims 32 to 38, comprising EDC or ETT.

40. The kit of any one of claims 32 to 39, comprising hematoxylin and/or eosin.

41. The kit of any one of claims 35 to 40, wherein said probes for FISH of RNA are specific for HER2, ER, PR, NUPR1, CSF1, GRB7, Ki-67, STK15, Survivin, Cyclin B1, MYBL2, ER, PR, Bcl2, SCUBE2, Stromelysin 3, Cathepsin L2, GSTM1, BAG1, and CD68.

42. The kit of any one of claims 35 to 41, wherein said probes for FISH of RNA are specific for miR-21, miR-29a, miR-221, and miR-375.

43. The kit of any one of claims 35 to 42, wherein said probes for FISH of RNA are specific for U2 snRNA.

44. The kit of any one of claims 35 to 43, wherein said probes for FISH of RNA are specific for 7SL scRNA.

45. The kit of any one of claims 35 to 44, wherein said probes for FISH of RNA are specific for 28S rRNA, poly(A) RNA, Beta-actin, GAPDH, RPLPO, GUS, TFRC as control.

46. The kit of any one of claims 32 to 45, comprising siliconized nuclease-free containers.

47. Use of a kit of any one of claims 32 to 46 for performing the methods of any one claim 1 to 31.

Description

[0085] The Figures show:

[0086] FIG. 1 Differentiating FFPE breast cancer cell lines using RNA FISH and shorter DNA probes. 45 DNA (24 to 30-nt), 39 DNA (14 to 21-nt) or 53 (11 to 15-nt) LNA/DNA probes conjugated to ATTO-550 were used to differentiate HER2 positive (HCC-1954) and HER2-negative (MDA-MB231) breast cancer cell lines, stained and visualized in parallel. Five rRNA probes were conjugated to ATTO-488. Probes were hybridized using 25% Formamide and 1M NaCl at 40° C. HCC-1954 cell line could not be distinguished from MDA-MB231 due to rRNA mishybridization of DNA probes. However, LNA/DNA probes finally discriminate between HER2+ and HER2− cells, indicating these probes being specific. Exposure times for rRNA and HER2 were 80 ms and 200 ms, respectively. Scale bar, 50 μm.

[0087] FIG. 2 in situ click labeling. Exemplary set-up. Two short fluorophore-labeled neighbouring probes are tagged with azide and alkyne and fuse together by click chemistry. Following stringent wash, mishybridized probes are removed. T.sub.M was measured for each ca. 15-nt long LNA/DNA probe (in duplex with RNA). Both T.sub.Ms were similar, −50° C. in phosphate buffer containing 50% formamide/1M NaCl.

[0088] FIG. 3 RNA FISH of 6 ncRNAs, poly(A) RNA and DAPI nuclear DNA staining. RNA FISH was performed using the HCC-1954 cell line. We used 12 to 17 nt long LNA-modified DNA probes targeting U2 snRNA, 7SL small cytoplasmic (sc)RNA, U1 snRNA, mt-RNA, rRNA, U3 snoRNA and poly(T) probes targeting poly(A) conjugated to ATTO-488, ATTO-532, ATTO-Rho12, ATTO-Rho 14, ATTO-647N, ATTO-680 and ATTO-550, respectively. The cells were scanned using Vectra Intelligent Slide Analysis System (PerkinElmer).

[0089] FIG. 4 The MultiplexDX (MDX) method of sample processing in comparison to traditional (prior art) method of sample processing. The method of the present invention prevents diffusion of small RNA (e.g., microRNA) out of the cell, ensuring high concentrations of small RNA. Mouse brain tissue sections (10 μm) were obtained using a microtome from either formalin-fixed, flash-frozen (FFFF) tissues processed immediately (0 seconds, baseline control) or formalin-fixed, paraffin-embedded (FFPE) tissues processed after 5, 60, 180, and 600 seconds (s). Only the MDX paraffin ribbon was briefly placed in an ice-cold water bath, then a 42° C. water bath before being positioned on a glass slide after either 5 s (MDX method, data point enclosed in shaded box) or 60, 180, and 600 s (Other methods). Note that paraffin ribbons processed pursuant to traditional (prior art) methods were not placed in an ice-cold water bath after having been obtained from microtome sectioning. The tissue was deparaffinized, dried, and then microRNA was extracted using the Ambion® PureLink® miRNA Isolation Kit and the concentration of microRNA was measured using NanoDrop.

[0090] FIG. 5 Effects of RNA degradation. Effects of RNA degradation on the ratio of PolyA mRNA/28S rRNA (A) and on mean fluorescent intensity of PolyA mRNA expression (B) following incubation of rat liver tissue for 0, 1, 3, 6, and 12 hours at either room temperature (25° C.) or elevated temperature (37° C.). A, The ratio (fluorescence activity/units) of PolyA mRNA/28S rRNA can be used to assess RNA degradation in formalin-fixed paraffin-embedded (FFPE) tissues, with ratios below 1 signifying degraded RNA (as a perhaps ideal ratio 1.15 is marked as dotted line). B, Confocal photomicrographs of PolyA mRNA expression showing a reduction in fluorescent intensity across timepoints.

[0091] FIG. 6 Laser capture microdissection (LMD) reduces bias introduced by sampling heterogeneous tissues and ensures concordance between RNA fluorescent in situ hybridization (FISH, A) and RNA sequencing (B). A, RNA FISH reveals Her2 amplification in breast cancer biopsy tissue in patient A (left panel), but not patient B (right panel). B, Laser capture microdissection of Her2+ cell populations (approximately 100 cells shown in square inset) followed by RNA sequencing shows high concordance with Her2 expression assessed by RNA FISH. C, Whole tissue sampling followed by RNA sequencing demonstrates low concordance with RNA FISH due to sampling from heterogeneous cell populations. This could lead to inaccurate diagnosis of patient A's Her2 status and consequently inappropriate or ineffective treatment.

[0092] FIG. 7 Barcoded pre-adenylated 3′-adapters reduce ligation (A) and technical (B) biases in small RNA sequencing. A, Violin plots illustrating the density estimates of small RNA sequencing libraries prepared using the miRXplore Universal Reference containing an equimolar pool of 962 unique microRNA sequences. The libraries were generated using standard competitor-I 3′-adapters (sample I-1-I-3), pooled MDX barcoded pre-adenylated 3′-adapters (MDX-4a-c) or unpooled MDX barcoded pre-adenylated 3′-adapters (MDX-7-MDX-9). MDX 3′-adapters, compared to competitor I 3′-adapters, reduce ligation bias as shown by density estimates that are closer to the expected read counts (denoted as dotted line at 0). B, Box-and-whisker plots demonstrate that pooling of MDX barcoded pre-adenylated 3′-adapters reduces technical biases observed in miR-21, miR-29a, miR-221, and miR-375 when using unpooled MDX barcoded pre-adenylated 3′-adapters. Note that pooled MDX barcoded pre-adenylated 3′-adapters are shown left, while unpooled MDX barcoded pre-adenylated 3′-adapters are shown right.

[0093] The following Sequences are provided herein:

TABLE-US-00003 SEQ ID NO: 1 Mus musculus (mmu) RNA GGAAAAGAAACTAACCAGGA SEQ ID NO: 2 Mus musculus (mmu) RNA ATCAGACCCCAGAAAAG SEQ ID NO: 3 Mus musculus (mmu) RNA CTAAGGAGTGTGTAACAACT SEQ ID NO: 4 Mus musculus (mmu) RNA CTGAAAATGGATGGCGCTG SEQ ID NO: 5 Mus musculus (mmu) RNA CGGAACGGGACGGGA SEQ ID NO: 6 Mus musculus (mmu) RNA AGTCGGTCCTGAGAGATG SEQ ID NO: 7 Mus musculus (mmu) RNA GGAGCAGAAGGGCAAA SEQ ID NO: 8 Mus musculus (mmu) RNA TCAGTACGAGAGGAACC SEQ ID NO: 9 artificial LNA LNA residues are indicated in lowercase letters TCcTGGtTAgTTtCTtTTCC SEQ ID NO: 10 artificial LNA LNA residues are indicated in lowercase letters CtttTCtGggGTcTGaT SEQ ID NO: 11 artificial LNA LNA residues are indicated in lowercase letters AGTtGTtACACAcTCcTtaG SEQ ID NO: 12 artificial LNA LNA residues are indicated in lowercase letters CAGcGCcATcCAtTTtCAG SEQ ID NO: 13 artificial LNA LNA residues are indicated in lowercase letters TCCcGTcCCgTTCCG SEQ ID NO: 14 artificial LNA LNA residues are indicated in lowercase letters CATCTcTcAGGAcCgAcT SEQ ID NO: 15 artificial LNA LNA residues are indicated in lowercase letters TtTGCCcTTCTGCtCc SEQ ID NO: 16 artificial LNA LNA residues are indicated in lowercase letters GGTtCctCtCGtACTgA

[0094] The present invention may also be characterized by the following items: [0095] 1. A method for diagnosing a disease, said method comprising: [0096] (a) determining by multiplex fluorescence in situ hybridization (FISH) whether or not mRNA species and/or at least three miRNA species of disease-associated biomarkers are present in a sample obtained from a subject; and [0097] (b) determining by multiplex sequencing whether or not said mRNA species of disease-associated biomarkers and/or said miRNA species of disease-associated biomarkers of step(a) are present in said sample. [0098] 2. The method of item 1, wherein step(a) further comprises determining by multiplex FISH whether or not snRNA species and/or scRNA species of disease-associated biomarkers are present in said sample. [0099] 3. The method of any one of the preceding items, wherein step(b) further comprises determining by multiplex sequencing whether or not snRNA and/or scRNA species of disease-associated biomarkers are present in said sample. [0100] 4. The method of any one of the preceding items, wherein the presence of said disease-associated biomarkers in step(a) and step(b) is indicative of said disease. [0101] 5. The method of any one of the preceding items, wherein said method allows the diagnosis of a disease on the presence or absence of said disease-associated biomarkers. [0102] 6. The method of any one of the preceding items, wherein said disease is cancer. [0103] 7. The method of item 6, wherein said cancer is breast cancer. [0104] 8. The method of any one of the preceding items, wherein said mRNA is selected from the group consisting of HER2, ER, PR, NUPR1, CSF1, GRB7, Ki-67, STK15, Survivin, Cyclin B1, MYBL2, ER, PR, Bcl2, SCUBE2, Stromelysin 3, Cathepsin L2, GSTM1, BAG1, and CD68. [0105] 9. The method of any of the preceding items, wherein said miRNA is selected from the group consisting of miR-21, miR-29a, miR-221, and miR-375. [0106] 10. The method of any one of the preceding items, wherein said snRNA is U2 snRNA. [0107] 11. The method of any one of the preceding items, wherein said scRNA is 7SL scRNA. [0108] 12. The method of any one of the preceding items, wherein additionally one or more RNAs selected from the group consisting of 28S rRNA, poly(A) RNA, Beta-actin, GAPDH, RPLPO, GUS, TFRC are determined by FISH as control. [0109] 13. A kit for performing the method of any one of the preceding items. [0110] 14. Use of a kit of item 13 for performing the methods of any one item 1 to 12.

[0111] The invention is further illustrated by the following examples, however, without being limited to the example or by any specific embodiment of the examples.

EXAMPLES

Test of Probe Design

[0112] To test an RNA FISH probe design and compare to other commercially available design, two breast cancer cell lines were used, HER2+(HCT1954) and HER2− (MDA-MB231). Stellaris probe design program (Biosearch Technologies) was used to prepare ERBB2 mRNA probes. Instead of 20-nt long probes, forty five 24 to 30-nt long DNA probes were designed to increase binding affinity, length of the probes varied to equalize T.sub.Ms (resulting T.sub.Ms varied between 48.1 and 56.9° C. in 50% Formamide (FA), 1 M NaCl, 50 mM phosphate (pH 7.0)). The GC content was limited between 50 to 64% as suggested by Stellaris. In subsequent RNA FISH, rRNA probes were also used as an internal control and standard for signal specificity and RNA content. Subsequently, DNA probes (24 to 30-nt long) were shortened either from 5′-end or 3′-end to avoid rRNA mishybridization (no segment longer than 8 nt with rRNA sequence complementarity) to yield 39 shorter DNA probes (14 to 21-nt long). Melting temperatures of these DNA probes varied from 38.8 to 47.1° C. While small discrimination between HER2+ and HER2− breast cancer cell was observed, rRNA mishybridization was still predominant. To avoid mishybridization and increase probe specificity, 53 short (11- to 15-nt long) directly labeled LNA-modified DNA (LNA/DNA) oligonucleotide probes were synthesized for ERBB2 mRNA with no longer than 6-nt sequence segment that cross-hybridize to the most abundant RNAs (rRNAs, tRNAs, snRNAs, mitochondrial rRNAs, etc.) using the RNA FISH probe design as described herein. Melting temperatures of these LNA/DNA probes varied from 44.2 to 52.1° C. These LNA/DNA probes were finally shown to be specific and distinguished HCC-1954 (HER2+) from MDA-MB231 (HER2-) breast cancer cells (cf. FIG. 1). Moreover, when comparing signal intensities of 100 cells from mRNA FISH and copy numbers of ERRB2 transcript from mRNA deep sequencing of those two HER2+ and HER2− cell line, the difference from mRNA FISH was 51-fold compared to 49-fold difference from mRNA sequencing. This indicates that very high specificity was achieved.

RNA Fish:

[0113] NOTE 1: Proteinase K permeabilization, 4% PFA fixation, acetylation and blocking endogenous biotin steps may be omitted.

[0114] NOTE 2: If FFFF (formaldehyde-fixed, fresh-frozen) tissues are used, after thawing and air-drying, incubate slides in 50 ml of 1-Methylimidazole buffer (pH 8.0) for 2 min at 25° C. and immediately start EDC fixation proceeding to step 14.

Microtome Sectioning

[0115] 1 Paraffin blocks were trimmed to an optimal cuffing surface including the sample. [0116] 2 5 μm slices were cut; a brush was used to draw the section onto the knife holder. [0117] 3 Paraffin ribbon or section (slice) was placed in ice-cold water bath with a 2nd wet brush (it may expand, and wrinkles will vanish). [0118] 4 Swimming paraffin section was fished out using a glass slide, the paraffin ribbon was placed in a 42° C. water bath until it expanded and wrinkles vanished and then the paraffin section was fished out with a 2nd wet brush to position the section. NOTE: Using higher temperature of water bath than 42° C., can cause diffusion of especially short RNAs from the tissue due to paraffin melting. [0119] 5 Sections were dried at room temperature for at least 1 h until the glass slides were completely dry and water trapped between the tissue and glass slide has evaporated. [0120] 6 Sections were baked at 56° C. for 1 h.

Deparaffinization

[0121] 7 Slides were incubated in 50 ml of Histo-Clear II twice for 5 min at 25° C. [0122] 8 Slides were incubated in 50 ml 100% ethanol for 2 min at 25° C. [0123] 9 Slides were incubated in 50 ml of 95% ethanol twice for 1 min at 25° C. [0124] 10 Slides were incubated in 50 ml of 70% ethanol for 1 min at 25° C. [0125] 11 Slides were incubated in 50 ml of 50% ethanol for 1 min at 25° C. [0126] 12 Slides were held in the Coplin jar under running cold tap water to rinse.
Fixation of Tissues with EDC/5-ETT

[0127] NOTE 3: EDC fixation can be omitted when long RNAs (mRNAs and rRNAs) are targeted, but one must be sure that the tissue used was well preserved and does not contain high levels of hydrolyzed RNA.

[0128] NOTE 4: For targeting tRNAs containing 5′-phosphate, EDC fixation would be advantageous. [0129] 13 Slides were incubated in 50 ml of 1-Methylimidazole buffer (pH 8.0) for 2 min at 25° C. This step was to remove residual 1×TBS buffer. [0130] 14 Fresh EDC/5-ETT solution was made prior to use. [0131] 15 In a humidified chamber, slides were placed face up in a slide rack. 1-Methylimidazole buffer (pH 8.0) was removed by tilting the slide and decanting the solution. In a humidified chamber, slides were placed face up in a slide rack. [0132] 16 500 μl of EDC/5-ETT solution was added to each slide and samples were incubated for 3 h at 50° C. in a sealed humidified chamber.
Wash Steps after Fixation [0133] 17 The samples were washed twice with 50 ml of 1×TBS for 3 min at 25° C.

Pre-Hybridization and Hybridization of Probe and RNA

[0134] 18 Slides were placed with the tissue side up on a slide rack in a humidified chamber. [0135] 19 500 μl of freshly prepared hybridization buffer was added to each slide within the hydrophobic barrier. Tissue was fully covered. Slides were incubated in a sealed humidified chamber for 1 h at 25° C. [0136] 20 Hybridization buffer was removed by tilting the slide and decanting the solution.

Preparing the Probe and Hybridization

[0137] 21 The desired probes were selected and ovens pre-heated to the appropriate hybridization temperature—approximately 20° C. below the T.sub.M. [0138] 22 500 μl hybridization solution containing probes was added to each slide. Concentration of mRNA probes: 4 nM, abundant ncRNA: 10 nM, rRNA probes: 20 nM. [0139] 23 Slides were incubated in a sealed humidified chamber for 6 to 16 h at the hybridization temperature (37-50° C.).

Post-Hybridization Washes

[0140] 24 Samples were washed two times in a glass Coplin jar filled with 50 ml of Wash buffer 1 for 5-10 min at 25° C. NOTE: When hybridization buffer (50% FA) is used, use Wash buffer 1 (50% FA), but when hybridization buffer (25% FA) is used, use Wash buffer 1 (25% FA). [0141] 25 Samples were washed in 50 ml of Wash buffer 2 for 5 min at 25° C. [0142] 26 Samples were rinsed in 50 ml of 1×TBS-T buffer for 3 min at 25° C.

In Situ Click Chemistry Cross-Linking

[0143] 27 In an Eppendorf tube (for one slide), a solution of 63 μl of 20 mM CuSO.sub.4 and 125 μl of 50 mM ligand THPTA was prepared. The final concentration of copper in the tube was 0.25 mM and the final concentration of ligand 1 in the tube was 1.25 mM (ligand to copper ratio, 5:1). [0144] 28 250 μl of 100 mM sodium ascorbate was added. The final concentration of sodium ascorbate in the tube was 5 mM. [0145] 29 The tube was closed and mixed by inverting the tube several times (to prevent more oxygen from diffusing in). [0146] 30 400 μl of freshly prepared CuSO.sub.4/THPTA/sodium ascorbate solution was added to each slide. [0147] 31 Slides were incubated in a sealed humidified chamber avoiding light for 1 to 2 h at room temperature. [0148] 32 Samples were washed twice with 50 ml of 1×TBS-T for 3 min at 25° C.

Stringency Wash, if Desired

[0149] 32a 1 ml wash buffer was added to each slide. Slides were incubated for 5-10 min at 40-50° C. (or 0-10° C. above previous hybridization temperature) in a sealed humidified chamber. Note: When hybridization buffer (50% FA) is used, use Wash buffer 1 (50% FA), but when hybridization buffer (25% FA) is used, use Wash buffer 1 (25% FA). [0150] 32b Samples were washed in 50 ml of wash buffer 2 for 5 min at 25° C. [0151] 32c Samples were rinsed in 50 ml of 1×TBS-T buffer for 3 min at 25° C.

Mounting Slides for Microscopy

[0152] 33 Slides were placed horizontally, face up in a humidified slide rack and 500 μl of DAPI working solution was added to each slide for 10 min at 25° C. [0153] 34 Slides were washed two times in 50 ml of 1×TBS for 3 min at 25° C. [0154] 35 Slides were placed horizontally, face up in a humidified slide rack and 2 drops of mounting solution was added on the tissue section. [0155] 36 A glass coverslip was carefully placed over the tissue sections. [0156] 37 Cover slipped slides were air dried for 10 min. [0157] 38 Cover slipped slides were stored in a dark slide rack.

Fluorescence Slide Imaging

[0158] 39 For use of Perkin Elmer Vectra 3.0 Quantitative Pathology Imaging System including slide scanning, RNA visualization, RNA biomarker quantification, spectral imaging, de-mixing, multiplexed visualization, whole-slide scanning, image analysis, etc., see User's Manual: https://www.perkinelmer.com/Content/LST_Software_DownloadsNectra-User-Manual-3-0-3.pdf

Laser Capture Microdissection: Tissue Microdissectioning and RNA Extraction

[0159] 40 5-μm tissue sections previously stained and visualized by RNA FISH were stained with hematoxylin and eosin (H&E) for further pathological review. [0160] 41 Tissue part (region) of interest was identified by microscopy and comparing RNA FISH and H&E images, circled by imaging software, and these H&E slides were then laser microdissected by Leica LMD7 (see https://www.leica-microsystems.com/applicationslife-sciencelaser-microdissection/). [0161] 42 Five to ten 5-μm sections were microdissected prior to RNA extraction in siliconized nuclease-free Eppendorf tube. [0162] 43 RNA extraction was performed on matched case-control specimens, the same day as tissue microdissection, to prevent tissue desiccation, RNA damage and technical differences. [0163] 44 500 μl of TRIzol@ Reagent was added to Eppendorf tube containing tissue pieces, and tissues were homogenized by pipetting up and down and tissues were incubated for 5 min at room temperature. [0164] 45 200 μl of chloroform was added, shaken vigorously (vortexing) for 15 seconds and the sample incubated at room temperature for 3 min. [0165] 46 The sample was centrifuged at 11,500 rpm (12,568×g) for 10 min at 4° C. using Sorvall fresco centrifuge. [0166] 47 After separation of the phases, the clear upper aqueous phase containing RNA was collected without disturbing the cloudy interphase or lower colored layer. pH of aqueous phase was set acidic (about 4) [0167] 48 The aqueous phase was transferred and divided into two fresh tubes, each containing approximately 500 μl of the lysate. [0168] 49 500 μl of ice-cold isopropyl alcohol was added to each of the tubes and incubated on ice for 30 min and centrifuged the samples at 11,500 rpm (12,568×g) for 10 min at 4° C. [0169] 50 The supernatant was removed. Then the tube was placed again into centrifuge in the same orientation, spun for another 10 s and the remaining liquid collected. For small pellets, washing of the pellet was not necessary. [0170] 51 For larger pellets, 500 μl of ice-cold 75% EtOH solution was added, the tube was inverted once without disturbing pellet, centrifuged to collect liquid at 11,500 rpm (12,568×g) for 10 min at 4° C.), liquid removed, and centrifuged again to remove residual liquid. [0171] 52 The supernatant was removed completely (i.e. use second 10 s spin). RNA samples were re-dissolved in 100 μl of Millipore water and the volumes recombined. [0172] 53 The RNA was quantified on a total RNA chip on a Bioanalyzer (Agilent, Danbury, Conn., USA).

RNA Sequencing:

[0173] 54 RNA sequencing of extracted RNA from microdissected tissue (1-2 μg) was performed using the Illumina TrueSeq cDNA library preparation protocol: https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/samplepreps_truseq/tru seqma/truseq-ma-sample-prep-v2-guide-15026495-f.pdf