FAD-CONJUGATED GLUCOSE DEHYDROGENASE GENE

20170226486 ยท 2017-08-10

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the present invention is to provide: a novel gene (polynucleotide) encoding an FAD-conjugated glucose dehydrogenase having excellent properties that it has excellent reactivity to glucose, excellent thermal stability, and excellent substrate-recognition performance and also has a low activity for maltose; a process for the production of the enzyme using a transformant cell transfected with the gene; and a method for the determination of glucose, a reagent composition for use in the determination of glucose, a biosensor for use in the determination of glucose and others, each characterized by using the enzyme obtained. The invention relates to a polynucleotide encoding an FAD-conjugated glucose dehydrogenase, comprising a polypeptide containing an amino acid sequence: X1-X2-X3-X4-X5-X6 (wherein X1 and X2 independently represent an aliphatic amino acid residue; X3 and X6 independently represent a branched amino acid residue; and X4 and X5 independently represent a heterocyclic amino acid residue or an aromatic amino acid residue); and others.

Claims

1-24. (canceled)

25. A biosensor comprising a recombinant FAD-conjugated glucose dehydrogenase, wherein the recombinant FAD-conjugated glucose dehydrogenase is selected from: (a) a polypeptide which comprises the amino acid sequence represented by SEQ ID NO: 1; and (b) a polypeptide which comprises an amino acid sequence having a homology of 90% or more to the amino acid sequence (a) and has an FAD-conjugated glucose dehydrogenase activity; wherein the recombinant FAD-conjugated glucose dehydrogenase has a value of enzymatic activity for maltose of 10% or less with a value of enzymatic activity for D-glucose taken as 100%; and wherein the biosensor is capable of detecting glucose.

26. The biosensor of claim 25, wherein the biosensor comprises a reaction layer comprising the recombinant FAD-conjugated glucose dehydrogenase.

27. The biosensor of claim 26, wherein the reaction layer further comprises a hydrophilic polymer and an electron acceptor.

28. The biosensor of claim 27, wherein the electron receptor is an osmium compound, a quinone compound or a ferricyan compound.

29. The biosensor of claim 27, wherein the reaction layer is in contact with an electrode system comprising a working electrode, a counter electrode, and a reference electrode, each on an insulating base plate.

30. The biosensor of claim 25, which is capable of detecting glucose by detection of an oxidation current.

31. The biosensor of claim 25, which is capable of detecting glucose by a change in color intensity.

32. The biosensor of claim 25, which is capable of detecting glucose by a pH change.

33. The biosensor of claim 25, wherein the recombinant FAD-conjugated glucose dehydrogenase has a value of enzymatic activity for maltose of 5% or less with a value of enzymatic activity for D-glucose taken as 100%.

34. The biosensor of claim 33, wherein the recombinant FAD-conjugated glucose dehydrogenase has a value of enzymatic activity for maltose of 3% or less with a value of enzymatic activity for D-glucose taken as 100%.

35. A method of making a biosensor of claim 29, comprising: forming the electrode system comprising the working electrode, the counter electrode, and the reference electrode, each on the insulating base plate, and forming the reaction layer on the electrode system comprising the hydrophilic polymer, the recombinant FAD-conjugated glucose dehydrogenase, and the electron receptor.

36. The method of making a biosensor of claim 35, wherein the electron receptor is an osmium compound, a quinone compound or a ferricyan compound.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0042] FIG. 1 shows a calibration curve of glucose concentration using an enzyme-immobilized electrode.

[0043] FIG. 2 shows the detection results of a target gene by PCR. The symbols in the drawing are as follows. M: 200 bp DNA ladder marker (manufactured by Takara Bio Inc.); 1: Aspergillus oryzae NBRC4268; 2: Aspergillus oryzae NBRC 5375; 3: Aspergillus oryzae NBRC6215; 4: Aspergillus oryzae NBRC 4181; 5: Aspergillus oryzae NBRC 4220; 6: Aspergillus oryzae NBRC 100959

[0044] FIG. 3 shows the detection results of a target gene by Southern hybridization. The symbols in the drawing are the same as in FIG. 2.

BEST MODE FOR CARRYING OUT THE INVENTION

[0045] It is one of the technically important points that an amino acid sequence: X1-X2-X3-X4-X5-X6 (wherein X1 and X2 represent the same or a different aliphatic amino acid residue; X3 and X6 represent the same or a different branched amino acid residue; and X4 and X5 represent the same or a different heterocyclic amino acid residue or aromatic amino acid residue), in other words, a polypeptide comprising 6 amino acid residues is contained in the FAD-conjugated glucose dehydrogenase of the invention. According to this configuration, the enzyme is significantly expressed in microbial cells. Incidentally, the expressed enzyme is not necessarily secreted to the outside of microbial cells, and remains in microbial cells in some cases. In contrast, as specifically shown in Examples of this description, even if a gene encodes an enzyme considered to be an FAD-conjugated glucose dehydrogenase based on the homology of the entire amino acid sequence or the like, when the gene does not encode the polypeptide comprising the amino acid sequence, it does not express a protein having an FAD-conjugated glucose dehydrogenase activity.

[0046] The above-mentioned amino acid sequence comprising 6 amino acid residues is preferably located at positions 202 to 207 of a polypeptide which is an FAD-conjugated glucose dehydrogenase, or at least one of X1 to X6 is as follows: X1 is alanine (A), X2 is glycine (G), X3 is valine (V), X4 is proline (P), X5 is tryptophan (W), or X6 is valine (V). For example, as a preferred example, the amino acid sequence: AGVPWV (SEQ ID NO: 4) can be exemplified.

[0047] In the invention, the FAD-conjugated glucose dehydrogenase refers to a soluble protein which catalyzes a reaction of the dehydrogenation (oxidation) of a hydroxy group at the 1-position of glucose in the presence of an electron acceptor and has an activity for maltose relative to the activity for glucose of 10% or less, and the enzyme is characterized by the following properties.

[0048] 1) Flavin adenine dinucleotide (FAD) is required as a coenzyme.

[0049] 2) Oxygen is not used as an electron acceptor.

[0050] 3) The activity for maltose relative to the activity for glucose is 10% or less.

[0051] Among the FAD-conjugated glucose dehydrogenases of the invention, as the enzyme having the amino acid sequence: AGVPWV, particularly, one derived from Aspergillus oryzae is preferred. Typical examples of a strain thereof include NBRC 5375 strain, NBRC 4079 strain, NBRC 4203 strain, NBRC 4214 strain, NBRC 4268 strain, NBRC 5238 strain, NBRC 6215 strain, NBRC 30104 strain, and NBRC 30113 strain as shown in the following Table 1. The amino acid sequence: AGVPWV is contained in the amino acid sequence of the enzyme in the vicinity of positions 202 to 207 (derived from NBRC 5375 strain) (in the case of an enzyme derived from other strain, positions corresponding to the positions) with the initiator amino acid residue M in a signal sequence region counted as position 1.

[0052] For example, the amino acid sequence of the FAD-conjugated glucose dehydrogenase expressed by Aspergillus oryzae NBRC 5375 strain is represented by SEQ ID NO: 1 (containing a signal peptide), the base sequence of a chromosomal DNA encoding the same is represented by SEQ ID NO: 2, and a cDNA corresponding to the amino acid residues represented by SEQ ID NO: 1 is represented by SEQ ID NO: 3. Incidentally, in SEQ ID NO: 2 or 3, the base sequence encoding the amino acid sequence: AGVPWV is GCTGGTGTTCCATGGGTT (SEQ ID NO: 5).

[0053] Accordingly, the polynucleotide of the invention includes, in addition to those derived from Aspergillus oryzae strains described above, a polynucleotide encoding a polypeptide (a), (b) or (c) defined below:

[0054] (a) a polypeptide which comprises an amino acid sequence represented by SEQ ID NO: 1;

[0055] (b) a polypeptide which comprises an amino acid sequence having substitution, deletion, or addition of one to several amino acid residues in the amino acid sequence (a) and has an FAD-conjugated glucose dehydrogenase activity; or

[0056] (c) a polypeptide which comprises an amino acid sequence having a homology of 70% or more to the amino acid sequence (a) and has an FAD-conjugated glucose dehydrogenase activity.

[0057] Further, the polynucleotide of the invention includes a polynucleotide (d), (e) or (f) defined below:

[0058] (d) a polynucleotide which comprises a base sequence represented by SEQ ID NO: 2 or 3;

[0059] (e) a polynucleotide which hybridizes to a polynucleotide comprising a base sequence complementary to a polynucleotide comprising a base sequence (d) under stringent conditions and encodes a polypeptide having an FAD-conjugated glucose dehydrogenase activity; or

[0060] (f) a polynucleotide which comprises a base sequence having a homology of 70% or more to the polynucleotide comprising a base sequence (d) and encodes a polypeptide having an FAD-conjugated glucose dehydrogenase activity.

[0061] In particular, it is preferred that the above polypeptide (b) or (c) contains the amino acid sequence: X1-X2-X3-X4-X5-X6, or the polynucleotide (e) or (f) contains a base sequence encoding the amino acid sequence. Further, it is preferred that this amino acid sequence is AGVPWV.

[0062] In this description, the amino acid sequence or base sequence having a homology of 70% or more refers to a sequence showing a homology of at least 70%, preferably 75% or more, more preferably 80% or more, further more preferably 90% or more, particularly preferably 95% or more to the full-length of a standard sequence to be compared, respectively. The homology percentage of such a sequence can be calculated using a disclosed or commercially available software with an algorithm that makes a comparison using the standard sequence as a reference sequence. For example, BLAST, FASTA, or GENETYX (manufactured by Software Development Co., Ltd.), or the like can be used. These can be used with default parameters.

[0063] In the invention, as specific conditions for the hybridization under stringent conditions when polynucleotides are hybridized, for example, incubation at 42 C. in 50% formamide, 5SSC (150 mM sodium chloride, 15 mM trisodium citrate, 10 mM sodium phosphate, 1 mM ethylenediaminetetraacetic acid, pH 7.2), 5Denhardt's solution, 0.1% SDS, 10% dextran sulfate, and 100 g/mL modified salmon sperm DNA, followed by washing of the filter at 42 C. in 0.2SSC can be exemplified.

[0064] Further, the polynucleotide of the invention includes a polynucleotide which has a DNA fragment amplifiable by PCR using a combination of a sense primer comprising a base sequence encoding the amino acid sequence: AGVPWV with a reverse primer comprising a base sequence on the 3-terminal side of a polynucleotide encoding an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae or a combination of an antisense primer for a base sequence encoding the amino acid sequence: AGVPWV with a forward primer comprising a base sequence on the 5-terminal side of a polynucleotide encoding an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae, and encodes a polypeptide having an FAD-conjugated glucose dehydrogenase activity.

[0065] Alternatively, the polynucleotide of the invention includes a polynucleotide which hybridizes to a probe comprising a base sequence encoding the amino acid sequence: AGVPWV under stringent conditions and encodes a polypeptide having an FAD-conjugated glucose dehydrogenase activity.

[0066] The base sequence encoding the amino acid sequence: AGVPWV is preferably GCTGGTGTTCCATGGGTT. Further, the respective conditions for the above-mentioned PCR and hybridization under stringent conditions can be suitably selected by those skilled in the art in accordance with the description of Examples in this description.

[0067] Further, the polynucleotide of the invention includes a polynucleotide encoding an FAD-conjugated glucose dehydrogenase, which shows a value of enzymatic activity for maltose of 10% or less, preferably 5% or less, more preferably 3% or less, and a value of enzymatic activity for D-galactose of 5% or less, preferably 3% or less, more preferably 2% or less, further more preferably 1% or less with a value of enzymatic activity for D-glucose taken as 100%; or a polynucleotide encoding an FAD-conjugated glucose dehydrogenase having an enzymatic activity of a specific activity per protein of 300 U/mg or more, preferably 500 U/mg or more, more preferably 1,000 U/mg or more. Incidentally, the specific activity per protein as used herein is, for example, a measurement determined in a state confirmed as a single band by SDS-PAGE of a concentrated culture supernatant as described in Example 7 of this description.

[0068] Incidentally, in the invention, the polynucleotide refers to a molecule having 100 or more phosphate esters of nucleosides in which a purine or a pyrimidine is attached to a sugar via a -N-glycosidic bond (ATP (adenosine triphosphate), GTP (guanosine triphosphate), CTP (cytidine triphosphate), or UTP (uridine triphosphate); or dATP (deoxyadenosine triphosphate), dGTP (deoxyquanosine triphosphate), dCTP (deoxycytidine triphosphate), or dTTP (deoxythymidine triphosphate). Specific examples thereof include a chromosomal DNA encoding an FAD-conjugated glucose dehydrogenase, a mRNA transcribed from the chromosomal DNA, a cDNA synthesized from the mRNA, and a polynucleotide amplified by PCR using any of these as a template. An oligonucleotide refers to a molecule in which 2 to 99 nucleotides are linked to one another. Further, the polypeptide refers to a molecule formed from 30 or more amino acid residues which are linked to one another through an amide bond (peptide bond) or an unnatural residual linkage, and also those with the addition of a sugar chain, those with the artificial chemical modification, and the like are included.

[0069] The most specific mode of the polynucleotide (gene) of the invention is a polynucleotide containing the base sequence represented by SEQ ID NO: 2 or 3. The polynucleotide which is a chromosomal DNA typified by SEQ ID NO: 2 can be obtained by, for example, preparing a chromosomal DNA library from Aspergillus oryzae NBRC 5375 strain, and screening the chromosomal DNA library by a method known to those skilled in the art using a plurality of oligonucleotide probes prepared based on amino acid sequences obtained by determining amino acid residues of N-terminal and internal sequences of an FAD-conjugated glucose dehydrogenase derived from Aspergillus terreus described in Patent document 1 by the Edman sequencing method or the like, and the genome sequence information of Aspergillus oryzae (NBRC 100959 strain) disclosed in DOGAN (Database of the Genomes Analyzed at NITE) (website http://www.bio.nite.go.jp/dogan/Top) in January, 2006 as a result of the Aspergillus oryzae genome analysis project.

[0070] The labeling of the probe can be performed by an arbitrary method known to those skilled in the art such as a radioisotope (RI) method or a non-RI method, however, a non-RI method is preferably used. Examples of the non-RI method include a fluorescence labeling method, a biotinylation method, and a chemiluminescence method, however, a fluorescence labeling method is preferably used. As a fluorescent substance, those capable of binding to a base moiety of an oligonucleotide is suitably selected and can be used, and specifically, a cyanine dye (such as Cy3 or Cy5 in Cy Dye series), a rhodamine 6G reagent, N-acetoxy-N2-acetylaminofluorene (AAF), AAIF (iodine derivative of AAF), or the like can be used.

[0071] Alternatively, the polynucleotide which is a cDNA typified by SEQ ID NO: 3 can be obtained by, for example, as specifically described in Examples of this specification, any of a variety of PCR methods known to those skilled in the art using the oligonucleotide primer (probe) set prepared in the above with a cDNA library as a template, or also by the RT-PCR method using the total RNA or mRNA extracted from Aspergillus oryzae NBRC 5375 strain as a template. Incidentally, in the case where a primer is designed, the size (the number of bases) of the primers is from 15 to 40 bases, preferably from 15 to 30 bases in consideration of achieving the specific annealing thereof to a template DNA. However, in the case where LA (long and accurate) PCR is performed, the size of at least 30 bases is effective. Complementary sequences between the both primers should be avoided so that a set of or a pair (2 strands) of primers comprising a sense strand (on the 5-terminal side) and an antisense strand (on the 3-terminal side) may not anneal to each other. Further, in order to secure stable binding to the template DNA, the GC content should be about 50% so that GC-rich or AT-rich regions should not be unevenly distributed within the primers. Since the annealing temperature depends on Tm (melting temperature), primers having a Tm value in the range from 55 to 65 C. and similar to each other are selected in order to obtain a highly specific PCR product. In addition, it is necessary to note that the final concentration of the primers used in PCR should be adjusted to about 0.1 to about 1 M and the like. Further, a commercially available software for primer designing, for example, Oligo (manufactured by National Bioscience, Inc. (U.S.A.)), GENETYX (manufactured by Software Development Co., Ltd.), or the like can be also used.

[0072] Incidentally, such an oligonucleotide probe or an oligonucleotide primer set can also be prepared by cleaving the cDNA which is the polynucleotide of the invention with a suitable restriction enzyme.

[0073] Further, the polynucleotide of the invention can be prepared by modifying the above-mentioned cDNA of the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain by a known mutation introduction method, a mutagenic PCR method, or the like. Further, the polynucleotide of the invention can be obtained from a chromosomal DNA of an Aspergillus oryzae strain other than NBRC 5375 strain or a cDNA library thereof by a probe hybridization method using an oligonucleotide prepared based on the nucleotide sequence information of SEQ ID NO: 1. The polynucleotide can be obtained by variously changing stringent conditions when performing hybridization. The stringent conditions are defined by a salt concentration, an organic solvent (such as formaldehyde) concentration, a temperature, and the like in the hybridization and washing steps, and for example, various conditions known to those skilled in the art as disclosed in the description of U.S. Pat. No. 6,100,037 or the like can be adopted.

[0074] Further, the polynucleotide of the invention can be synthesized in vitro by a well-known chemical synthesis technique as described in a document (such as Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47: 411-418; Adams (1983) J. Am. Chem. Soc. 105: 661; Belousov (1997) Nucleic Acid Res. 25: 3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19: 373-380; Blommers (1994) Biochemistry 33: 7886-7896; Narang (1979) Meth. Enzymol. 68: 90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; or U.S. Pat. No. 4,458,066).

[0075] The recombinant vector of the invention is a cloning vector or an expression vector, and an appropriate recombinant vector is used depending on the kind of a polynucleotide to be used as an insert, an intended use thereof, or the like. For example, in the case where an FAD-conjugated glucose dehydrogenase is produced using a cDNA or an ORF region thereof as an insert, an expression vector for in vitro transcription, or an expression vector suitable for the respective prokaryotic cells such as Escherichia coli and Bacillus subtilis; and eukaryotic cells such as yeasts, filamentous fungi (such as molds), insect cells, and mammalian cells can be used.

[0076] As the transformant cell of the invention, for example, a prokaryotic cell such as Escherichia coli or Bacillus subtilis; a eukaryotic cell such as a yeast, a mold, an insect cell, or a mammalian cell; or the like can be used. Such a transformant cell can be prepared by introducing a recombinant vector into a cell by a known method such as an electroporation method, a calcium phosphate method, a liposome method, or a DEAE dextran method. Specific examples of the recombinant vector and the transformant cell include a recombinant vector shown in the below-mentioned Examples and a transformed Escherichia coli and a transformed mold prepared with this vector.

[0077] In the case where the FAD-conjugated glucose dehydrogenase of the invention is produced by expressing a DNA in a microorganism such as Escherichia coli, a recombinant expression vector in which the above-mentioned polynucleotide is introduced into an expression vector having an origin, a promoter, a ribosome-binding site, a DNA cloning site, a terminator sequence, and the like and replicable in the microorganism is prepared, a host cell is transformed with this expression vector, and the resulting transformant is cultured, whereby the FAD-conjugated glucose dehydrogenase can be produced in a large amount in the microorganism. At this time, if a start codon and a stop codon are introduced upstream and downstream of an arbitrary coding region and the DNA is expressed, an FAD-conjugated glucose dehydrogenase fragment containing the arbitrary region can also be obtained. Alternatively, the enzyme can also be expressed as a fusion protein with another protein. By cleaving this fusion protein with a suitable protease, the target FAD-conjugated glucose dehydrogenase can also be obtained. Examples of the expression vector for Escherichia coli include a pUC system, pBluescript II, a pET expression system, a pGEX expression system, and a pCold expression system.

[0078] Alternatively, in the case where the FAD-conjugated glucose dehydrogenase is produced by expressing it in a eukaryotic cell, a recombinant vector is prepared by inserting the above-mentioned polynucleotide into an expression vector for a eukaryotic cell having a promoter, a splicing region, a poly(A) addition site, and the like, and the resulting recombinant vector is introduced into a eukaryotic cell, whereby the FAD-conjugated glucose dehydrogenase can be produced in the eukaryotic cell. The polynucleotide can be maintained in a cell in a state of a plasmid or the like, or can be maintained by incorporating the polynucleotide into a chromosome. Examples of the expression vector include pKA1, pCDM8, pSVK3, pSVL, pBK-CMV, pBK-RSV, an EBV vector, pRS, and pYE82. Further, if pIND/V5-His, pFLAG-CMV-2, pEGFP-N1, pEGFP-C1, or the like is used as the expression vector, an FAD-conjugated glucose dehydrogenase polypeptide can also be expressed as a fusion protein to which any of a variety of tags such as a His tag, a FLAG tag, or GFP has been attached. As the eukaryotic cell, a cultured mammalian cell such as a monkey kidney cell COS-7, or a Chinese hamster ovary cell CHO; a budding yeast, a fission yeast, a mold, a silkworm cell, or a Xenopus oocyte is generally used, however, any kind of eukaryotic cell may be used as long as it can express the FAD-conjugated glucose dehydrogenase. In order to introduce the expression vector into the eukaryotic cell, a known method such as an electroporation method, a calcium phosphate method, a liposome method, or a DEAE dextran method can be used.

[0079] In particular, self-cloning in which an appropriate Aspergillus oryzae strain is transformed with a recombinant vector containing a polynucleotide encoding the FAD-conjugated glucose dehydrogenase of the invention derived from Aspergillus oryzae is preferred.

[0080] In order to isolate and purify the target protein from a culture (such as microbial cells or a culture broth or a culture medium composition containing the enzyme secreted to the outside of microbial cells) after the FAD-conjugated glucose dehydrogenase is expressed in a prokaryotic cell or a eukaryotic cell, known separation procedures can be combined. Examples of such procedures include a treatment with a denaturant such as urea or a surfactant, a heat treatment, a pH treatment, an ultrasonication treatment, enzymatic digestion, salting out, a solvent sedimentation method, dialysis, centrifugal separation, ultrafiltration, gel filtration, SDS-PAGE, isoelectric focusing, ion exchange chromatography, hydrophobic chromatography, reverse-phase chromatography, and affinity chromatography (also including a method utilizing a tag sequence, and a method using a polyclonal antibody or a monoclonal antibody specific for the FAD coenzyme-conjugated glucose dehydrogenase).

[0081] Further, the FAD-conjugated glucose dehydrogenase can be obtained by a recombinant DNA technique using the polynucleotide (a cDNA or a coding region thereof) of the invention. For example, an RNA is prepared by in vitro transcription from a vector containing the above-mentioned polynucleotide, and in vitro translation is performed using the RNA as a template, whereby the FAD-conjugated glucose dehydrogenase can be obtained in vitro. Further, if the polynucleotide is recombined into a suitable expression vector by a known method, the FAD-conjugated glucose dehydrogenase encoded by the polynucleotide can be expressed in a large amount in a prokaryotic cell such as Escherichia coli or Bacillus subtilis; or a eukaryotic cell such as a yeast, a mold, an insect cell, or a mammalian cell. Further, a polynucleotide having the same amino acid sequence but having a codon usage optimized in accordance with the host may be introduced thereinto. Further, the host can be suitably selected in accordance with the need of a sugar chain or other peptide modification.

[0082] In the case where the FAD-conjugated glucose dehydrogenase is produced by expressing it in vitro, a recombinant vector is prepared by inserting the above-mentioned polynucleotide into a vector having a promoter to which an RNA polymerase can bind, and this vector is added to an in vitro translation system such as a rabbit reticulocyte lysate or a wheat germ extract including an RNA polymerase corresponding to the promoter, whereby the FAD-conjugated glucose dehydrogenase can be produced in vitro. Examples of the promoter to which an RNA polymerase can bind include T3, T7, and SP6. Examples of the vector containing such a promoter include pKA1, pCDM8, pT3/T718, pT7/319, and pBluescript II.

[0083] The recombinant FAD-conjugated glucose dehydrogenase of the invention can be produced by the method described above. Such an FAD-conjugated glucose dehydrogenase is an enzyme which catalyzes a reaction of the dehydrogenation of glucose in the presence of an electron acceptor, and therefore, the use thereof is not particularly limited as long as a change caused by this reaction can be utilized. For example, it can be used in the medical field or the clinical field such as the use in the determination of glucose in a sample containing a biological material, a reagent for use in the determination thereof, or a reagent for use in the elimination thereof, and also it can be used in the production of a substance using a coenzyme-conjugated glucose dehydrogenase.

[0084] The reagent composition for use in the determination of glucose of the invention may be formulated into a single reagent by mixing all the components, or in the case where the reagent composition contains components interfering with each other, the respective components are separated so as to provide suitable combinations. Further, the reagent composition may be prepared as a reagent in the form of a solution or a powder, and moreover, it may be prepared as a test paper or a film for use in the analysis by being incorporated in an appropriate support such as a filter paper or a film. Incidentally, a standard reagent containing a deproteinizing agent such as perchloric acid or a fixed amount of glucose may be attached. The amount of the enzyme in this composition is preferably about 0.1 to 50 units per sample. Examples of a specimen to be determined for glucose include plasma, serum, spinal fluid, saliva, and urine.

[0085] The biosensor of the invention is a glucose sensor which determines a glucose concentration in a sample liquid using a reaction layer containing the FAD-conjugated glucose dehydrogenase of the invention as an enzyme. The biosensor is produced by, for example, forming an electrode system comprising a working electrode, its counter electrode, and a reference electrode on an insulating base plate using a method such as screen printing, and forming an enzyme reaction layer containing a hydrophilic polymer, an oxidoreductase, and an electron acceptor on this electrode system in contact therewith. When a sample liquid containing a substrate is dropped on the enzyme reaction layer of this biosensor, the enzyme reaction layer is dissolved and the enzyme and the substrate are reacted with each other, and accompanying the reaction, the electron acceptor is reduced. After completion of the enzymatic reaction, the reduced electron acceptor is electrochemically oxidized. At this time, this biosensor can determine the substrate concentration in the sample liquid from the oxidation current value obtained. In addition, other than this, a biosensor of a type for detecting a coloring intensity or a pH change can also be constructed.

[0086] As the electron acceptor of the biosensor, a chemical substance having an excellent ability to donate and accept electrons can be used. The chemical substance having an excellent ability to donate and accept electrons is a chemical substance generally called an electron carrier, a mediator, or a redox mediator, and as a chemical substance corresponding to such a substance, an electron carrier or a redox mediator cited in, for example, JP-T-2002-526759 or the like may be used. Specific examples thereof include an osmium compound, a quinone compound, and a ferricyan compound.

[0087] In the determination of the activity of the FAD-conjugated glucose dehydrogenase, the enzyme is preferably used by appropriately diluting it such that the final concentration thereof is 0.1 to 1.0 unit/mL. Incidentally, the unit of the enzymatic activity (unit) of the enzyme is an enzymatic activity that oxidizes 1 mol of glucose per minute. The enzymatic activity of the FAD-conjugated glucose dehydrogenase of the invention can be determined by the following method.

[Method for Determination of Enzymatic Activity]

[0088] 1.0 mL of 0.1 M potassium phosphate buffer (pH 7.0), 1.0 mL, of 1.0 M D-glucose, 0.1.4 mL of 3 mM 2,6-dichlorophenol indophenol (hereinafter referred to as DCIP), 0.2 mL of 3 mM 1-methoxy-5-methylphenazinium methylsulfate, and 0.61 mL of water are added to a 3-mL quartz cell (light path length: 1 cm), and the cell is placed in a spectrophotometer provided with a thermostat cell holder and incubated at 37 C. for 5 minutes. Thereafter, 0.05 mL of an enzyme solution is added to the cell, and then, a change in the absorbance of DCIP at 600 nm (ABS/min) is determined. The molar extinction coefficient of DCIP at pH 7.0 is taken as 16.310.sup.3 cm.sup.1M.sup.1, and the enzymatic activity to reduce 1 mol of DCIP per minute is substantially equivalent to 1 unit of the enzymatic activity. Therefore, the enzymatic activity was determined from the change in the absorbance according to the following equation.


Enzymatic activity (unit/mL)=ABS/16.33.0/0.05Dilution ratio of enzyme[Equation 1]

[0089] In the determination of the protein concentration of this enzyme, the enzyme is preferably used by appropriately diluting it such that the final concentration thereof is 0.2 to 0.9 mg/mL. The protein concentration in the invention can be determined by the calculation from a calibration curve prepared using bovine serum albumin (BSA, manufactured by Wako Pure Chemical Industries, Ltd., for biochemical purpose) as a standard substance using a Bio-Rad Protein Assay, which is a protein concentration determination kit and can be purchased from Bio-Rad Laboratories, Inc. Japan according to the instruction attached to the kit.

[0090] Incidentally, various techniques used for implementing the invention can be easily and surely carried out by those skilled in the art based on publicly known documents and the like exclusive of techniques the sources of which are indicated specifically. For example, the genetic engineering and molecular biological techniques can be carried out based on the methods described in Sambrook and Maniatis, in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausubel, F. M. et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 1995; and the like or the methods described in the references cited therein or methods substantially equivalent thereto or modified methods thereof. In addition, the terms in the invention are basically in accordance with IUPAC-IUB Commission on Biochemical Nomenclature or the meanings of terms conventionally used in the art.

[0091] Hereinafter, the invention will be more specifically described with reference to Examples. However, the technical scope of the invention is by no means limited to the description thereof. Further, the contents described in the documents cited in this description constitute the disclosure of this description as a part thereof.

Example 1

[0092] (Cloning of Gene Presumed to be FAD-Conjugated Glucose Dehydrogenase Derived from Aspergillus oryzae NBRC 5375 Strain into Escherichia coli)

(1) Culture of Microbial Cells

[0093] A liquid culture medium containing 1% (w/v) glucose (manufactured by Nacalai Tesque), 2% (w/v) defatted soybean (manufactured by Showa Sangyo Co., Ltd.), 0.5% (w/v) corn steep liquor (manufactured by San-ei Sucrochemical Co., Ltd.), 0.1% (w/v) magnesium sulfate heptahydrate (manufactured by Nacalai Tesque), and water was adjusted to pH 6.0, and a 100 mL portion thereof was placed in a 500 mL Sakaguchi flask and autoclaved at 121 C. for 20 minutes. In the cooled liquid culture medium, Aspergillus oryzae NBRC 5375 strain was inoculated and subjected to shaking culture at 28 C. for 48 hours. Thereafter, the wet microbial cells (15.5 g) were collected using a centrifugal separator.

(2) Confirmation of Activity of FAD-Conjugated Glucose Dehydrogenase of Aspergillus oryzae NRRC 5375 Strain

[0094] The microbial cells obtained in (1) were suspended in 50 mM potassium phosphate buffer (pH 7.5) and homogenized using sea sand B (manufactured by Nacalai Tesque). Then, the resulting homogenate was centrifuged and the supernatant was collected and used as a cell-free extract.

[0095] According to the above-mentioned method for the determination of enzymatic activity, the FAD-conjugated glucose dehydrogenase activity of the cell-free extract was confirmed, and the FAD-conjugated glucose dehydrogenase activity per cell-free extract was confirmed to be 0.0043 U/mL.

(3) Isolation of Total RNA

[0096] Among the microbial cells obtained in (1), 0.31 g of the wet microbial cells were frozen in liquid nitrogen, and then homogenized, and the total RNA was extracted using ISOGEN (manufactured by Nippon Gene Co., Ltd.).

(4) RT-PCR

[0097] RT-PCR was performed under the following conditions using a TaKaRa RNA LA PCR Kit (AMV) Ver. 1.1 (manufactured by Takara Rio Inc.), and PCR products containing a gene of about 1.8 kbp presumed to be an FAD-conjugated glucose dehydrogenase were obtained.

[0098] Template: Total RNA extracted in (3)

[0099] Primer:

[0100] Primer 1: 5-tgggatcctatqctcttctcactqgqcat-3 (SEQ ID NO: 6)

[0101] Primer 2: 5-gccaagcttctaagcactcttcgcatcctccttaatcaa gtc-3 (SEQ ID NO: 7)

[0102] Incidentally, the primers 1 and 2 were synthesized based on the base sequence of AO090005000449 (presumed to be a choline dehydrogenase) from the result of the gene analysis of Aspergillus oryzae NBRC 100959 strain disclosed in the above-mentioned DOGAN (Database of the Genomes Analyzed at NITE) (website http://www.bio.nite.go.jp/dogan/Top).

[0103] It is because the above-mentioned AO090005000449 was presumed not to be a choline dehydrogenase gene, but to be an FAD-conjugated glucose dehydrogenase gene of Aspergillus oryzae based on the base sequence information of an FAD-conjugated glucose dehydrogenase gene of Aspergillus terreus found by the present inventors.

[0104] Reaction conditions: Reverse transcription reaction at 42 C. for 30 minutes (1 cycle)

[0105] Denaturation at 99 C. for 5 minutes (1 cycle)

[0106] Cooling at 5 C. for 5 minutes (1 cycle)

[0107] Denaturation at 94 C. for 2 minutes (1 cycle)

[0108] Denaturation at 94 C. for 30 seconds, annealing at 45 C. for 30 seconds, and elongation reaction at 72 C. for 1 minute 30 seconds (25 cycles)

[0109] Elongation reaction at 72 C. for 5 minutes (1 cycle)

(5) Preparation of Plasmid Containing Gene Presumed to be FAD-Conjugated Glucose Dehydrogenase

[0110] The PCR amplified fragments obtained in (4) were cleaved with restriction enzymes BamHI and HindIII, and ligated to a pUJC18 vector (manufactured by Takara Bio, Inc.) treated with the same restriction enzymes using a DNA Ligation Kit Ver. 2.1 (manufactured by Takara Bio, Inc.), and a plasmid containing the gene presumed to be an FAD-conjugated glucose dehydrogenase was prepared.

(6) Production of Transformant

[0111] The plasmid obtained in (5) was introduced into E. coli JM109 Competent Cells (manufactured by Takara Bio, Inc.), and transformation was performed. The cells were cultured overnight in an LB plate containing ampicillin sodium (manufactured by Wako Pure Chemical Industries, Ltd.) at 37 C., and thereafter, it was confirmed that the plasmid containing the gene presumed to be an FAD-conjugated glucose dehydrogenase was introduced into one grown colony by direct PCR, and then, the transformant was obtained in the TB plate containing ampicillin sodium.

Example 2

[0112] (Cloning of Gene Presumed to be FAD-Conjugated Glucose Dehydrogenase Derived from Aspergillus oryzae NBRC 5375 Strain into Aspergillus oryzae)

(1) Extraction of Chromosomal DNA

[0113] Among the wet microbial cells obtained in Example 1 (1), a 0.25 g portion thereof was frozen in liquid nitrogen, and then homogenized, and a chromosomal DNA was extracted by a common procedure.

(2) Cloning of Gene Presumed to be FAD-Conjugated Glucose Dehydrogenase

[0114] As a host to be used, Aspergillus oryzae NS4 strain was used. This strain was bred in Brewery Laboratory in 1997 as described in a publicly known document 1 (Biosci. Biotech. Biochem., 61 (8), 1367-1369, 1997) and has been used in the analysis of transcription factors, the breeding of high-producing strains of various enzymes, and the like, and those for distribution are available.

[0115] For this strain, a modified amylase gene promoter derived from Aspergillus oryzae described in a publicly known document 2 (Development of the heterologous gene expression system for Aspergillus species, MINETOKI Toshitaka, Chemistry & Biology, 38, 12, pp. 831-838, 2000) was used, and a gene presumed to be an FAD-conjugated glucose dehydrogenase and amplified using the chromosomal DNA obtained in (1) as a template and also using the following primers synthesized based on the base sequence of AO090005000449 disclosed in DOGAN (Database of the Genomes Analyzed at NITE) (website http://www.bio.nite.go.jp/dogan/Top) was ligated to downstream of the promoter, whereby a vector which can express this gene was prepared.

TABLE-US-00001 1.gene1F: (SEQIDNO:8) 5-(acgcgtcgac)tgaccaattccgcagctcgtcaaaatgctcttc tcactggcattcctga-3 2.gene1R: (SEQIDNO:9) 5-ggctgaactaattcctcctacgcttctcacgaatc(gtg)-3
(F is the 5 side, and R is the 3 side, bases in the parenthesis: restriction enzyme cleavage sites, underlined bases: enoA 5-UTR, others: ORF)

[0116] Transformation was performed basically in accordance with the methods described in the publicly known document 2 and a publicly known document 3 (Genetic engineering technology of Koji mold for sake, GOMT Katsuya, Journal of the Brewing Society of Japan, pp. 494-502, 2000), whereby a transformant was obtained.

Comparative Example

[0117] (Cloning of Gene (AO0090005000449) Presumed to be FAD-Conjugated Glucose Dehydrogenase Derived from Aspergillus oryzae NBRC 100959 Strain into Aspergillus oryzae)

(1) Culture of Microbial Cells

[0118] A liquid culture medium containing 1% (w/v) glucose, 2% (w/v) defatted soybean, 0.5% (w/v) corn steep liquor, 0.1% (w/v) magnesium sulfate heptahydrate and water was adjusted to pH 6.0, and a 100 mL portion thereof was placed in a 500 mL Sakaguchi flask and autoclaved at 121 C. for 20 minutes. In the cooled liquid culture medium, Aspergillus oryzae NBRC 100959 strain was inoculated and subjected to shaking culture at 28 C. for 48 hours. Thereafter, the microbial cells (10.5 g) were collected using a centrifugal separator.

(2) Extraction of Chromosomal DNA

[0119] Among the microbial cells obtained in (1), 0.31 g of the wet microbial cells were frozen in liquid nitrogen, and then homogenized, and a chromosomal DNA was extracted by a common procedure.

(3) Cloning of Gene (AO0090005000449 Gene) Presumed to be FAD-Conjugated Glucose Dehydrogenase

[0120] As a host to be used, Aspergillus oryzae NS4 strain was used. This strain was bred in Brewery Laboratory in 1997 as described in the publicly known document 1, and has been used in the analysis of transcription factors, the breeding of high-producing strains of various enzymes, and the like, and those for distribution are available.

[0121] For this strain, a modified amylase gene promoter derived from Aspergillus oryzae described in the publicly known document 2 was used, and a gene (AO0090005000449 gene) presumed to be an FAD-conjugated glucose dehydrogenase and amplified using the chromosomal DNA obtained in (2) as a template and also using the primers (SEQ ID NOS: 8 and 9) used in Example 2 was ligated to downstream of the promoter, whereby a vector which can express this gene was prepared.

[0122] Transformation was performed basically in accordance with the methods described in the publicly known documents 2 and 3, whereby a transformant was obtained.

Example 3

(Confirmation of Gene Sequence)

[0123] (1) Sequence of Gene Presumed to be FAD-Conjugated Glucose Dehydrogenase Derived from Aspergillus oryzae NBRC 5375 Strain in Recombinant Escherichia coli

[0124] The sequence determination of the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain in the recombinant Escherichia coli obtained in Example 1 was performed, and the result is shown in SEQ ID NO: 3. The sequence shown in SEQ TD NO: 3 was compared with a cDNA sequence obtained by removing the intron from the base sequence of the gene (AO090005000449) presumed to be an FAD-conjugated glucose dehydrogenase in Comparative example, and it was found that the sequence of ATG at positions 604 to 606 with the start base A of AO090005000449 counted as position 1 was different from that of the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain which had the sequence of GCTGGTGTTCCATGGGTT represented by SEQ ID NO: 5 instead, and the other sequences agreed completely with each other.

[0125] Further, the translated amino acid sequence is shown in SEQ ID NO: 1, and a comparison of the amino acid sequences was made in the same manner, and it was found that the amino acid residue M at position 202 with the start amino acid residue M of AO090005000449 counted as position 1 was different from that of the amino acid sequence encoded by the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain which had the sequence of AGVPWV represented by SEQ ID NO: 4 instead, and the other sequences agreed completely with each other.

(2) Sequence of Gene Presumed to be FAD-Conjugated Glucose Dehydrogenase Derived from Aspergillus oryzae NBRC 5375 Strain in Recombinant Mold

[0126] The sequence determination of the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain in the recombinant mold obtained in Example 2 was performed, and the result is shown in SEQ ID NO: 2. The sequence shown in SEQ ID NO: 2 was compared with the base sequence of the gene (AO0090005000449) presumed to be an FAD-conjugated glucose dehydroqenase in Comparative example, and it was found that the sequence of ATG at positions 656 to 658 with the start base A of AO090005000449 counted as position 1 was different from that of the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain which had the sequence of GCTGGTGTTCCATGGGTT represented by SEQ ID NO: 5 instead.

[0127] Further, the translated amino acid sequence is shown in SEQ ID NO: 1 and a comparison of the amino acid sequences was made in the same manner, and it was found that the amino acid residue M at position 202 with the start amino acid residue M of AO090005000449 (presumed to be a choline dehydrogenase) counted as position 1 was different from that of the amino acid sequence encoded by the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain which had the sequence of AGVPWV represented by SEQ ID NO: 4 instead, and the other sequences agreed completely with each other.

(Comparison of Gene Sequences)

[0128] From the above results, it was found that in the strains of Examples 1 and 2 and the strain of Comparative example, the genes presumed to be an FAD-conjugated glucose dehydrogenase had a similar gene sequence, however, as compared with the sequence of the gene of AO090005000449 derived from the strain of Comparative example, the sequence of the gene derived from Aspergillus oryzae NBRC 5375 strain in each of Examples 1 and 2 had the sequence of GCTGGTGTTCCATGGGTT represented by SEQ ID NO: 5 in place of the sequence of ATG at positions 656 to 658. Further, when a comparison of the amino acid sequences was made, it was found that the amino acid sequence encoded by the gene derived from Aspergillus oryzae NBRC 5375 strain had AGVPWV represented by SEQ ID NO: 4 in place of the amino acid residue M in the vicinity of position 202 of AO090005000449.

Example 4

(Analysis and Comparison at Gene Level)

(1) Confirmation by Southern Blotting

[0129] From wet microbial cells cultured using each of the strains obtained in Example 2 and Comparative example, DNA was extracted by a common procedure, and detection was performed by Southern blotting using a part of the gene presumed to be the FAD-conjugated glucose dehydrogenase as a probe.

[0130] As a result, it was found that in each of the strains, a DNA fragment containing the gene presumed to be the FAD-conjugated glucose dehydrogenase ligated to the modified amylase gene promoter derived from Aspergillus oryzae was contained in substantially the same copy number.

[0131] That is, it was found that in each of the strains obtained in Example 2 and Comparative example, the gene was contained in substantially the same copy number by transformation.

(2) Confirmation by Northern Blotting

[0132] From wet microbial cells cultured using each of the strains obtained in Example 2 and Comparative example, RNA was extracted by a common procedure, and detection was performed by Northern blotting using a part of the gene presumed to be the FAD-conjugated glucose dehydrogenase as a probe.

[0133] As a result, it was found that in each of the strains, which were transformed a mRNA fragment presumed to be derived from the FAD-conjugated glucose dehydrogenase gene ligated to the modified amylase gene promoter derived from Aspergillus oryzae was detected to substantially the same extent. That is, it could be determined that in each of the strains obtained in Example 2 and Comparative example, the gene presumed to be the FAD-conjugated glucose dehydrogenase was transcribed into an RNA to substantially the same extent.

Example 5

(Confirmation of FAD-Conjugated Glucose Dehydrogenase Activity in Transformed Strain)

[0134] The microbial cells of Example 1 were subjected to shaking culture in an LB liquid culture medium containing 50 g/mL ampicillin sodium and 0.1 mM isopropyl--D-1-thiogalactopyranoside (manufactured by Sigma-Aldrich Japan KK) at 37 C. for 17 hours. After completion of the culture, the microbial cells were collected, suspended in 50 mM potassium phosphate buffer (pH 7.0), and homogenized using an ultrasonic homogenizer. Then, the resulting homogenate was centrifuged and the supernatant was collected, whereby a cell-free extract was obtained.

[0135] When the cell-free extract was subjected to SDS-PAGE, an enzyme protein having a molecular weight of about 63 kDa could be confirmed, and the FAD-conjugated glucose dehydrogenase activity per cell-free extract was confirmed to be 0.014 U/mL. Incidentally, this activity was not at all confirmed in Escherichia coli used as the host.

[0136] The microbial cells of each of Example 2 and Comparative example were subjected to shaking culture at 28 C. for 3 days in a liquid culture medium containing 1% peptone, 2% sucrose, 0.5% dipotassium hydrogen phosphate, and 0.05% magnesium sulfate. After completion of the culture, the microbial cells and the culture supernatant were collected by centrifugation. The microbial cells were suspended in 50 mM potassium phosphate buffer (pH 7.0) and homogenized using a chip-type ultrasonic homogenizer. Then, the resulting homogenate was centrifuged and the supernatant was collected and used as a cell-free extract.

[0137] When the culture supernatant and the cell-free extract were subjected to SDS-PAGE, in the case of the microbial cells of Example 2, an enzyme protein having a molecular weight of about 86 kDa could be confirmed in the culture supernatant, however, in the case of the microbial cells of Comparative example, the protein could not be confirmed in the culture supernatant or the cell-free extract.

[0138] Further, in accordance with the above-mentioned method for the determination of enzymatic activity, the FAD-conjugated glucose dehydrogenase activity in the culture supernatant and the cell-free extract was confirmed, and in the case of the microbial cells of Example 2, the FAD-conjugated glucose dehydrogenase activity of 53 U/mL was confirmed in the culture supernatant, however, in the case of the microbial cells of Comparative example, the activity could not be confirmed at all in the culture supernatant or the cell-free extract.

(Conclusion)

[0139] When summarizing the findings of Examples 3 to 5, it can be concluded that although Example 2 and Comparative example are comparable in terms of the transformed gene copy number and its transcription level, the sequences presumed to be the gene of the FAD-conjugated glucose dehydrogenase transformed are subtly different, and the difference between the gene sequences largely affects the expression of the enzymatic activity.

Example 6

[0140] (Comparison Among Other Aspergillus oryzae Strains)

[0141] For several other Aspergillus oryzae strains, the FAD-conjugated glucose dehydrogenase activity in the culture supernatant and the cell-free extract (CFE) was confirmed in the same manner as in Example 1-(2). Further, for each of these strains, a chromosomal DNA was extracted in the same manner as in Example 2-(1), and the sequence of a fragment of about 1.9 kbp amplified using the primers represented by SEQ ID NOS: 6 and 7 was determined and compared with the sequence represented by SEQ ID NO: 2 and with the chromosomal DNA sequence of AO090005000449. Further, the translated amino acid sequence was compared with the sequence represented by SEQ ID NO: 1 and with the amino acid sequence of AO090005000449. These results are shown in the following Table 1 along with the results of Examples 1 to 3 and Comparative example. As for the sequence, particularly, the presence or absence of the amino acid sequence of AGVPWV described in Example 3-(1) is shown in Table 1.

TABLE-US-00002 TABLE 1 Presence or absence of FAD-conjugated glucose dehydrogenase Presence or absence of Strain activity in culture amino acid sequence: (Aspergillus oryzae) supernatant or CFE AGVPWV NBRC 5375 Presence Presence NBRC 100959 Absence Absence NBRC 4079 Presence Presence NBRC 4203 Presence Presence NBRC 4214 Presence Presence NBRC 4268 Presence Presence NBRC 5238 Presence Presence NBRC 6215 Presence Presence NBRC 30104 Presence Presence NBRC 30113 Presence Presence NBRC 4181 Absence Absence NBRC 4220 Absence Absence

[0142] All of the chromosomal DNA sequences derived from Aspergillus oryzae NBRC 4079, 4214, 4268, 5238, 6215, and 30113 agreed completely with the sequence represented by SEQ ID NO: 2.

[0143] The chromosomal DNA sequence derived from Aspergillus oryzae NBRC 4203 was different in four bases (135C.fwdarw.A, 437G.fwdarw.A, 532G.fwdarw.A, 1263C.fwdarw.T) from the sequence represented by SEQ ID NO: 2. Further, the amino acid sequence translated from the chromosomal DNA sequence derived from Aspergillus oryzae NBRC 4203 was different in two amino acid residues (129V.fwdarw.I, 386A.fwdarw.V) from the sequence represented by SEQ ID NO: 1.

[0144] Further, the chromosomal DNA sequence derived from Aspergillus oryzae NBRC 30104 was different in four bases (135C.fwdarw.A, 413C.fwdarw.A, 437G.fwdarw.A, 532G.fwdarw.A) from the sequence represented by SEQ ID NO: 2. Further, the amino acid sequence translated from the chromosomal DNA sequence derived from Aspergillus oryzae NBRC 30104 was different in two amino acid residues (121R.fwdarw.S, 129V.fwdarw.I) from the sequence represented by SEQ ID NO: 1. It was considered that the difference between these amino acid sequences did not directly affect the expression of the FAD-conjugated glucose dehydrogenase.

[0145] Further, both of the chromosomal DNA sequences derived from Aspergillus oryzae NBRC 4181 and 4220 agreed completely with the chromosomal DNA sequence of AO090005000449.

[0146] From the results of Examples 1 to 5 and Comparative example, it was concluded that the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain was a gene encoding an active form of an FAD-conjugated glucose dehydrogenase, and also that the gene presumed to be an FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 100959 strain (AO090005000449 gene) was not a gene encoding an active form of an FAD-conjugated glucose dehydrogenase. The AO090005000449 gene encodes the amino acid sequence very similar to that of an FAD-conjugated glucose dehydrogenase derived from NBRC 5375 strain, and therefore, in the light of the technical common knowledge in this technical field, it is assumed that the enzyme has a similar enzymatic activity. However, it was unexpectedly found for the first time by the present inventors that, in fact, as shown in Comparative example, the enzyme was not expressed by the sequences of the AO090005000449 gene, NBRC 4181 gene, and 4220 gene. Even though a similar expression system was used, the FAD-conjugated glucose dehydrogenase was expressed or not expressed depending only on the difference of the above-mentioned sequence. Therefore, though it is only a hypothesis, the amino acid sequence: AGVPWV contained in the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain or the like is considered to be an important sequence for forming the conformation of the FAD-conjugated glucose dehydrogenase, and it is presumed that when the sequence of AGVPWV is lacking, endoplasmic reticulum stress or the like occurs to cause the degradation of the expressed protein and/or the suppression of the expression of the protein. The presence of the amino acid sequence: AGVPWV in the vicinity of position 202 with the initiator amino acid residue M counted as position 1 is important for expressing the function. In this connection, which amino acid residue in this sequence is essential for expressing the activity is currently being studied, however, there is a possibility that even if a part of the amino acid residues are lost, substituted, or added, the activity can be maintained to some extent. Further, as for the region other than the amino acid sequence: AGVPWV, substitution of several amino acid residues found from the analysis of the genes of Aspergillus oryzae NBRC 4203 and Aspergillus oryzae NBRC 30104 did not affect the expression of the FAD-conjugated glucose dehydrogenase.

Example 7

(Test for Properties of FAD-Conjugated Glucose Dehydrogenase)

[0147] The culture supernatant of the microbial cells of Example 2 obtained in Example 5 was concentrated with Vivacell 2 having a fractionation molecular weight of 10000 (manufactured by Vivascience, Inc.), and then replaced with distilled water, whereby a purified enzyme having a specific activity per protein of 323 U/mg was obtained. Incidentally, enzymes derived from other strains showing an FAD-conjugated glucose dehydrogenase activity could be purified in the same manner. When these purified enzymes were subjected to SDS-PAGE, a single band of about 86 kDa could be confirmed. This enzyme was examined for its activity, substrate specificity, and coenzyme. The enzymatic activity was determined according to the above-mentioned method for the determination of enzymatic activity.

1) Activity

[0148] The purified enzyme was reacted with 500 mM D-glucose in the presence of 8.66 mM DCIP, and the reaction product was determined using a D-gluconic acid/D-glucono--lactone assay kit. As a result, the production of D-gluconic acid was confirmed, and accordingly, it was revealed that the FAD-conjugated glucose dehydrogenase of the invention was an enzyme which catalyzed a reaction of the oxidation of a hydroxy group at the 1-position of D-glucose.

2) Substrate Specificity

[0149] As a substrate in a reaction solution for the determination of activity in the above-mentioned method for the determination of enzymatic activity, D-glucose, maltose, and D-galactose were used, and the enzymatic activity of the purified enzyme was determined according to the method for the determination of enzymatic activity. The enzyme had an activity such that the value of enzymatic activity for maltose was 2.1% and the value of enzymatic activity for D-galactose was 0.99% with the value of enzymatic activity for D-glucose taken as 100%.

3) Coenzyme

[0150] D-glucose was added to the purified enzyme, and absorption spectroscopy was performed. As a result, the absorption maxima observed at 385 nm and 465 nm disappeared by the addition, and therefore, it was revealed that the coenzyme was FAD.

Example 8

[0151] (Determination of Glucose with Enzyme-Immobilized Electrode)

[0152] By using the purified enzyme described in Example 7, the determination of D-glucose with an enzyme-immobilized electrode was performed. By using a glassy carbon (GC) electrode on which 1.5 U of this enzyme was immobilized, a response current to the glucose concentration was determined. To an electrolytic cell, 1.8 mL of 50 mM potassium phosphate buffer (pH 6.0) and 0.2 mL of a 1 M aqueous solution of potassium hexacyanoferrate(III) (potassium ferricyanide) were added. The GC electrode was connected to a potentiostat BAS 100B/W (manufactured by BAS, Inc.), and the solution was stirred at 37 C., and +500 mV was applied to a silver-silver chloride reference electrode. To such a system, a 1 MD-glucose solution was added such that the final concentration of D-glucose became 5, 10, 20, 30, 40, or 50 mM, and a current in a steady state was determined for each addition operation. The current values were plotted against the known glucose concentrations (5, 10, 20, 30, 40, and 50 mM), whereby a calibration curve was prepared (FIG. 1). From this, it was shown that glucose could be quantitatively determined with an enzyme-immobilized electrode using the FAD-conjugated glucose dehydrogenase of the invention.

Example 9

(Confirmation of FAD-Conjugated Glucose Dehydrogenase Gene by PCR)

(1) Culture of Microbial Cells

[0153] A liquid culture medium containing 1% (w/v) glucose (manufactured by Nacalai Tesque), 2% (w/v) defatted soybean (manufactured by Showa Sangyo Co., Ltd.), 0.5% (w/v) corn steep liquor (manufactured by San-ei Sucrochemical Co., Ltd.), 0.1% (w/v) magnesium sulfate heptahydrate (manufactured by Nacalai Tesque) and water was adjusted to pH 6.0, and a 10 mL portion thereof was placed in a large diameter test tube and autoclaved at 121 C. for 20 minutes. In the cooled liquid culture medium, as shown in Example 4, Aspergillus oryzae NBRC 4268 strain, NBRC 5375 strain, and NBRC 6215 strain confirmed to have a glucose dehydrogenase activity in the culture broth, and Aspergillus oryzae NBRC 4181 strain, NBRC 4220 strain, and NBRC 1.00959 strain confirmed to have no glucose dehydrogenase activity in the culture broth were inoculated in the respective test tubes and subjected to shaking culture at 30 C. for 43 hours. Thereafter, the wet microbial cells were collected using a centrifugal separator, respectively.

(2) Extraction of Chromosomal DNA

[0154] The wet microbial cells obtained in (1) were frozen in liquid nitrogen, and then homogenized, and a chromosomal DNA was extracted by a common procedure.

(3) Amplification of Full-Length FAD-Conjugated Glucose Dehydrogenase Gene

[0155] PCR was performed under the following conditions using each DNA extracted in (2) as a template and also using primers 3 and 4 synthesized based on the sequence represented by SEQ ID NO: 2, and PCR products containing an FAD-conjugated glucose dehydrogenase gene of about 1.9 kbp were obtained.

[0156] Template: DNA extracted in (2)

[0157] Primers:

TABLE-US-00003 Primer3: (SEQIDNO:10) 5-ttatgctcttctcactggcattcctgagtgccctgt-3 Primer4: (SEQIDNO:11) 5-gctaagcactcttcgcatcctccttaatcaagtcgg-3

[0158] Reaction conditions: Denaturation at 94 C. for 1 minute (1 cycle)

[0159] Denaturation at 94 C. for 30 seconds, annealing at 45 C. for 30 seconds, and elongation reaction at 72 C. for 1 minute 30 seconds (30 cycles)

[0160] Elongation reaction at 72 C. for 10 minutes (1 cycle)

(4) Amplification of Gene of FAD-Conjugated Glucose Dehydrogenase Expressing Activity

[0161] PCR was performed under the following conditions using each PCR product obtained in (3) as a template and also using the primer 3 and a primer 5 synthesized based on the amino acid sequence: AGVPWV.

[0162] Template: PCR product obtained in (3)

[0163] Primers:

TABLE-US-00004 Primer3: (SEQIDNO:10) 5-ttatgctcttctcactggcattcctgagtgccctgt-3 Primer5: (SEQIDNO:12) 5-aacccatggaacaccagc-3

[0164] Reaction conditions: Denaturation at 94 C. for 1 minute (1 cycle)

[0165] Denaturation at 94 C. for 30 seconds, annealing at 65 C. for 30 seconds, and elongation reaction at 72 C. for 1 minute (30 cycles)

[0166] Elongation reaction at 72 C. for 5 minutes (1 cycle)

[0167] The results of the detection of the target gene by PCR are shown in FIG. 2. It could be confirmed that only the polynucleotide encoding the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae having a glucose dehydrogenase activity in the culture broth was amplified with a size as predicted by PCR. Incidentally, even when PCR was performed using the DNA obtained in (2) directly as the template, it could be confirmed that only the polynucleotide encoding the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae having a glucose dehydrogenase activity in the culture broth was amplified with a size as predicted by PCR in the same manner.

Example 10

(Confirmation of FAD-Conjugated Glucose Dehydrogenase Gene by Southern Hybridization)

[0168] 100 ng of each PCR product obtained in Example 10(1) was subjected to agarose gel electrophoresis, followed by blotting onto a nylon membrane (Hybond-N+, manufactured by GE Health Care, Inc.), and the membrane was treated at 80 C. for 71 hours for fixation. After prehybridization, a probe synthesized based on the amino acid sequence: AGVPWV and fluorescently labeled with fluorescein isothiocyanate (FITC) at the 5-terminus was added thereto, and the membrane was incubated at 37 C. for 24 hours. Then, the membrane was washed at 4 C. with 6SSC and at 50 C. with a tetramethylammonium chloride solution, and thereafter, SDS derived from the tetramethylammonium chloride solution was washed off with 25 mM TBS. Then, fluorescent detection was performed using an image analyzer (Typhoon 9400, manufactured by GE Health Care, Inc.). The composition of the buffer used and the sequence of the probe used are shown below.

[0169] Hybridization buffer:

[0170] 6SSC

[0171] 5Denhardt's solution

[0172] 0.5% skim milk

[0173] 20SSC:

[0174] 3 M sodium chloride

[0175] 0.3 M trisodium citrate

[0176] Tetramethylammonium chloride solution:

[0177] 3 M tetramethylammonium chloride

[0178] 50 mM Tris-HCl (pH 8.0)

[0179] 2 mM EDTA

[0180] 0.1% SDS

TABLE-US-00005 Probe: (SEQIDNO:5) 5 (FITC)-gctggtgttccatgggtt-3

[0181] The results of the detection of the target gene by Southern hybridization are shown in FIG. 3. It is found that only the polynucleotide encoding the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae having a glucose dehydrogenase activity in the culture broth could be detected by Southern hybridization. Incidentally, even when the confirmation by Southern hybridization is performed by immobilizing the PCR product obtained in (3) on a nylon membrane (Hybond-N+, manufactured by GE Health Care, Inc.), the same results can be obtained.

Example 11

[0182] (Cloning of Gene that could be Confirmed to be FAD-Conjugated Glucose Dehydrogenase Gene and Secretion and Production in Cloned Strain)

[0183] According to the method described in Example 2, the gene which could be confirmed to be the polynucleotide encoding the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae capable of secreting and producing the glucose dehydrogenase in the culture broth by the method shown in Example 9 and/or Example 10 was ligated to a vector, the resulting recombinant vector was cloned into a strain, and then, the cloned strain was cultured. As a result, in a culture supernatant, an active form of the enzyme could be secreted and produced in a large amount.

Example 12

[0184] (Confirmation of Amino Acid Residue that Affects Expression of Activity of FAD-Conjugated Glucose Dehydrogenase Derived from Aspergillus oryzae)

[0185] Several mutated enzyme genes in which one amino acid residue among the six amino acid residues (AGVPWV (the amino acid residues 202 to 207)) of the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae NBRC 5375 strain was deleted, a mutated enzyme gene in which all of the six amino acid residues were deleted, and a mutated enzyme gene having the bases encoding Met in place of these six amino acid residues were prepared, and each of the mutated genes was introduced into Aspergillus oryzae NS4 strain, and the effect on the expression of the activity was confirmed. Incidentally, the preparation of the mutated genes were performed using a Quikchange Site-Directed Mutagenesis kit manufactured by Stratagene, Inc., and the introduction of the gene into Aspergillus oryzae was performed according to the method described in Example 2. The average of the activity values (3 strains) per culture medium was calculated for each of the recombinants (presumed to contain a single copy) into which the respective mutated genes were introduced, and the results are shown in Table 2. From these results, it is strongly suggested that for the expression of the activity of the FAD-conjugated glucose dehydrogenase derived from Aspergillus oryzae, these six amino acid residues, particularly the amino acid residues 205 to 207 were important.

TABLE-US-00006 TABLE 2 Relative activity (%) with the Mutation site activity of (deletion of amino Activity value Control (No. 1) No. acid residue) (U/mL) taken as 100 1 Non (Control) 42 100 2 205 (Pro) 0.04 0.1 or less 3 206 (Trp) 0.03 0.1 or less 4 207 (Val) 0.04 0.1 or less 5 202 to 207 0.02 0.1 or less 6 (Ala-Gly-Val-Pro-Trp-Val) 0.03 0.1 or less Met is introduced into the deletion site of No. 8 in place of 6 amino acid residues (corresponding to gene of AO090005000449 of Comparative example)

INDUSTRIAL APPLICABILITY

[0186] An FAD-conjugated glucose dehydrogenase encoded by a polynucleotide of the invention does not substantially act on maltose in the determination of blood glucose, and therefore can be utilized also in a self-monitoring of blood glucose (SMBG) device with higher accuracy, and largely contributes to self-care and self-treatment by patients with diabetes.