An Electrochemical Interface for Molecular Circuit-Based Outputs
20230175044 · 2023-06-08
Inventors
- Keith PARDEE (Toronto, CA)
- Shana O. Kelley (Toronto, CA)
- Sarah J. Smith (Lewisburg, PA, US)
- Peivand S. Mousavi (Waterloo, CA)
- Jenise B. CHEN (Toronto, CA)
- Wenhan Liu (London, CA)
Cpc classification
G01N27/3277
PHYSICS
C12Q2565/519
CHEMISTRY; METALLURGY
C12Q2563/113
CHEMISTRY; METALLURGY
C12Q2565/519
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q2563/113
CHEMISTRY; METALLURGY
International classification
Abstract
The present description pertains to a detection system and methods of using same comprising an upstream molecular circuitry system that is activated in the presence of a target molecule to produce a reporter molecule and a capture molecule bound to an electrode wherein the reporter molecule specifically binds to the capture molecule bound to the electrode to produce or reduce a detectable electrochemical signal.
Claims
1-17. (canceled)
18. A detection system comprising: a. an upstream molecular circuitry system that is activated in the presence of a target molecule to produce an activator; b. a reporter system; and c. a capture molecule bound to an electrode; wherein the activator activates the reporter system to specifically release a reporter molecule and wherein the reporter molecule specifically binds to the capture molecule bound to the electrode to produce a detectable electrochemical signal.
19. The system of claim 18, wherein said detection system is a cell-free system.
20. The system of claim 18. wherein said system is a multiplexed system comprising a plurality of distinct detection systems.
21. The system of claim 18, wherein the upstream system comprises a synthetic toehold switch-based sensor, an aptamer-based switch-based sensor, an inducible transcription system, a riboregulated toehold-gated guide RNA (gRNA) switch-based sensor, or a system for generating a gRNA.
22. The system of claim 21, wherein said synthetic toehold switch-based sensor further comprises a sequence that is specific for the target molecule which is a trigger RNA or trigger DNA sequence.
23. (canceled)
24. The system of claim 18, the upstream system comprises an inducible transcription system, and wherein the transcription is controlled by a transcriptional repressor; or the upstream system comprises an inducible transcription system, and wherein the transcription is controlled by a transcriptional activator.
25. The system of claim 24, wherein said transcriptional repressor or transcriptional activator is specific for a small molecule.
26-29. (canceled)
30. The system of claim 18, wherein said activator is or comprises a nuclease, restriction enzyme, DNAzyme, or RNAzyme.
31. (canceled)
32. The system of claim 30, wherein said a restriction enzyme is comprises EcoRV, AciI, ClaI, BanII, BsaAI, BglII, BstEII, HincII, NcoI, or PstI.
33. The system of claim 30, wherein said a nuclease is comprises a Cas protein.
34-37. (canceled)
38. The system of claim 18, wherein the reporter molecule comprises a single-stranded DNA sequence, and wherein the reporter system comprises reporter molecule hybridized to a complementary inhibitory single-stranded DNA sequence (iDNA).
39. The system of claim 18, wherein the reporter molecule comprises a redox active molecule.
40-41. (canceled)
42. The system of to claim 39, wherein the a redox active molecule is comprises methylene blue.
43. The system of claim 18, wherein said capture molecule comprises a single-stranded DNA sequence.
44. The system of claim 43, wherein said capture molecule is coupled to the electrode via a terminal thiol group.
45-48. (canceled)
49. The system of claim 18, wherein said reporter molecule binds to a capture molecule and increases the detection of a generated electrochemical signal by an electrode.
50. The system of claim 18, wherein the electrochemical signal is detected by a computer.
51. (canceled)
52. A detection system comprising: a. an upstream molecular circuitry system comprising one or more different RNA toehold switch-based sensor(s), wherein each RNA toehold switch is specific to a target molecule that is an RNA sequence within a sample, and comprises an mRNA sequence encoding a distinct activator that is a restriction enzyme; b. one or more reporter system(s), wherein each reporter system comprises a reporter molecule that is a reporterDNA bound to an inhibitory single-stranded DNA that is an iDNA, wherein said reporterDNA is coupled to a redox active molecule, and wherein said reporterDNA and iDNA comprise a sequence recognized by said restriction enzyme; c. one or more capture molecules, wherein each capture molecule that is a captureDNA, is coupled to an electrode and comprises a sequence complementary to said reporterDNA; wherein the restriction enzyme activates the reporter system by specifically releasing the reporterDNA from the iDNA and wherein the reporterDNA specifically binds to the captureDNA, to produce an electrochemical signal detected by the electrode.
53. A method of detecting a target molecule comprising: a. providing the molecular-based detection system of claim 18; b. contacting said system with a sample; and c. detecting an electrochemical signal, wherein detection of said signal indicates the presence of the target molecule.
54. A method of detecting a plurality of target molecules comprising: a. providing the molecular-based detection system of claim 20; b. contacting said system with a sample; and c. detecting an electrochemical signal, wherein detection of said signal indicates the presence of a target molecule in the sample.
55-56. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] In the appended drawings:
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
SEQUENCE LISTING
[0054] This application contains a Sequence Listing in computer readable form created Oct. 10, 2019 having a size of about 51 kb. The computer readable form is incorporated herein by reference.
TABLE-US-00001 Sequence Listing of Successfully Expressed Restriction Enzymes in a Cell-Free System codon optimized for E. coli expression and modified to remove self-cutting sequences) SEQ ID NO: GenBankID Description 1 HQ327694 AciI 2 AF247972 AgeI 3 ADJ68010 AluI 4 HQ327698 ApaI 5 NZ_LCYI01000022 BamHI 6 HM569709 BanII 7 CP007640.1 BglII 8 AF522187 BpmI 9 HQ446231 BsaAI 10 EU386360 BsaHI 11 HQ636106 BstEII 12 JF323047 ClaI 13 DQ491002 CviQI 14 Y00449 DdeI 15 WP_081407150 EcoRI 16 P04390 EcoRV 17 NEBM150 HhaI 18 X54197 HincII 19 M22862 HinfI 20 JF432060 MscI 21 AF068761 NcoI 22 AY462277 NheI 23 DQ242471 NotI 24 AAA25673 PstI 25 Q53608 SalI 26 JF432057 SfoI 27 U44748 XmnI
TABLE-US-00002 DNA sequences used for the electrochemical detection system Enzyme DNA Strand Type 5′ Modification Sequence 3′ Modification AciI Capture Thiol CTAGCAGTACACCG (SEQ ID NO: 40) Inhibitor CTAGCAGAACACCGCGGTTCACGTCCG (SEQ ID NO: 41) Reporter CGGACGTGAACCGCGGTGTACTGCTAG (SEQ ID NO: 42) Amine BanII Capture GGCTCCTCGAGTATGC (SEQ ID NO: 43) Thiol Inhibitor ACTGAGAACGTGGGGCTCCTCGAGTATGC (SEQ ID NO: 44) Reporter Amine GCATACTCGAGGAGCCCCACGTTCTCAGT (SEQ ID NO: 45) BglII Capture Thiol GCTTGAGAACTAGATC (SEQ ID NO: 46) Inhibitor GCTTGAGAACTAGATCTAAGCACGTCCAGT (SEQ ID NO: 47) Reporter ACTGGACGTGCTTAGATCTAGTTCTCAAGC (SEQ ID NO: 48) Amine BsaAI Capture Thiol CGTAGGGATCATAC (SEQ ID NO: 49) Inhibitor CGTAGGGATAATACGTGAGCTCACGTGCA (SEQ ID NO: 50) Reporter TGCACGTGAGCTCACGTATGATCCCTACG (SEQ ID NO: 51) Amine BstEII Capture Thiol CACATCGTCATGGTGAC (SEQ ID NO : 52) Inhibitor CACATCGACATGGTGACCCGATGACCTCGC (SEQ ID NO: 53) Reporter GCGAGGTCATCGGGTCACCATGACGATGTG (SEQ ID NO: 54) Amine ClaI Capture Thiol GCAACTGAACAATCG (SEQ ID NO: 55) Inhibitor GCAACTGTACAATCGATGACTCAGCACCG (SEQ ID NO: 56) Reporter CGGTGCTGAGTCATCGATTGTTCAGTTGC (SEQ ID NO: 57) Amine EcoRV Capture Thiol TGCCTGGATTTGAT (SEQ ID NO: 58) Inhibitor TGCCTGGATTAGATATCCGTCGAGGAGAC (SEQ ID NO: 59) Reporter GTCTCCTCGACGGATATCAAATCCAGGCA (SEQ ID NO: 60) Amine HincII Capture Thiol GTCGAGGTACTGTT (SEQ ID NO: 61) Inhibitor GTCGAGGTAATGTTGACGATCCTGAGCGA (SEQ ID NO: 62) Reporter TCGCTCAGGATCGTCAACAGTACCTCGAC (SEQ ID NO: 63) Amine NcoI Capture Thiol CGAACACGTGACCATG (SEQ ID NO: 64) Inhibitor CGAACACGTGACCATGGTGCAGCATATGG (SEQ ID NO: 65) Reporter CCATATGCTGCACCATGGTCACGTGTTCG (SEQ ID NO: 66) Amine PstI Capture Thiol AGGCATGTCACCTGCA (SEQ ID NO: 67) Inhibitor AGGCATGTCACCTGCAGGAGCTTCAGAAC (SEQ ID NO: 68) Reporter GTTCTGAAGCTCCTGCAGGTGACATGCCT (SEQ ID NO: 69) Amine
TABLE-US-00003 Synthetic Toehold Switch and Trigger Sequences for Unique Restriction Enzymes SEQ ID NO: Toehold Switch Name SEQ ID NO: Paired Reporter Enzyme 28 Switch 1 29 AciI 30 Switch 2 31 BanII 32 Switch 3 33 BstEII 34 Switch 4 35 ClaI/AciI 36 Switch 5 37 EcoRV 38 Switch 6 39 HincII
General Definitions
[0055] Headings, and other identifiers, e.g., (a), (b), (i), (ii), etc., are presented merely for ease of reading the specification and claims. The use of headings or other identifiers in the specification or claims does not necessarily require the steps or elements be performed in alphabetical or numerical order or the order in which they are presented.
[0056] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one” but it is also consistent with the meaning of “one or more”, “at least one”, and “one or more than one”.
[0057] The term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed in order to determine the value. In general, the terminology “about” is meant to designate a possible variation of up to 10%. Therefore, a variation of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 % of a value is included in the term “about”. Unless indicated otherwise, use of the term “about” before a range applies to both ends of the range.
[0058] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
[0059] As used herein, the term “upstream molecular circuitry system” (also referred to as a gene circuit) refers to an engineered composition that comprises at least one nucleic acid material or construct and can perform a function including, but not limited to sensing, and a regulatory function. An input activates the upstream molecular circuitry system to produce an output. The nucleic acid material or construct (DNA, RNA) can be naturally occurring or synthetic. The upstream system can be a gene expression system wherein the system regulates transcription, translation or cleavage (e.g. synthetic RNA or DNA toehold switch-based sensor, an aptamer-based RNA or DNA switch-based sensor, an inducible transcription system, a riboregulated toehold-gated guide RNA (gRNA) switch-based sensor, or a system for generating a gRNA).
[0060] As used herein, the term “target molecule” refers to a small molecule or at least one nucleic acid material such as DNA or RNA.
[0061] As used herein, the term “activator” refers to an output produced by the upstream molecular circuitry system and includes, for example, a protein such as a nuclease, a CRISPR associated (Cas) protein, DNAs and RNAs that can cleave nucleic acids or any other molecule with specific nuclease activity. The protein can also be a restriction enzyme which is EcoRV, AciI, ClaI, BanII, BsaAI, BglII, BstEII, HincII, NcoI, or PstI or a Cas protein. The activator can also be a DNAzyme (e.g. deoxyribozyme or catalytic DNA) or RNAzyme (e.g. ribozyme or catalytic RNA). When used in the multiplex context, each activator (for example, restriction enzymes) are selected to provide orthogonal signalling. In certain embodiments, the activator comprises an enzyme (e.g. any oxidase, reductase, or oxidoreductase).
[0062] As used herein, the term “reporter system” refers to an engineered composition that is activated by the activator to produce or release a reporter molecule. For example, the reporter system can be a substrate for a nuclease generated by upstream molecular circuitry system.
[0063] As used herein, the term “reporter molecule” refers to a molecule (e.g. may be within the reporter system) that can be activated or produced by the activator or the upstream molecular circuitry system. For example, the reporter molecule could be a single-stranded DNA (reporterDNA) or a protein, such as an antibody or an antigen. In certain embodiments, the reporter molecule could be inactive in its bound state and could be released to its active state by an activator. For example, the reporterDNA could be hybridized to a complementary single-stranded DNA (iDNA) in its inactive state. In other embodiments, the reporter molecule can be coupled to a redox active molecule and can bind a capture molecule in its active state. The reporter molecule coupled to a redox active molecule can be referred to as a redox active reporter or redox active reporter molecule. In certain embodiments, the redox active reporter comprises an enzyme cofactor and is enzymatically produced. In other embodiments, the reporter molecule comprises an enzyme (e.g. any oxidase, reductase, or oxidoreductase).
[0064] As used herein, the terms “redox active molecule” or “electrochemically active molecule” refer to a molecule or chemical that experiences reduced or oxidized states, which is characterized by the transfer of electrons. For example, methylene blue.
[0065] As used herein, the terms “redox enzyme” refers to an enzyme that can catalyze electron transfer by reduction or oxidation of substrates within a redox reaction. For example, oxidases (e.g. glucose oxidase), reductases, or oxidoreductases.
[0066] As used herein, the terms “enzyme cofactor” (i.e. coenzyme), refers to small molecules that carry chemical groups between enzymes. In some embodiments, the enzyme cofactor carries and transfers electrons and functions as an oxidizing or reducing agent in redox reactions. For example, nicotinamide adenine dinucleotide (NADH) or flavin adenine dinucleotide (FADH).
[0067] As used herein, the term “capture molecule” refers to a molecule that is capable of binding a reporter molecule, and an electrode. For example, a capture molecule could be a single-stranded DNA (captureDNA) that is complementary to the reporter molecule, or an antigen or an antibody. In other embodiments, the capture molecule comprises an enzyme cofactor and is enzymatically produced to be redox active. In other embodiments, the capture molecule may comprise a redox active molecule. In other embodiments, the capture molecule may comprise a double stranded DNA that is able to recruit a catalytically inactive Cas protein. In this embodiment, either the Cas protein or gRNA can be modified with a redox active molecule or fused to a redox enzyme to create an electrochemical signal.
[0068] As used herein, “protein” or “polypeptide”, or any protein/polypeptide enzymes described herein, refers to any peptide-linked chain of amino acids, which may comprise any type of modification (e.g., chemical or post-translational modifications such as acetylation, phosphorylation, glycosylation, sulfatation, sumoylation, prenylation, ubiquitination, etc.). For further clarity, protein/polypeptide/enzyme modifications are envisaged so long as the modification does not destroy the desired enzymatic activity.
[0069] As used herein, the term “in vitro” refers to activities that take place outside an organism. In some embodiments, “in vitro” refers to activities that occur in the absence of cells.
[0070] As used herein, the term “cell-free” a used in “cell-free, detection system” refers to a set of biological components capable of providing for or supporting a biological reaction (e.g., transcription reaction, translation reaction, or both) in vitro in the absence of cells. Cell-free systems can be prepared using proteins, nucleic acid material and other subcellular components either isolated or purified from eukaryotic or prokaryotic cells, including recombinant cells, or prepared as whole extracts or fractions of cells.
[0071] As used herein, the term “electrode” refers to any electrode or electrochemical system that is sufficient for detecting the change in electrochemical potential when the reporter molecule specifically binds the capture molecule bound to the electrode. The electrode can be a nanostructured electrode, a non-nano structured electrode, a micro-patterned electrode, or an array thereof.
[0072] As used herein, the term “electrochemical signal” refers to the electric potential generated by a chemical messenger. For example, the electric potential generated by the chemical messenger or redox active molecule (e.g. methylene blue) could be measured by an electrode when in close proximity.
[0073] As used herein, the term “sample” means any sample comprising or being tested for the presence of one or more target molecule. Samples can include but are not limited to, small molecules, prokaryotic or eukaryotic cell-derived components such as nucleic acid material, proteins, or cellular extracts, extracellular fluid or fluid harvested from the body of a mammal, culture media, blood, plasma, and/or serum thereof.
[0074] As used herein, the term “small molecule” refers to a natural or synthetic molecule having a molecular mass of less than about 5 kD. For example, anhydrotetracycline (ATc).
[0075] As used herein, the term “transcriptional repressor” refers to a molecule that inhibits transcriptional activity. For example, a transcriptional repressor can be TetR, which binds and inhibits transcription of TetO. ATc may bind TetR and derepress transcription of TetO.
[0076] As used herein, the term “transcriptional activator” refers to a molecule that promotes or activates transcriptional activity.
[0077] As used herein, the term “computer” refers to an electronic device for storing and processing data, and capable of performing logic functions based on instructions given to it in an adjustable program.
[0078] As used herein, the term “portable” refers to a device, such as a computer, that can be held in one or two hands, without the need for any special carriers. In some embodiments, a portable can be used outside of a laboratory setting. In some embodiments, a portable device can be battery powered.
[0079] As used herein, the term “multiplex” refers to a system that allows for the simultaneous detection of a plurality of distinct target molecules in a single assay (e.g., at least 2, at least 6, at least 10, at least 20, at least 30 target molecules).
[0080] Other objects, advantages and features of the present description will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
DETAILED DESCRIPTION
[0081] In one aspect, the present description relates to a direct interface between engineered molecular circuits and electronics. Interfacing in vitro synthetic biology with electronics will enable engineered gene networks to rapidly share data with computational tools, a feature that will drive more sophisticated and interactive diagnostics and embedded sensor applications. Importantly, this electrochemical interface also enables the large-scale multiplexing outputs from molecular circuit-based sensors. Reporter output from these networks has largely been optical, which has limited the potential to measure distinct, parallel signals.
[0082] In one aspect, the present description provides an electrochemical interface permitting multiplexed detection for cell-free synthetic gene networks.
[0083] In one aspect, the present description provides a scalable system of reporter enzymes that release a modified DNA strand, resulting in recruitment of a redox reporter molecule to the surface of a nanostructured microelectrode and an increase in measured current.
[0084] In one aspect, the molecular circuitry system described therein can be used to detect target molecules such as small molecules, DNA, RNA, and proteins, including the detection of multiple antibiotic resistance genes in parallel. This technology has potential for expanding the integration between synthetic biology applications (sensing) and hardware, software, and machine learning.
[0085] In one aspect, the molecular circuitry system comprises one or more different switch-based sensors, specific for different target molecules. In some aspects, the switch-based sensor is a toehold RNA switch-based sensor. In some aspects, the target molecule is RNA within a sample and can bind a toehold RNA switch comprising an mRNA sequence encoding a protein. Upon RNA binding, the toehold RNA switch linearizes and the mRNA is translated into said protein. In some aspects, the protein is an activator or is the reporter molecule. In some aspects, the protein is a nuclease. In some aspects, the nuclease is a restriction enzyme. In some aspects, the restriction enzyme is from the list of EcoRV, AciI, ClaI, BanII, BsaAI, BglII, BstEII, HincII, NcoI, or PstI. In some aspects, the nuclease is a Cas protein. In some aspects, the restriction enzyme is specific for a reporter molecule, which is a single stranded DNA strand referred to as reporterDNA. In some aspects, the reporterDNA is inactive when hybridized to a complementary inhibitory single-stranded DNA strand referred to as iDNA. In some aspects, the reporter molecule or reporterDNA comprises a redox active molecule, referred to as a redox active reporter. In some aspects, the restriction enzyme or nuclease specifically cleaves the reporterDNA/iDNA complex, thereby releasing the reporterDNA. In some aspects, a series of electrodes are coupled to a corresponding capture molecule. In some aspects, the capture molecule is a single-stranded DNA strand specific for a reporterDNA. In some aspects, the captureDNA binds the released or active reporterDNA. In some aspects, an electrode detects an electrochemical signal generated by the electric potential of the redox active molecule that is bound to the reporterDNA. In other aspects, the activator or the reporter molecule comprises enzyme that could any oxidase, reductase, or oxidoreductase. In some aspects, the reporter molecule or reporterDNA comprises an enzyme cofactor. In some aspects, the enzyme produces a redox active reporter. In some aspects, the oxidase, reductase, or oxidoreductase enzymes are fused to Cas protein and recruited to the capture molecule on the surface. In other aspects, the RNA toehold switch encodes an RNAzyme.
[0086] In one aspect, the target molecule is DNA within a sample and can bind a toehold DNA switch comprising a DNA sequence encoding an mRNA, gRNA, or RNAzyme. In some aspects, the mRNA is translated into a protein, which can be the reporter molecule or an activator that activates a reporter molecule. In other aspects, the transcribed gRNA is bound by a Cas protein, which can activate a reporter molecule. In other aspects, the DNA sequence encodes a DNAzyme, that can activate a reporter molecule.
[0087] In one aspect, the target molecule is RNA within a sample and can bind a riboregulated toehold-gated guide RNA (gRNA) switch-based sensor. In some aspects, the gRNA is exposed and can be bound by a Cas protein. In some aspects, the gRNA is specific for a reporterDNA. In some aspects, the Cas-gRNA complex binds and cleaves the reporterDNA/iDNA complex, thereby releasing and activating the reporterDNA.
[0088] In one aspect, aptamer switch-based sensors detect certain target molecules within a sample. In some aspects, the aptamer switches detect specific molecules like proteins or small molecules. In some aspects, the aptamer is DNA-based. In other aspects, the aptamer is RNA-based. In some aspects, the aptamer is fused to a DNA or RNA sequence. In some aspects, upon aptamer binding of a specific molecule, DNA can be transcribed into an RNA sequence, which could be an mRNA, gRNA, or RNAzyme. In some aspects, the mRNA is be translated into a protein, which is the reporter molecule or is an activator that can activate a reporter molecule. In other aspects, the transcribed gRNA is bound by a Cas protein, which can activate a reporter molecule. In other aspects, the DNA sequence encodes a DNAzyme, that can activate a reporter molecule.
[0089] In one aspect, the target molecule is small molecule within a sample and can activate an inducible transcription system by binding a transcriptional activator or transcriptional repressor. In some aspects, the inducible transcription system encodes an mRNA, gRNA, or RNAzyme. In some aspects, the mRNA is translated into a protein, which is the reporter molecule or is an activator that can activate a reporter molecule. In other aspects, the transcribed gRNA is bound by a Cas protein, which can activate a reporter molecule. In other aspects, transcribed gRNA is not bound to Cas protein in its inactive state (e.g. riboregulated guide RNAs); however, upon activation by target sequence (e.g. pathogen RNA) the gRNA becomes available to bind to the Cas protein and generate an electrochemical signal.
[0090] In one aspect, by amalgamating programmable molecular circuit-based sensors with electrochemical detection, the molecular circuitry system as described herein is adaptive, broadly capable and has the potential to allow 5-10 multiplexed sensors to operate with parallel but distinct signals.
[0091] In some aspects, the electrode-bound capture molecule is coupled to an enzyme cofactor. In some aspects, the activator/reporter molecule comprises an enzyme that could be any oxidase, reductase, or oxidoreductase and can produce a redox active capture molecule. In other aspects, the redox active reporter molecule continuously produces an electrochemical signal detected by the electrode. In some aspects, the activator/reporter molecule that is an enzyme can inhibit the detection of the electrochemical signal by the electrode.
[0092] In one aspect, the electrode-bound capture molecule could be an aptamer DNA or RNA and is coupled to a redox active molecule. In some aspects, the electrochemical signal is continuously detected by the electrode. In some aspects, the reporter molecule/activator can bind the aptamer and inhibit detection of the electrochemical signal.
[0093] Using DNA-functionalized nanostructured microelectrodes as electrochemical detectors (26,32), the activation of molecular circuits is linked to specifically paired electrodes through the expression of orthogonal reporters (see
[0094] In one aspect, upon activation of the upstream system by a target molecule, nanostructured microelectrodes recruit the reporter molecule to their surface (e.g. redox-active reporterDNA through complementary binding to captureDNA), generating an electrochemical signal. Each sensor system is engineered to produce a unique activator or reporter molecule (e.g. nuclease with sequence-specific cleavage activity that is coupled to a distinct reporter system and capture molecule (e.g. reporter DNA molecule specific - capture DNA pair) for multiplexed signaling.
[0095] In one aspect, the detected electrochemical signals, or change thereof, by the electrodes are transmitted to a processing device, such as a computer. In some aspects, the signals are analyzed by computer-implemented methods such as software. In some aspects, the signals are converted into rich data sets, that may also be used for machine learning applications.
[0096] Taken together, the present description provides a series of proof-of-concept experiments for a direct and scalable interface between engineered molecular circuits and electronics. Interfacing cell-free synthetic biology with electronics will enable engineered gene networks to curate mixed molecular information and rapidly share data with computational tools, a capability that promises to drive more sophisticated and interactive applications. Potential uses include high-content multiplexing systems for decentralized sensing in health, agriculture, national security and industry, among others. Using low-cost electronics, ultimately, we envision this interface to enable dozens of diagnostics to operate for the cost of a single test in our current colorimetric format (<$1/test) (15). Moreover, by simply modifying the upstream molecular sensor elements in the system, the same reporter enzyme-electrode pairs can be left unchanged, along with common microelectrode hardware, to, in principle, serve any sensor application. Toehold switches can be rationally designed (35) and therefore the platform can be tailored to detect virtually any nucleic acid sequence. The stable and biosafe nature of the cell-free format also means that the technology can be used without the limitations of cellular systems, potentially enabling new applications and operating environments outside of the laboratory.
[0097] This approach also holds exciting technical implications for the field of synthetic biology. First, this work highlights the potential for chemistry to enable and mediate signaling for synthetic gene networks, creating a much-needed mechanism for increasing the bandwidth of sensor outputs. This contrasts with conventional reporters, which are optical and have a limited capacity for multiplexing (9,15). While sensing arrays can be contemplated for optical detection (e.g. microarrays), the complexity of these devices and the optics needed for detection are major disadvantages. Second, tackling another key challenge in the field, here we demonstrate that rather than having to encode decision making and memory features genetically into molecular circuits, we can off-load these features to attached electronics. The system continues to take advantage of biology’s incredible capacity to sense, but has the potential to dramatically reduce the time needed to develop synthetic biology applications. With this approach, the underlying connectivity of sensory outputs can be re-programmed at will, easily creating any number of logic calculations (e.g. AND gates, etc.) by simply modifying the code at the level of the software rather than at the level of the DNA. Looking forward, we see this bio-electrochemical approach as providing the field a new enabling venue and one that provides new opportunities for even greater interdisciplinarity and rational design of chemical and biological systems.
EXAMPLES
Example 1: Materials and Methods
1.1 Chip Fabrication
[0098] Microelectrode patterns including reference, counter, and working electrodes were generated using standard contact photolithography techniques from glass substrates layered with chrome, gold, and with or without positive photoresist (AZ1600) obtained from Telic Company or EMF. The working electrodes were nanostructured using electrodeposition in solution of 50 mM AuCl.sub.3 in 0.5 M HCl. Standard three-electrode system with an Ag/AgCl reference electrode and a platinum counter electrode was set up at constant potential of 0 mV for 100 s using Bioanalytical Systems Epsilon potentiostat (West Lafayette, IN, USA). Finally, 100 .Math.m high PDMS channels were fabricated and bonded to chips using standard soft lithography techniques.
1.2 CaptureDNA Deposition
[0099] CaptureDNA strands were obtained from Integrated DNA Technologies containing a 6-carbon linker with a terminal thiol. Final concentrations of 10.5 .Math.M of captureDNA along with 5 .Math.M mercaptohexanol (MCH) were deposited on nanostructured working electrodes, and incubated in a humid environment at room temperature for approximately 14 hr. In order to deposit multiple DNA capture strands on a single chip, Dowsil™ 3145 RTV silicone adhesive sealant (Dowsil, Midland, Michigan, USA) was used to create separate chambers for DNA deposition, and the glue was removed after overnight incubation with the DNA solutions. Chips were then washed 3x with 1x PBS. A solution of 1 mM MCH was added to cover the working electrodes of each chip to backfill any gold surface and prevent nonspecific interaction. After incubation for 3 hr at room temperature, chips were washed 3x with 1x Phosphate-Buffered Saline, pH 7.4 (PBS), then rinsed with ddH2O and dried under a stream of N.sub.2.
1.3 Reporter DNA Preparation
[0100] ReporterDNA was ordered from Integrated DNA Technologies with a terminal amine, which was used for labeling with a methylene blue NHS Ester (Glen Research, Sterling, VA, USA) according to manufacturer’s protocol. Labeled DNA was then purified using reverse phase HPLC, dried via lyophilization, and re-dissolved in 1x PBS. Then reporter and inhibitor DNA strands were annealed at ratio of 1:4 (for initial proof-of-concept experiments) or 1:10 (for multiplexed experiments) in 1x PBS incubated at 95° C. for 4 min. The solutions were then cooled slowly to room temperature.
1.5 Cell-Free Expression of Restriction Enzymes
[0101] All experiments were performed using the recombinant cell-free protein expression system (CFS), PURExpress™ (E6800S, NEB, Ipswich, MA, USA) following manufacturers procedures with an additional 0.5% by volume RNAse inhibitor (M0314S, NEB). All DNA constructs and gene-circuits were designed to be compatible with this cell-free system. Restriction enzyme expression reactions were assembled using 10 nM linear DNA encoding for the restriction enzyme in CFS. To measure restriction enzyme expression and activity electrochemically, the reporterDNA-iDNA complex was added to a final concentration of 100-280 nM reporterDNA. If measurements were to be made in real-time, the solution was then added directly to the electrochemical chips for measurement during incubation at 37° C. Unless otherwise stated, the reactions were incubated at 37° C. for 1 hr before addition to chips. The reactions were then incubated on the chips for 15-30 min at 37° C. before electrochemical measurements were obtained.
[0102] For the restriction enzyme co-expression experiments, we took advantage of the methyl sensitivity of AciI, BsaAI, and HincII. The coding DNA sequences for AciI, ClaI, and EcoRV were methylated to protect against cross cleavage by, BsaAI/HincII, BsaAI, and AciI respectively by combining 10 units of CpG methyltransferase (#M0226M, NEB) with 4 .Math.g of linear DNA at 37° C. overnight in 100 .Math.l 1x NEBuffer™ 2 (NEB). The methylated product was purified using QIAquick™ Spin Columns (#28104, Qiagen, Germantown, Maryland, USA). 30 nM of either methylated (AciI, ClaI, EcoRV) or non-methylated (BsaAI, HincII) coding sequences were used for co-expression and results monitored electrochemically as described above (
1.6 Electrochemical Measurements
[0103] All measurements were performed using either a Bioanalytical Systems Epsilon potentiostat or a PalmSens PSTrace™ potentiostat, both with a three-electrode system. An on-board gold reference electrode was used in addition to a platinum wire auxiliary electrode. The multiplex chip was designed to house both an on-board gold reference and counter electrodes. Square wave voltammetry (SW) signals were obtained with a potential pulse step of 1 mV at a frequency of 60 Hz and an amplitude of 25 mV, with measurements taken from 100 to 450 mV.
1.7 Toehold Switch-based Design and Multiplexed Sensing of MCR Antibiotic Resistances
[0104] A series of toehold switches recognizing synthetic target sequences were used to build toehold-based gene-circuits14 (Table 3). Briefly, each toehold switch was constructed separately with multiple restriction enzymes by overlap extension PCR using the primers. For each construct, both the toehold switch sequence and reporter enzyme were amplified with PCR primers to add ~20 nucleotides that overlap between the two sequences. The overlapping region allows for attachment of the switch to reporter in the second round of PCR using forward and reverse primers. The activity of these toehold switch-based sensors was tested and screened for performance using MB fluorescence assays as described above. Top performing switches were then tested using electrochemical assays. Here reactions for restriction enzyme expression were assembled as described previously in CFS, containing 10 nM linear DNA coding for the respective restriction enzyme under switch-molecular circuit control and 1 .Math.M trigger RNA. Reactions were incubated at 37° C. for 1 hr before adding to electrochemical detection chips, where they were then incubated for 20-60 min before measuring current (
[0105] For proof of concept experiments (
Example 2: Screening for High-Performing Restriction Enzyme-Based Reporters
[0106] The creation of this electrochemical approach to gene circuit-based sensor signaling required that we first identify a set of restriction enzymes capable of rapid and robust performance. We screened 66 commercially available restriction enzymes for cleavage activity under buffer conditions required for the cell-free transcription and translation system (
[0107] Given that restriction enzyme expression and processivity are critical for reporter performance, we developed a fluorescence-based molecular beacon assay to monitor DNA cleavage in real-time as the restriction enzymes were expressed in vitro. The hairpin-based molecular beacons contain a DNA recognition site for each of the respective restriction enzymes and are designed with a 5′ FAM-6 fluorophore and a 3′ BHQ-1 quencher (
Example 3: Electrochemical Detection of Restriction Enzyme-Activated Redox Reporters
[0108] With a set of restriction enzymes established, we next developed the companion electrode and redox reporter systems. Each chip contains an array of fifteen micropatterned electrodes arranged in five sets of three, which were prepared using standard photolithography techniques (
[0109] Release of the complementary reporterDNA is catalyzed by restriction enzyme-dependent cleavage of free-floating DNA duplexes in cell-free reactions (
[0110] Using T7-RNAP expression, we showed that the restriction enzyme-mediated electrochemical signal can be detected in as little as 20 minutes after transcription initiation using square wave voltammetry (
Example 4: Electrochemical Detection of Molecular Circuit-Driven Expression: TetO and Toehold Switches
[0111] With the fundamental components for the electrochemical interface complete, we next developed applications to demonstrate electronic sensing of molecular circuit activation. We began with TetO-regulated expression of a reporter enzyme (
[0112] The multiplexed linkage of molecular circuits to electronics has the potential to enable automated and high-capacity biosensing. We have previously demonstrated that toehold switches can be designed to recognize specific RNA sequences and that these RNA sensors can be used to identify the presence of pathogens (14,15). To explore the potential of multiplexing such sensing capacity, we used six toehold switches designed to recognize six synthetic model sequences (Table 3) (35). Cell-free reactions containing a toehold switch, with or without its respective RNA trigger sequence, were monitored electrochemically at 37° C. on microelectrode arrays containing the complementary captureDNA and free floating reporterDNA duplex. This resulted in the sequence-specific RNA activation of toehold switches and electrochemical outputs that ranged from 7- to 30-fold (
Example 5: Application to Detection of Colistin Antibiotic Resistance Genes
[0113] The overuse of antibiotics has given rise to the growing threat of drug resistance. With the vast majority of antibiotic use related to agricultural settings, farms represent a significant risk for the emergence of resistance (36,37). Here we developed toehold switch-based sensors specific to the coding regions of resistance genes for the key last-line antibiotic colistin (MCR-1, MCR-2, MCR-3 and MCR-4). These genes have recently been identified in livestock globally and represent a dangerous threat to the efficacy of an antibiotic of last resort.
[0114] Using a purpose-built algorithm for toehold switch design (15), each MCR gene was computationally screened for regions of low structural complexity that could be targeted by toehold switches. We then synthesized toehold switch designs complementary to the 24 top ranked binding sites within each MCR gene and ligated a unique reporter enzyme gene to each set of switches (MCR-1_EcoRV, MCR-2_AciI, MCR-3_BanII, MCR-4_ClaI). Reporter enzyme selection was based on the speed of DNA cleavage in time course assays (
[0115] As with other cell-free sensors (15,20), we next used isothermal amplification (1 hour) to specifically amplify target sequences before adding the sample to cell-free reactions containing toehold sensors. The limit of detection (LOD) without an amplification step was determined through on-chip sensing of MCR-1 at RNA concentrations between 10 nM and 150 nM using 200 nM MCR-1_EcoRV switch following the experimental design described above. These measurements yielded a calculated LOD of 64.5 nM. With the addition of a Nucleic Acid Sequence Based Amplification (NASBA) step upstream of the electrochemical workflow, we were able to extend the detection of the antibiotic resistance gene MCR-4 to the low femtomolar range (1 fM), an improvement of many orders of magnitude (-107). In these experiments, MCR-4 RNA at 1 fM was added to a NASBA reaction (1 hr) and this amplified RNA was then added to cell-free reactions at 14% of total cell-free reaction volume. Here the combined workflow led to a robust increase in electrochemical signal on-chip after 120 minutes of incubation at 37° C. This level of performance compares well with the turnaround time and sensitivity of other recently published cell-free synthetic biology-based detection schemes (2-3 hours) (15,38).
[0116] Finally, with a long-term goal of applying this approach to the interrogation of real-world samples, we wanted to determine the capacity of our on-chip detection for more complex samples. Here the MCR-4 gene was expressed in E. coli and then total RNA was collected from the resulting culture. In total, cellular RNA was added to the NASBA reaction (1 hr) at concentration of 30 ng/.Math.l for isothermal amplification using MCR-4 specific primers. The amplified MCR-4 mix was added without purification to the cell-free reactions containing (MCR-4_ClaI switch), followed by 30 minutes of off-chip, and 15 minutes of on-chip incubation at 37° C. prior to taking the first electrochemical measurement (
REFERENCES
[0117] 1. Cameron, D. E., Bashor, C. J. & Collins, J. J. A brief history of synthetic biology. Nat. Rev. Microbiol. 12, 381-90 (2014). [0118] 2. Cheng, A. A. & Lu, T. K. Synthetic biology: an emerging engineering discipline. Annu. Rev. Biomed. Eng. 14, 155-78 (2012). [0119] 3. Fossati, E. et al. Reconstitution of a 10-gene pathway for synthesis of the plant alkaloid dihydrosanguinarine in Saccharomyces cerevisiae. Nat. Commun. 5, 3283 (2014). [0120] 4. Smanski, M. J. et al. Synthetic biology to access and expand nature’s chemical diversity. Nat. Rev. Microbiol. 14, 135-49 (2016). [0121] 5. Green, A. A. et al. Complex cellular logic computation using ribocomputing devices. Nature 548, 117-121 (2017). [0122] 6. Yehl, K. & Lu, T. Scaling Computation and Memory in Living Cells. Curr. Opin. Biomed. Eng. 4, 143-151 (2017). [0123] 7. Kitada, T., DiAndreth, B., Teague, B. & Weiss, R. Programming gene and engineered-cell therapies with synthetic biology. Science 359, eaad1067 (2018). [0124] 8. Mao, N., Cubillos-Ruiz, A., Cameron, D. E. & Collins, J. J. Probiotic strains detect and suppress cholera in mice. Sci. Transl. Med. 10, eaao2586 (2018). [0125] 9. Kotula, J. W. et al. Programmable bacteria detect and record an environmental signal in the mammalian gut. Proc. Natl. Acad. Sci. U. S. A. 111, 4838-43 (2014). [0126] 10. Keasling, J. D. Synthetic biology and the development of tools for metabolic engineering. Metab. Eng. 14, 189-95 (2012). [0127] 11. Shimizu, Y. et al. Cell-free translation reconstituted with purified components. Nat. Biotechnol. 19, 751-755 (2001). [0128] 12. Jewett, M. C., Calhoun, K. A., Voloshin, A., Wuu, J. J. & Swartz, J. R. An integrated cell-free metabolic platform for protein production and synthetic biology. Mol. Syst. Biol. 4, 220 (2008). [0129] 13. Shin, J., Jardine, P. & Noireaux, V. Genome replication, synthesis, and assembly of the bacteriophage T7 in a single cell-free reaction. ACS Synth. Biol. 1, 408-413 (2012). [0130] 14. Pardee, K. et al. Paper-based synthetic gene networks. Cell 159, 940-954 (2014). [0131] 15. Pardee, K. et al. Rapid, Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell 165, 1255-1266 (2016). [0132] 16. Pardee, K. et al. Portable, On-Demand Biomolecular Manufacturing. Cell 167, 248-259.e12 (2016). [0133] 17. Huang, A. et al. BioBitsTM Explorer: A modular synthetic biology education kit. Sci. Adv. 4, eaat5105 (2018). [0134] 18. Stark, J. C. et al. BioBitsTM Bright: A fluorescent synthetic biology education kit. Sci. Adv. 4, eaat5107 (2018). [0135] 19. Wen, K. Y. et al. A Cell-Free Biosensor for Detecting Quorum Sensing Molecules in P. aeruginosa -Infected Respiratory Samples. ACS Synth. Biol. 6, 2293-2301 (2017). [0136] 20. Takahashi, M. K. et al. A low-cost paper-based synthetic biology platform for analyzing gut microbiota and host biomarkers. Nat. Commun. 9, 3347 (2018). [0137] 21. Alligrant, T. M., Nettleton, E. G. & Crooks, R. M. Lab on a Chip Electrochemical detection of individual DNA. Lab Chip 349-354 (2013). Doi:10.1039/c21c40993c [0138] 22. Fan, C., Plaxco, K. W. & Heeger, A. J. Electrochemical interrogation of conformational changes as a reagentless method for the sequence-specific detection of DNA. Proc. Natl. Acad. Sci. 100, 9134—9137 (2003). [0139] 23. Khan, H. U. et al. In situ, label-free DNA detection using organic transistor sensors. Adv. Mater. 22, 4452-4456 (2010). [0140] 24. Patolsky, F., Lichtenstein, A. & Willner, I. Detection of single-base DNA mutations by enzyme-amplified electronic transduction. Nat. Biotechnol. 19, 253-257 (2001). [0141] 25. Slinker, J. D., Muren, N. B., Gorodetsky, A. A. & Barton, J. K. Multiplexed DNA-modified electrodes. J. Am. Chem. Soc. 132, 2769-74 (2010). [0142] 26. Das, J. et al. An ultrasensitive universal detector based on neutralizer displacement. Nat. Chem. 4, 642-8 (2012). [0143] 27. Zuo, X., Xiao, Y. & Plaxco, K. W. High Specificity, Electrochemical Sandwich Assays Based on Single Aptamer Sequences and Suitable for the Direct Detection of Small-Molecule Targets in Blood and Other Complex Matrices. J. Am. Chem. Soc. 131, 6944-6945 (2009). [0144] 28. Kuang, Z., Kim, S. N., Crookes-goodson, W. J., Farmer, B. L. & Naik, R. R. Biomimetic Chemosensor : Designing Peptide Recognition Elements for Surface Functionalization of Carbon Nanotube Field Effect Transistors. ACS Nano 4, 452-458 (2010). [0145] 29. Liu, H., Xiang, Y., Lu, Y. & Crooks, R. M. Aptamer-Based Origami Paper Analytical Device for Electrochemical Detection of Adenosine. Angew. Chemie Int. Ed. 51, 6925-6928 (2012). [0146] 30. Das, J. & Kelley, S. O. Protein Detection Using Arrayed Microsensor Chips: Tuning Sensor Footprint to Achieve Ultrasensitive Readout of CA-125 in Serum and Whole Blood. Anal. Chem. 83, 1167-1172 (2011). [0147] 31. Tang, D., Yuan, R. & Chai, Y. Ultrasensitive Electrochemical Immunosensor for Clinical Immunoassay Using Thionine-Doped Magnetic Gold Nanospheres as Labels and Horseradish Peroxidase as Enhancer. Anal. Chem. 80, 1582-1588 (2008). [0148] 32. Sage, A. T., Besant, J. D., Lam, B., Sargent, E. H. & Kelley, S. O. Ultrasensitive electrochemical biomolecular detection using nanostructured microelectrodes. Acc. Chem. Res. 47, 2417-25 (2014). [0149] 33. Li, J. J., Geyer, R. & Tan, W. Using molecular beacons as a sensitive fluorescence assay for enzymatic cleavage of single-stranded DNA. Nucleic Acids Res. 28, E52 (2000). [0150] 34. Soleymani, L., Fang, Z., Sargent, E. H. & Kelley, S. O. Programming the detection limits of biosensors through controlled nanostructuring. Nat. Nanotechnol. 4, 844-848 (2009). [0151] 35. Green, A. A., Silver, P. A., Collins, J. J. & Yin, P. Toehold switches: de-novo-designed regulators of gene expression. Cell 159, 925-939 (2014). [0152] 36. Zhang, J. et al. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 8, 3705 (2018). [0153] 37. Garcia, V. et al. Co-occurrence of mcr-1, mcr-4 and mcr-5 genes in multidrug-resistant ST10 Enterotoxigenic and Shiga toxin-producing Escherichia coli in Spain (2006-2017). Int. J. Antimicrob. Agents 52, 104-108 (2018). [0154] 38. Gootenberg, J. S. et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356, 438-442 (2017). [0155] 39. 3Karig DK, Iyer S, Simpson ML, Doktycz MJ. Expression optimization and synthetic gene networks in cell-free systems. Nucleic Acids Res. 40, 3763-3774 (2012). [0156] 40. J. N. Zadeh, C. D. Steenberg, J. S. Bois, B. R. Wolfe, M. B. Pierce, A. R. Khan, R. M. Dirks & N. A. Pierce, “NUPACK: Analysis and design of nucleic acid systems,” Journal of computational chemistry 32, 170-173 (2011). [0157] 41. Davis JH, Rubin AJ, Sauer RT. Design, construction and characterization of a set of insulated bacterial promoters. Nucleic Acids Res. 2011;39(3):1131-41. 10.1093/nar/gkq810